ID: 1018250294

View in Genome Browser
Species Human (GRCh38)
Location 6:161862734-161862756
Sequence CCTTCCATTCAGAGGCGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018250290_1018250294 6 Left 1018250290 6:161862705-161862727 CCTTAGAATCAAAGGCTGGTGGC 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1018250294 6:161862734-161862756 CCTTCCATTCAGAGGCGAGAAGG No data
1018250285_1018250294 30 Left 1018250285 6:161862681-161862703 CCAGCTACAAATGGGAGGTTTGT 0: 1
1: 0
2: 1
3: 11
4: 93
Right 1018250294 6:161862734-161862756 CCTTCCATTCAGAGGCGAGAAGG No data
1018250288_1018250294 7 Left 1018250288 6:161862704-161862726 CCCTTAGAATCAAAGGCTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1018250294 6:161862734-161862756 CCTTCCATTCAGAGGCGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018250294 Original CRISPR CCTTCCATTCAGAGGCGAGA AGG Intronic
No off target data available for this crispr