ID: 1018250294 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:161862734-161862756 |
| Sequence | CCTTCCATTCAGAGGCGAGA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018250290_1018250294 | 6 | Left | 1018250290 | 6:161862705-161862727 | CCTTAGAATCAAAGGCTGGTGGC | 0: 1 1: 0 2: 1 3: 9 4: 106 |
||
| Right | 1018250294 | 6:161862734-161862756 | CCTTCCATTCAGAGGCGAGAAGG | No data | ||||
| 1018250285_1018250294 | 30 | Left | 1018250285 | 6:161862681-161862703 | CCAGCTACAAATGGGAGGTTTGT | 0: 1 1: 0 2: 1 3: 11 4: 93 |
||
| Right | 1018250294 | 6:161862734-161862756 | CCTTCCATTCAGAGGCGAGAAGG | No data | ||||
| 1018250288_1018250294 | 7 | Left | 1018250288 | 6:161862704-161862726 | CCCTTAGAATCAAAGGCTGGTGG | 0: 1 1: 0 2: 0 3: 13 4: 110 |
||
| Right | 1018250294 | 6:161862734-161862756 | CCTTCCATTCAGAGGCGAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018250294 | Original CRISPR | CCTTCCATTCAGAGGCGAGA AGG | Intronic | ||
| No off target data available for this crispr | |||||