ID: 1018246015

View in Genome Browser
Species Human (GRCh38)
Location 6:161824701-161824723
Sequence AACTGCGTGTAGCAATGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018246014_1018246015 14 Left 1018246014 6:161824664-161824686 CCAGTGACTAAATTGCTACATTT 0: 1
1: 0
2: 0
3: 11
4: 175
Right 1018246015 6:161824701-161824723 AACTGCGTGTAGCAATGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018246015 Original CRISPR AACTGCGTGTAGCAATGAAC AGG Intronic
No off target data available for this crispr