ID: 1018250529

View in Genome Browser
Species Human (GRCh38)
Location 6:161865424-161865446
Sequence GATAAAAAAAAATCGATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 0, 2: 9, 3: 70, 4: 616}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018250529_1018250531 -1 Left 1018250529 6:161865424-161865446 CCAGGAATCGATTTTTTTTTATC 0: 1
1: 0
2: 9
3: 70
4: 616
Right 1018250531 6:161865446-161865468 CCAACTATGAAAGTCCTAGATGG 0: 1
1: 35
2: 284
3: 606
4: 800
1018250529_1018250533 19 Left 1018250529 6:161865424-161865446 CCAGGAATCGATTTTTTTTTATC 0: 1
1: 0
2: 9
3: 70
4: 616
Right 1018250533 6:161865466-161865488 TGGCATCTTTTTACAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018250529 Original CRISPR GATAAAAAAAAATCGATTCC TGG (reversed) Intronic
901518507 1:9765583-9765605 GAAAAAAAAAAATGGAGGCCAGG + Intronic
902667608 1:17950602-17950624 GAAAAAAAAAAATGGATAGCTGG - Intergenic
903436415 1:23353216-23353238 AAAAAAAAAAAATCCATTCGAGG + Intergenic
903510735 1:23873228-23873250 AATAAAATAAAATAGATCCCAGG - Exonic
903910464 1:26720875-26720897 GAAAAAAAAAAAAAGATTCCTGG + Intronic
907368346 1:53980891-53980913 AATAAAATAAGATAGATTCCTGG - Intergenic
907444339 1:54498469-54498491 GAAAAAAAAAATTCAATTACTGG - Intergenic
908134591 1:61117509-61117531 GAAAAAAAAATGTAGATTCCTGG + Intronic
908164603 1:61446025-61446047 TAGAAAAAAAAAATGATTCCTGG + Intronic
908280005 1:62523402-62523424 TATATAAAAAAATCTATTTCAGG + Intronic
908474400 1:64473322-64473344 GAAAAAAAAAAGTCGAATGCAGG + Intronic
909006594 1:70283519-70283541 AAGAAAAAAAAATCCATGCCGGG + Intronic
909299883 1:73999113-73999135 GAAAAATAAAAAATGATTCCAGG - Intergenic
909301434 1:74017658-74017680 GAGAAAAAAAAATTGATCCCTGG - Intergenic
910078895 1:83315395-83315417 GATAGAAAGAAATTGTTTCCTGG + Intergenic
911100281 1:94090178-94090200 GAGAAAACAAAACTGATTCCTGG - Intronic
911285459 1:95986682-95986704 GATAAAAGCAAATCCATTCCAGG + Intergenic
911349935 1:96741169-96741191 AAAAAAAAAACATTGATTCCTGG + Intronic
911824124 1:102459884-102459906 GTTAAAAAAAAAACTATACCTGG - Intergenic
912026599 1:105182936-105182958 CATTAAAAAAAATAGATTCAGGG + Intergenic
912193323 1:107367265-107367287 TTTAAAAAAAAATCAATTTCAGG - Intronic
912282255 1:108328147-108328169 GATAAGAAATAATAGATTTCTGG - Intergenic
912326892 1:108773827-108773849 GAGGAAAAAAAAAAGATTCCTGG - Intronic
913139439 1:115926159-115926181 AAAAAAAAAAAAATGATTCCCGG - Intergenic
915156161 1:153878154-153878176 GAAAAAAAAAAAAAGATTGCAGG - Intronic
916395141 1:164378868-164378890 GATAGACAAACATCGATCCCAGG + Intergenic
917870829 1:179240508-179240530 AAAAAAAAAAAATGGATTTCAGG + Intergenic
918141922 1:181726950-181726972 AAGAAACAAAAATCGATCCCAGG + Intronic
918394896 1:184103446-184103468 GATTAAATATAATCTATTCCTGG - Intergenic
918468163 1:184842771-184842793 AAAAAAAAAAAATCCATTCTTGG + Intronic
919875782 1:201866683-201866705 ATTAAAAAAAATTCAATTCCTGG - Intronic
920138399 1:203789288-203789310 GGAAAAAATAAATCAATTCCAGG - Intergenic
920724740 1:208423581-208423603 AAAAAAAAAAAAAAGATTCCAGG + Intergenic
921335256 1:214079295-214079317 AGGAAAAAAAAATCAATTCCTGG + Intergenic
922144839 1:222931677-222931699 AAAAAAAAAAAAAAGATTCCTGG - Intronic
922282945 1:224143242-224143264 GAGAAAAAAAAATCAGTTCCCGG + Intronic
923239771 1:232071809-232071831 AATAAAAAAAAATTGCCTCCTGG - Intergenic
923354138 1:233137130-233137152 GGGAAAACAAAATGGATTCCTGG + Intronic
923607903 1:235461374-235461396 AAGGAAAAAAAATAGATTCCTGG - Intronic
923978501 1:239293524-239293546 GAAAAAAAATAATTTATTCCTGG + Intergenic
1063235255 10:4107854-4107876 GAAAAAAAAATAACGTTTCCAGG - Intergenic
1063340544 10:5259303-5259325 GGAAAAAAAAAATCAATTCCTGG + Intergenic
1063661896 10:8040207-8040229 AGAAAAAAAAAATCAATTCCTGG - Intergenic
1063931419 10:11032160-11032182 AAAAAAAAAAAATTGCTTCCAGG + Intronic
1064182000 10:13125912-13125934 GATATTAAAAAATGGAATCCTGG - Intronic
1064317479 10:14271554-14271576 GAAAAAGAAAAATCACTTCCTGG - Intronic
1064902334 10:20308940-20308962 CATAAACAAAAATCCCTTCCTGG - Intergenic
1064910499 10:20396180-20396202 GATGAAAAATAAAAGATTCCAGG + Intergenic
1064999130 10:21321149-21321171 AAAAAAAAAAAATCAGTTCCTGG + Intergenic
1065228497 10:23572007-23572029 ATTAAAAAAAAATCAAATCCTGG + Intergenic
1065391378 10:25185806-25185828 GAGAAAAAAAAAAAAATTCCTGG + Intronic
1065777303 10:29132763-29132785 AATAGAAAAAAATCTGTTCCAGG + Intergenic
1066053449 10:31659098-31659120 TTTAAAAAAAAATAGATTCCTGG - Intergenic
1067124723 10:43506516-43506538 AATAAAATAAAATAAATTCCAGG + Intergenic
1068680331 10:59812467-59812489 AAAAAAAAAAATTCCATTCCAGG + Intronic
1069186191 10:65426429-65426451 AATAAAATAAAACAGATTCCAGG + Intergenic
1069316581 10:67111695-67111717 GATAAAAAGAAATCCACTACAGG + Intronic
1069321413 10:67176171-67176193 GATAAAAAAGAATTTATTTCTGG + Intronic
1069477277 10:68745760-68745782 GAAAAAAAAAAATAGTTGCCGGG - Intronic
1069600012 10:69698184-69698206 GATAAAAAGAAATCCACACCAGG - Intergenic
1070031152 10:72678685-72678707 GTAAAAAAAGAATCAATTCCTGG - Intergenic
1070050185 10:72881238-72881260 TATAAACAAAAATAAATTCCAGG + Intronic
1070176323 10:73973160-73973182 AAAAAAAAAAAATCAATTCATGG + Intergenic
1070559791 10:77557635-77557657 AAAAAAAAAAAATCACTTCCTGG - Intronic
1071429025 10:85591092-85591114 CATACTAAAAAATTGATTCCAGG + Intergenic
1071890244 10:89997752-89997774 AATAATAAAAAATAGATACCAGG - Intergenic
1072090715 10:92124595-92124617 GAAAAAAAAAAATCAGGTCCTGG - Intronic
1073665580 10:105529851-105529873 AAAAAAAAAAAAACTATTCCAGG - Intergenic
1073708751 10:106015813-106015835 GATGAAAAAAAAACATTTCCTGG - Intergenic
1073868596 10:107834262-107834284 AAAAAAAAAAAATCTATCCCTGG + Intergenic
1074931268 10:118128623-118128645 GATCAAAAAAAATCTACTCTTGG - Intergenic
1075492278 10:122881516-122881538 AGTAAAAAAAAATTGTTTCCAGG - Intergenic
1075820600 10:125305240-125305262 AAGAAAAAACAATTGATTCCCGG - Intergenic
1076286584 10:129304574-129304596 AAAAAAAAAAAAAAGATTCCTGG + Intergenic
1076897683 10:133321554-133321576 CAAAAAAAAAAATCCATTCTCGG - Intronic
1077654839 11:4008842-4008864 ATGAAAAAAAAATCAATTCCTGG - Intronic
1077668358 11:4136518-4136540 AATAAAATAAAATACATTCCTGG - Intronic
1078146375 11:8724296-8724318 AAAAAAAAAAAAAAGATTCCAGG + Intronic
1078742725 11:14082186-14082208 GAAAAAAAAAAATTGTTTCTGGG + Intronic
1079525443 11:21381894-21381916 AAAAAAAAAAAATCCCTTCCAGG - Intronic
1080992407 11:37553840-37553862 CATAAGAAAAAATTGATTCCAGG + Intergenic
1081391805 11:42538503-42538525 GAGAAAAAAATAACAATTCCAGG + Intergenic
1081886441 11:46501190-46501212 GAGGGAAAAAAATCAATTCCTGG + Intronic
1082181300 11:49123016-49123038 GCTAAAAAAAAATAGCTTCTAGG - Intergenic
1082642757 11:55685305-55685327 AAAAAAAAAAACTCAATTCCAGG - Intergenic
1083405065 11:62451075-62451097 AAAAAAAAAAAAAAGATTCCAGG - Intronic
1084366211 11:68701889-68701911 GATAGCAAAAAACTGATTCCTGG + Intergenic
1084493552 11:69490991-69491013 GATAAAAAAGAAACGATGGCTGG - Intergenic
1085359451 11:75873328-75873350 TAAAAAAAAAAAACTATTCCTGG - Intronic
1085931709 11:81091444-81091466 GATGGAAAAAATTCAATTCCTGG + Intergenic
1086471031 11:87110463-87110485 AAAAAAAAAAAATTGAATCCTGG + Intronic
1086664147 11:89458793-89458815 GTTAAAAAATAACAGATTCCGGG + Intronic
1086684188 11:89711831-89711853 GCTAAAAAAAAATAGCTTCTAGG + Intronic
1086803184 11:91203275-91203297 TATATTAAAAAATCAATTCCAGG - Intergenic
1087051821 11:93893433-93893455 GTTAAACAGAAATCAATTCCAGG - Intergenic
1087346080 11:96972928-96972950 GATAAAAAAAAGTTGATTCCTGG - Intergenic
1087544980 11:99573626-99573648 AATAGAAAAAAATTCATTCCTGG - Intronic
1087691277 11:101323358-101323380 GAGAGAAAAAAATGGATCCCAGG + Intergenic
1088242330 11:107785305-107785327 GAGAAAAAAAAATCTAGTGCGGG - Intergenic
1088289105 11:108217009-108217031 GAGAGAAAAAAATCAATTTCTGG + Intronic
1088935395 11:114394706-114394728 GATTAAAAAAAGTCAATACCTGG - Intronic
1089423466 11:118349865-118349887 GATAAAAAAAAATGGAATCTGGG + Exonic
1089776912 11:120844157-120844179 GGGAAAAAATAATTGATTCCAGG + Intronic
1090014082 11:123069820-123069842 GATAAACAAATTTCCATTCCAGG + Intergenic
1090659539 11:128871851-128871873 GATAAACAAAAAGCCTTTCCAGG + Intergenic
1090679066 11:129033734-129033756 CATACACAAAAATCCATTCCAGG - Intronic
1092371929 12:7923758-7923780 AAAAAAAAAAAATCCAATCCTGG - Intronic
1092613066 12:10191746-10191768 GATAAAAACAAAGCCATTTCAGG - Exonic
1092909199 12:13131423-13131445 GAGGAAAAATAATCGCTTCCTGG + Intronic
1092948476 12:13478316-13478338 CATACACAAAAATCAATTCCTGG + Intergenic
1093611213 12:21160496-21160518 GGAAAAAAAAAATCAACTCCAGG + Intronic
1094579047 12:31717000-31717022 TAAAAAAAAAAATCAGTTCCTGG - Intronic
1094780857 12:33790127-33790149 GAGGAAAAAAAATGGCTTCCTGG - Intergenic
1094782806 12:33812378-33812400 GACAAAAAAAATTTGATTCAGGG - Intergenic
1095401240 12:41816750-41816772 GAGAAAACAAAATTGATTCTTGG - Intergenic
1095513694 12:42982235-42982257 GAGAAAAAGAAATCCATTCATGG - Intergenic
1096344311 12:50831848-50831870 CATACACAAAAATCAATTCCAGG + Intergenic
1097490364 12:60261093-60261115 AATAAATAAAACTGGATTCCTGG - Intergenic
1099383764 12:81988925-81988947 GATTAACAAAAATAGACTCCTGG - Intergenic
1099988091 12:89692361-89692383 GAAAAAACAAAATCAATTCCAGG + Intronic
1100255875 12:92882400-92882422 GAAAAAAAAAAAAAGATGCCAGG - Intronic
1100328512 12:93564650-93564672 GATAAAAAAAAGTGGATCCAGGG + Intergenic
1100485327 12:95019678-95019700 CATAAAAAAAAATAGATTGGTGG - Intergenic
1100696739 12:97102255-97102277 AATAAAATAAAATAAATTCCCGG - Intergenic
1101002158 12:100367521-100367543 AATAAAAAATTATCCATTCCAGG - Intronic
1101258945 12:103009498-103009520 AAAAAAAAAAAAAAGATTCCTGG + Intergenic
1101518778 12:105462554-105462576 GCTAAAAAAAAAAAAATTCCAGG + Intergenic
1101733008 12:107442061-107442083 GTTTAAAAAACATTGATTCCAGG - Intronic
1102100786 12:110277194-110277216 GAAAAAAAAAAGTCTCTTCCCGG - Intergenic
1102119290 12:110428616-110428638 AATAAAAAAAAATCCTTTTCTGG - Intergenic
1102365720 12:112332548-112332570 AAAAAAAAAAAAAAGATTCCTGG + Intronic
1102513111 12:113428911-113428933 CAAAAAAAAAAAACAATTCCAGG - Intronic
1103170980 12:118819721-118819743 TATATACAAAAATCAATTCCAGG - Intergenic
1103441645 12:120967380-120967402 GTTAAAAAAAATCAGATTCCAGG - Intergenic
1103589846 12:121983898-121983920 GATTAAAAAAAATCTTTTCAGGG + Intronic
1104413812 12:128581247-128581269 TAAAAAAAAAAAAAGATTCCCGG - Intronic
1104598773 12:130138442-130138464 CTGTAAAAAAAATCGATTCCCGG - Intergenic
1104873886 12:132019540-132019562 CAAAAAAAAAAATCAAATCCAGG + Intronic
1105037256 12:132934709-132934731 AAAAAAAAAAAAAAGATTCCAGG + Intronic
1105451950 13:20507938-20507960 GAAAAAAAAAAGTCCATGCCTGG + Intronic
1106078294 13:26479556-26479578 AAAAAAAAAAAATGGATTCAGGG + Intergenic
1106089556 13:26577722-26577744 GAAAAAAAAAAATCAAAACCAGG + Intronic
1107048127 13:36015700-36015722 GAAAGAAAGAAATGGATTCCAGG - Intronic
1107625420 13:42276901-42276923 GATAAAAAGAAATGTGTTCCTGG + Intronic
1108224664 13:48275890-48275912 AAAAAAAAAAAAAGGATTCCTGG + Intergenic
1108480562 13:50866100-50866122 GAAAAAAAGAAATCACTTCCTGG + Intergenic
1108773985 13:53740701-53740723 TATATACAAAAATCAATTCCAGG + Intergenic
1109042722 13:57360503-57360525 AAAAAAAAAAAATCAAGTCCTGG - Intergenic
1109042931 13:57364575-57364597 GTTACAAAAAAACAGATTCCAGG - Intergenic
1109377248 13:61512009-61512031 GATAGAAAAACATCATTTCCAGG + Intergenic
1109850980 13:68062865-68062887 GATAAAAAAAAATAAATACAGGG - Intergenic
1110415510 13:75247312-75247334 GATTAAAAAATATCTATTCTGGG - Intergenic
1110965379 13:81688658-81688680 GAGAAAAAAAAATTGACTCCCGG + Intergenic
1111230144 13:85334678-85334700 GCATAAATAAAATCGATTCCAGG + Intergenic
1111536351 13:89606999-89607021 AAAAAAAAAAAATGGTTTCCTGG - Intergenic
1111611447 13:90613296-90613318 GATAAAAAAAAATGTATTGCTGG + Intergenic
1112714288 13:102165826-102165848 AATAAAAGAAAGTAGATTCCTGG + Intronic
1112734621 13:102402179-102402201 TATAAAAAAAAATCGACACTGGG - Intergenic
1113112888 13:106843140-106843162 AATAAAAAAAATTTGATTTCAGG + Intergenic
1113204411 13:107898524-107898546 GGTAAAAAAAACACGATTTCTGG - Intergenic
1114448760 14:22810468-22810490 AAAAAAAAAAAATAGATTTCTGG + Intronic
1114572328 14:23680640-23680662 AAAAAAAAAAAATCCATTTCTGG - Intergenic
1114872172 14:26671893-26671915 AAAAAAAAAAAATCCATTTCTGG - Intergenic
1114932982 14:27497757-27497779 TATGAAGAAAAATGGATTCCAGG - Intergenic
1116089998 14:40293055-40293077 AATAAAAACAAATCAATACCAGG - Intergenic
1116240226 14:42332164-42332186 AAAAAAAAAAAATAGAATCCTGG + Intergenic
1116281322 14:42912659-42912681 GATAAAAACAGATAGATACCTGG - Intergenic
1117425588 14:55592249-55592271 AAGAAACAAAAATCAATTCCAGG - Intronic
1117691349 14:58310705-58310727 AAAAAAAAAAAATCAATGCCCGG - Intronic
1117749189 14:58902894-58902916 GGCAGAAAAAAATCGTTTCCTGG + Intergenic
1118083523 14:62388870-62388892 GATAAAAAAAAATTGAATTTTGG + Intergenic
1118669320 14:68105105-68105127 AAAAAAAAAAAAAAGATTCCTGG - Intronic
1118755218 14:68838201-68838223 GATAAATAAAAATCATTTTCAGG + Intergenic
1119268339 14:73278713-73278735 AAAAAAAAAAAAAAGATTCCAGG - Intronic
1119686585 14:76637458-76637480 AAAAAAAAAAAATGGAATCCAGG + Intergenic
1120631238 14:86893338-86893360 GATAAAAAATAATCTTGTCCTGG - Intergenic
1120671372 14:87366304-87366326 GATAAAAAAAAGTGGATGGCAGG - Intergenic
1121140541 14:91537840-91537862 GATGAGAAAAAATCGATTCCTGG - Intergenic
1121291735 14:92781320-92781342 CATACAAAAAAATCCATTTCAGG + Intergenic
1121542971 14:94742363-94742385 GATAAAAAAAAATGCTTTCACGG + Intergenic
1121696035 14:95913089-95913111 GGTAAAAAAAAAAAGATGCCCGG - Intergenic
1121876128 14:97455280-97455302 GAGAAAAAAAAATTGGTTCCTGG + Intergenic
1122358772 14:101143872-101143894 AATAAAATAAAATAAATTCCTGG + Intergenic
1123499818 15:20869660-20869682 GAGAGAAAAAAATATATTCCAGG + Intergenic
1123557067 15:21443357-21443379 GAGAGAAAAAAATATATTCCAGG + Intergenic
1123593291 15:21880626-21880648 GAGAGAAAAAAATATATTCCAGG + Intergenic
1124361470 15:29039563-29039585 GTTTAAAAAATATCAATTCCTGG - Intronic
1124591232 15:31055313-31055335 GAAAAAGAAAAATCTATTTCAGG + Intronic
1125130242 15:36276067-36276089 TAAAAATAAAAATCAATTCCAGG - Intergenic
1125312919 15:38400157-38400179 GAGGAAAAGAAATCAATTCCTGG + Intergenic
1126078672 15:44937721-44937743 TTTAAAAAAAAATCTACTCCTGG - Intergenic
1126115955 15:45207768-45207790 GATAAAAAAAAATGGATATGAGG + Intergenic
1126253591 15:46598178-46598200 GAAACAAAATAATCAATTCCTGG + Intergenic
1127094110 15:55495749-55495771 AATTAAAAAAAATAAATTCCAGG + Intronic
1127470722 15:59287624-59287646 GAGGAAGAAAAATGGATTCCTGG + Intronic
1127788111 15:62373989-62374011 GATATAAAAAAATACATTCTAGG + Intergenic
1127860910 15:62993745-62993767 AAAAAAAAAAAAAAGATTCCAGG + Intergenic
1128113685 15:65092479-65092501 CATAAAACAAAACAGATTCCTGG + Intergenic
1128157248 15:65399458-65399480 AAAAAAAAAAAAAAGATTCCTGG + Intronic
1128175509 15:65551944-65551966 GAAAAAAAAAAAAAGAATCCTGG + Intronic
1128417246 15:67458061-67458083 GATAAAACAGAATCAGTTCCTGG - Intronic
1128779127 15:70346419-70346441 AAAAAAAAAAAATAGATTGCTGG - Intergenic
1129567232 15:76635423-76635445 AGGAAAAAAAAATCAATTCCTGG - Intronic
1130041739 15:80410738-80410760 GATAAAAATGAATGGATTGCTGG - Intronic
1130301910 15:82686716-82686738 AAAAAAAAAAAATTGATTTCAGG - Intronic
1130558612 15:84941503-84941525 GTTAAAAAAAAAACAAATCCCGG - Intronic
1131501623 15:92972859-92972881 AAAAAAAAAAAAAAGATTCCAGG + Intronic
1131702433 15:94953362-94953384 AATAAAAAGAAATCCAGTCCTGG - Intergenic
1131852730 15:96560034-96560056 GAGAAAATAAAATCAATTACTGG - Intergenic
1132102503 15:99034565-99034587 GTAAAAAAAAAATCGATCCGGGG - Intergenic
1202965411 15_KI270727v1_random:170545-170567 GAGAGAAAAAAATATATTCCAGG + Intergenic
1132940501 16:2504746-2504768 GTAAAAATTAAATCGATTCCTGG - Intronic
1133244324 16:4437629-4437651 AATAAAAAAAAAGAGATTCCAGG + Intronic
1134436871 16:14267757-14267779 AATAAAAAAAAATCTGTTGCAGG - Intergenic
1135171179 16:20185224-20185246 AAAAAAAAAAAAAAGATTCCAGG - Intergenic
1135661675 16:24302438-24302460 AATAAAAAAAAATCAATACCTGG - Intronic
1135879058 16:26235589-26235611 AAAAAAAAAAAAGCCATTCCTGG + Intergenic
1135886201 16:26310480-26310502 GATAAAAGAAAAGCGAGGCCTGG - Intergenic
1135948972 16:26894498-26894520 TATACACAAAAATCAATTCCAGG - Intergenic
1136387718 16:29940096-29940118 GAAAAAAAAAAATCCAGGCCGGG - Intergenic
1137366071 16:47860812-47860834 AAGAAAAAGAAATCAATTCCAGG + Intergenic
1137438320 16:48476729-48476751 GACAAAAAAAAATCTTTTCTAGG - Intergenic
1137987623 16:53123161-53123183 AAAAAAAAAAAAGTGATTCCAGG - Intronic
1137993023 16:53179311-53179333 GATAAAAAAAAATTAACTGCTGG - Intronic
1138185995 16:54978057-54978079 GAGAAAAAAAAATGGATTCCTGG - Intergenic
1138536900 16:57665162-57665184 AAAAAAAAAAAATCGACTGCTGG + Exonic
1139110543 16:63885526-63885548 AAAAAAAAAAAATGGTTTCCTGG + Intergenic
1139138058 16:64228949-64228971 TATTAAAAAAAATAGATTCAGGG + Intergenic
1139554230 16:67696311-67696333 AAAAAAAAAAAAAAGATTCCCGG - Intronic
1139624040 16:68170786-68170808 AATAAAAGAAAATCGAGGCCGGG - Intronic
1140286758 16:73610204-73610226 GAAAAAAAAATAGCGATTCAGGG + Intergenic
1140382859 16:74506071-74506093 AAAAAAAAAAAATCTTTTCCAGG - Intronic
1140448261 16:75049302-75049324 GACATAAAAAAAAGGATTCCAGG - Intronic
1141347864 16:83264176-83264198 GATGAAAAAAAATGTATTCAGGG - Intronic
1143450498 17:7033860-7033882 AAAAAAAAAAAATCTAATCCAGG - Intergenic
1143839112 17:9717514-9717536 GAGAAAAAATAGTTGATTCCTGG + Intronic
1144288052 17:13798654-13798676 AAAAAAAAAAAATCTATTTCTGG + Intergenic
1145861815 17:28217476-28217498 GAAAAAAAAAAAAGGAGTCCAGG - Intergenic
1146621974 17:34405758-34405780 AAAAAAAAAAAAAAGATTCCAGG + Intergenic
1147126874 17:38376412-38376434 AAGAAAAAAAAATTGATTTCCGG - Intronic
1147419975 17:40317689-40317711 GAAAAAAAAAAAAAGAGTCCAGG - Intronic
1150120228 17:62594959-62594981 TCAAAAAAAAAATCAATTCCTGG - Intronic
1150628819 17:66861952-66861974 GAAAAATAAAAATCAATTTCTGG + Intronic
1150951749 17:69810361-69810383 GTTAAAAAATAACGGATTCCTGG - Intergenic
1152247818 17:79194614-79194636 GAAAAAAAAAAACTGCTTCCTGG + Intronic
1152399261 17:80055016-80055038 GATAAAAAAAAAAGGCTTCCTGG + Intronic
1152543456 17:80988972-80988994 TGTACAAAAAAATAGATTCCAGG + Intergenic
1152651634 17:81496854-81496876 GAAAAAAAAAAATGGAGGCCGGG + Intergenic
1152978710 18:251564-251586 AGAAAAAAAAAATCGATTCCTGG + Intronic
1153152201 18:2108217-2108239 GGAAAAAAAAAACCCATTCCAGG - Intergenic
1153389879 18:4544540-4544562 AAAAAAAAAAAAAGGATTCCTGG + Intergenic
1153704469 18:7731615-7731637 GATCAAAGAAAAGCTATTCCAGG - Intronic
1153822316 18:8842828-8842850 AAAAAAAAAAAATCAATGCCTGG + Intergenic
1154504399 18:15020975-15020997 GAGAAAAAAAAATGGTTTCATGG - Intergenic
1154930084 18:20985100-20985122 AAAAAAAAAAAAGCCATTCCTGG + Intronic
1155208690 18:23582808-23582830 AAAAAAAAAAAAAAGATTCCAGG + Intronic
1155224316 18:23715284-23715306 GTTAAAAAAAAAAGGATTCATGG + Intronic
1155293084 18:24360646-24360668 AAGAAAAAAAAATCGATTCTTGG + Intronic
1155449724 18:25951160-25951182 GACAAAAAATAATCAATTCATGG + Intergenic
1156010612 18:32493632-32493654 GAGTAATAAAAATGGATTCCAGG - Intergenic
1156396117 18:36701405-36701427 GATAAAAAAGAAGCAATTTCAGG - Intronic
1157665759 18:49485578-49485600 AATAAAATAAAATCAATTGCTGG + Intronic
1157939790 18:51915596-51915618 GTTAAAAAAAAATCTATTGATGG + Intergenic
1158109753 18:53928353-53928375 CTTAAAAAAAAAAAGATTCCTGG - Intergenic
1158215984 18:55101374-55101396 CATAAAAAAAAAATGCTTCCTGG - Intergenic
1158613228 18:58962227-58962249 AAAAAAAAAAAATGGATTCTAGG + Intronic
1158969704 18:62655209-62655231 AAGGAAAAAAAATAGATTCCTGG + Intergenic
1159035665 18:63275085-63275107 TATAAAAAAAAATCAAGGCCAGG + Intronic
1159425055 18:68274508-68274530 GGTTAATAAAAATAGATTCCAGG - Intergenic
1159558624 18:69970931-69970953 GAGAAAAAAAAATGGAAGCCTGG + Intergenic
1159568282 18:70081762-70081784 AAGAAAAAAAAATCCAATCCTGG - Intronic
1160963092 19:1733291-1733313 AAAAAAAAAAAATCCACTCCAGG + Intergenic
1161023908 19:2026059-2026081 AAGAAAAAAAAATTGATTACTGG + Intronic
1161252594 19:3288846-3288868 TTTAAAAAAAAATCCATTGCTGG + Intronic
1162077678 19:8199225-8199247 AACAAAAAAAAAACGTTTCCAGG + Intronic
1162202878 19:9033939-9033961 AATAAAAAATAATATATTCCAGG + Intergenic
1163439922 19:17317212-17317234 GAAAAAAAGAAATCTATACCGGG + Intronic
1163905088 19:20145153-20145175 TAAAAAAAAAAATGAATTCCAGG - Intergenic
1164677870 19:30113939-30113961 TTTAAAAAAAAATTGATTTCGGG - Intergenic
1165176293 19:33932616-33932638 AATAAAATAAAATGTATTCCTGG - Intergenic
1165292302 19:34896628-34896650 GAAAAAAAAAAAAAAATTCCAGG + Intergenic
1165465579 19:35972872-35972894 AAAAAAAAAAAAAAGATTCCCGG + Intergenic
1165990460 19:39809168-39809190 AAAAAAAAAAAATAGATCCCTGG + Intergenic
1166042402 19:40212023-40212045 GTTAAAAGAAAATCCATACCAGG - Intronic
1166217297 19:41343972-41343994 AAAAAAAAAAAAAAGATTCCAGG - Intronic
1167009554 19:46797992-46798014 AAAAAAAAAAAAAAGATTCCTGG + Intergenic
1167658396 19:50781211-50781233 TTTAAAATAAAATCGATGCCCGG + Intergenic
1167891897 19:52546933-52546955 AAAAAAAAAAAAGCAATTCCAGG - Intronic
1168264684 19:55216189-55216211 GAAAAAAAAAAATCTAATCCTGG - Intergenic
1168556393 19:57345741-57345763 GGCAAAAAAAAAGTGATTCCAGG - Intergenic
925325995 2:3022472-3022494 GAAAAAAAAAAACAGATTTCTGG + Intergenic
925821146 2:7801123-7801145 GAAAGAAAAAAATAGTTTCCTGG + Intergenic
926399598 2:12483670-12483692 AAAAAAAAAAAATGCATTCCAGG + Intergenic
926694274 2:15760295-15760317 GTTAAAAAATAATAAATTCCAGG + Intergenic
928298770 2:30107673-30107695 AAAAAAAAAAAACAGATTCCAGG + Intergenic
928503640 2:31925488-31925510 AAAAAAAAAAAATCTGTTCCCGG + Intronic
928663355 2:33526219-33526241 GATAAATCAAAACCCATTCCTGG + Intronic
929131435 2:38577634-38577656 CATAAAAGAAATACGATTCCTGG + Intronic
929260408 2:39860861-39860883 AAAAAAAAAAAATCTATTCCCGG - Intergenic
929746666 2:44666604-44666626 AAAAAAAAAAAAAAGATTCCAGG - Intronic
930352518 2:50275501-50275523 GAAAAAAAAAAATCTATTCATGG + Intronic
930415888 2:51090925-51090947 GATAAAAGATAAACGAGTCCAGG + Intergenic
930493342 2:52105787-52105809 AATAATAAAAAATAAATTCCTGG - Intergenic
931165770 2:59746013-59746035 GATAAACAAAAACAGATTTCTGG + Intergenic
931750186 2:65323574-65323596 AAAAAAAAAAAATCCATCCCTGG + Intronic
931871688 2:66467604-66467626 GAAAAAAAAAAATCCAATCGTGG + Intronic
931973257 2:67614145-67614167 ATGAAAAAAAAATAGATTCCTGG + Intergenic
932219282 2:69987450-69987472 GTTAAAAAAAAATCAGTTCGGGG + Intergenic
932289870 2:70567750-70567772 GAGAAAAAAAAATCAATTCCTGG - Intergenic
933053152 2:77626809-77626831 TATATACAAAAATCAATTCCAGG - Intergenic
933151574 2:78921754-78921776 GATGAGAAAAAATTGATTCCGGG + Intergenic
936098637 2:109554653-109554675 TAAGAAAAAAAATTGATTCCCGG - Intronic
936702627 2:115032147-115032169 TAGGAAAAAAAATGGATTCCAGG - Intronic
937332334 2:121039280-121039302 CAGAAAAAAAAATGGATCCCAGG + Intergenic
937520092 2:122703249-122703271 GATATGAAAAAATCAACTCCTGG + Intergenic
937572177 2:123377835-123377857 AAAAAAAAAAAAGAGATTCCAGG + Intergenic
938191664 2:129287825-129287847 AAAAAAAAAAAAACGAATCCAGG + Intergenic
938503588 2:131851181-131851203 GAGAAAAAAAAATGGTTTCATGG - Intergenic
938571050 2:132562145-132562167 TAAAAAAAAAAATGGATGCCTGG - Intronic
939081603 2:137669427-137669449 GTAAAAAAAAAATTGATTCTAGG - Intronic
939364403 2:141213605-141213627 GAGAAAAATAAATTGAATCCAGG - Intronic
940759526 2:157721872-157721894 GATAGAAACAAAGCTATTCCTGG - Intergenic
941283843 2:163584555-163584577 GTTAAAAAAAAATTGAACCCAGG - Intergenic
941363266 2:164579678-164579700 GGAAAAAAAAAATCTATTCCGGG - Intronic
941939363 2:171017791-171017813 GAGAAAAAAAGATGGATTCTGGG + Intronic
942549150 2:177096419-177096441 GATAATAAAAAAGCTATTTCAGG - Intergenic
942716588 2:178900041-178900063 GATAAAATAAAATTGTTTCTTGG - Intronic
943482611 2:188440187-188440209 GATAAAAACAAATCTATTGTTGG + Intronic
944110611 2:196128124-196128146 GAGAAAAAAAAACCTTTTCCAGG + Intergenic
944281345 2:197901844-197901866 GATACAAAAAACTAGAATCCAGG + Intronic
944668777 2:201978240-201978262 GATGCAAAGAAATTGATTCCTGG + Intergenic
944790713 2:203122597-203122619 GTGAGAAAAAAATTGATTCCTGG + Intronic
944972546 2:205010722-205010744 GAGAAAAAAAAATCCATGTCTGG - Intronic
945026172 2:205621971-205621993 GGAAAAAAAAAATTGATTCCTGG + Intergenic
945661148 2:212686966-212686988 GAAAAAAAAAAATTCATTCCTGG + Intergenic
946097163 2:217284866-217284888 GAAAAAAAAAAATATATTTCAGG + Intronic
946286617 2:218708705-218708727 GAAAAAAAAAACTGAATTCCTGG - Intergenic
946392001 2:219421659-219421681 AAAAAAAAAAAATTGTTTCCAGG - Intronic
946445735 2:219738532-219738554 AAAAAAAAAAAATCCCTTCCTGG + Intergenic
946475639 2:220004205-220004227 GTTAAAAAAAAATGAGTTCCGGG + Intergenic
947319623 2:228902039-228902061 GTGAAAAAAAAATCCAATCCAGG + Intronic
948136631 2:235641424-235641446 GAAAAAAAAAAATCGGGTCGGGG - Intronic
948226524 2:236315298-236315320 CATGAACAAAAATCAATTCCAGG + Intergenic
948392480 2:237622723-237622745 AAAAAAAAAAAATGAATTCCTGG + Intergenic
1169115352 20:3061386-3061408 GATAAAAAAAAATTGAAGTCCGG + Intergenic
1169177481 20:3530698-3530720 ATTAAAAAAAGATCTATTCCAGG - Intronic
1171041164 20:21764982-21765004 AATAAAAAAAATTCTCTTCCTGG - Intergenic
1171368448 20:24644099-24644121 GAGAAAAATCAATGGATTCCAGG + Intronic
1171376040 20:24694650-24694672 GATGTAAAAAAATAGATTCCTGG - Intergenic
1171503011 20:25608909-25608931 GAAAAAAAAAAATCGAGTATTGG + Intergenic
1174438017 20:50525602-50525624 AAAAAAAAAAAATCAAATCCAGG - Intronic
1174663047 20:52231869-52231891 AAAAAAAAAAAATTCATTCCAGG - Intergenic
1174993176 20:55535847-55535869 TATAAAACAAAATAAATTCCAGG - Intergenic
1175499595 20:59440523-59440545 AAAAAAAAAAAACGGATTCCTGG + Intergenic
1176868425 21:14069608-14069630 GAAAAAAAAAAAACTATTCTTGG - Intergenic
1176876863 21:14138273-14138295 GATAAAAAAATAAAGATTTCAGG + Intronic
1176949167 21:15023841-15023863 GAGAAAAACAAATTGATTGCTGG + Intronic
1177849443 21:26329100-26329122 GAAAAAAAAAAAATGAGTCCAGG - Intergenic
1177859223 21:26433520-26433542 GCTAAAAAAGAATCCAATCCAGG - Intergenic
1177874165 21:26610797-26610819 GGGAAAAATAAATGGATTCCAGG + Intergenic
1177911516 21:27039454-27039476 GGTAGAAAAAAAAAGATTCCTGG + Intergenic
1177974302 21:27827996-27828018 TAAGAAAAAAAATTGATTCCAGG - Intergenic
1178193081 21:30308802-30308824 AAAAAAAAAAAGCCGATTCCTGG + Intergenic
1178333305 21:31720194-31720216 AAGAAATAAAAATTGATTCCAGG + Intronic
1179633574 21:42693291-42693313 AAAAAAAAAAAAAAGATTCCTGG - Intronic
1179820793 21:43935700-43935722 GAAAAAAAAAAATCCCTTCCTGG - Intronic
1181493277 22:23274044-23274066 GATAAAAAAAAAGGGGTCCCTGG - Intronic
1182142131 22:27968750-27968772 AAAAAAAAAAAATCAATTCTTGG - Intergenic
1182192378 22:28475479-28475501 GAGGGAAAAAAATGGATTCCTGG - Intronic
1183290115 22:36996112-36996134 GATAAAAAATAATTGAGTCATGG - Intronic
1183419075 22:37699839-37699861 GAAAATAAAGAAGCGATTCCTGG - Intronic
1183432464 22:37774129-37774151 AAAAAAAAAAAAGCAATTCCTGG + Exonic
1183782978 22:40010429-40010451 TAGAAAAAAAAATCAATTGCTGG - Intronic
1184021361 22:41823889-41823911 GAAAAAAAACAATCGATTCCTGG - Intronic
1184738880 22:46415626-46415648 TAAAAAAAAAAAAAGATTCCTGG + Intronic
949447664 3:4152446-4152468 GAAAAAAAAAAAGCAAATCCGGG - Intronic
949677487 3:6472774-6472796 CAGAAAAAAAACTCGATCCCAGG + Intergenic
949741582 3:7240335-7240357 ATTAAAAAAAAAACAATTCCAGG - Intronic
949782661 3:7707567-7707589 TATTAAAAAAAATAGATGCCAGG - Intronic
949872904 3:8604378-8604400 ATGAAAAAAAAATCCATTCCCGG - Intergenic
950101446 3:10359320-10359342 TTTAAAAAAACATTGATTCCTGG - Intronic
950172840 3:10851466-10851488 GAAAGAAAAAAATCAATTCAAGG - Intronic
950252660 3:11479919-11479941 AAAAAAAAAAAATTGATTCCAGG - Intronic
950806671 3:15610008-15610030 AACAAACAAAAATCAATTCCAGG - Intronic
951131471 3:19051008-19051030 GCCAGAAAAAAATCAATTCCAGG - Intergenic
951594614 3:24303927-24303949 GATCAAGAAAAATTTATTCCTGG - Intronic
951734391 3:25848511-25848533 GAGAAAAAAAAATTGATCCTAGG + Intergenic
951865458 3:27301969-27301991 CATACACAAAAATCAATTCCAGG - Intronic
953770158 3:45773522-45773544 TACAGAAAAAAATCCATTCCTGG - Intronic
954234760 3:49247822-49247844 GAAAAAAAAAAATAGATTCAAGG + Intronic
955139635 3:56256544-56256566 CATAAAAAAAAAAAAATTCCTGG - Intronic
955308968 3:57864730-57864752 AATAAAATAAAATCAATTTCTGG - Intronic
955791182 3:62590191-62590213 GAAAAAAAAAAAAAAATTCCAGG + Intronic
956206532 3:66760870-66760892 GAAAAAAAAAAGTCGGTTCCCGG - Intergenic
956219894 3:66891283-66891305 GAGAAAAAAAAGTAGATTCATGG - Intergenic
956783772 3:72625291-72625313 AATAAAAAAAAATTCTTTCCAGG + Intergenic
956849533 3:73216272-73216294 TAAAAAAAAAAATCTAATCCAGG - Intergenic
956960011 3:74388521-74388543 TATAAAAATAAATCTATTACTGG - Intronic
957404498 3:79759896-79759918 TAAAACAAAAAATCAATTCCAGG + Intronic
957404563 3:79760502-79760524 AAAAAAAAAAAATAGAATCCAGG + Intronic
957442454 3:80267282-80267304 TATAAAAAAAAATCTATTATAGG + Intergenic
957449455 3:80359125-80359147 AATAAAGAAAAATATATTCCTGG + Intergenic
957452866 3:80402207-80402229 GAAAAAAAAAAATGGCTACCTGG + Intergenic
957584502 3:82116238-82116260 AAAAAAAAAAAATCTCTTCCAGG + Intergenic
958118195 3:89249833-89249855 AATAAAAAATAATTGTTTCCTGG + Intronic
958499896 3:94891745-94891767 GAAAGAAAAAAATCAATTTCTGG + Intergenic
959039020 3:101399100-101399122 GTTAAAAAAAAATGTATTCCAGG + Intronic
959104949 3:102054904-102054926 GAAAAAGCAAAATCAATTCCTGG - Intergenic
959283942 3:104382708-104382730 GAAAAAAAAATATAGATTCAAGG + Intergenic
959317995 3:104833797-104833819 GAGAAAAAAAAAATGACTCCAGG - Intergenic
959985868 3:112570723-112570745 GATAAAAAAAAAAAAATTCTGGG - Intronic
960358618 3:116683366-116683388 ATTAAAAAAAAATAGATTGCCGG - Intronic
961376720 3:126471711-126471733 CTTAAAAAAAAAACAATTCCAGG - Intronic
961698477 3:128723352-128723374 GATGAGAAAAAATTGATTCCTGG - Intergenic
961728365 3:128948522-128948544 GAAAAAAAAAAAAAAATTCCGGG - Intronic
961737826 3:129013452-129013474 GATAGAAAGAAAGAGATTCCAGG - Intronic
961964619 3:130889283-130889305 GAGAAAAAAACATCAATTACTGG - Intronic
964413404 3:156422895-156422917 CAGAAAAAAAAATGGAGTCCTGG + Intronic
964491540 3:157241712-157241734 AAAAAAAAAAAATCCTTTCCTGG + Intergenic
964807283 3:160624672-160624694 GAGAAAAAAAAATTGATTCCTGG - Intergenic
964839614 3:160979510-160979532 TAAAAAAAAAAATTGTTTCCTGG - Intronic
965286027 3:166821690-166821712 GAAAAAAAAAAAATGACTCCAGG + Intergenic
965469153 3:169068976-169068998 CAAAAAATAAAATCAATTCCAGG - Intergenic
965772996 3:172200304-172200326 GAGAAAACAAAATTGACTCCTGG - Intronic
966315385 3:178639065-178639087 AATTAAAAAAAATCTATTCAAGG - Intronic
966410488 3:179641915-179641937 GAAAAAAAAAAAAAGATTCTAGG - Intergenic
966442282 3:179959071-179959093 AATAAAAAAAACCAGATTCCTGG + Intronic
966444980 3:179991903-179991925 GATACAAAAAAATCAAATCTAGG + Intronic
966599473 3:181761032-181761054 GAAAAAAAAATACAGATTCCTGG - Intergenic
966697293 3:182803655-182803677 CATATACAAAAATTGATTCCAGG - Intronic
967419679 3:189259452-189259474 AAAAAAAAAAAAGGGATTCCTGG - Intronic
967459149 3:189724968-189724990 GAGAAAAAGAAATCGATTGCTGG - Intronic
967857858 3:194131853-194131875 AATAAATAAAAATAAATTCCAGG - Intergenic
967999334 3:195192983-195193005 AATTCAAAAAAATCCATTCCTGG + Intronic
968584166 4:1408195-1408217 GATAAAGAATAATCAAGTCCTGG - Intergenic
968693141 4:2006782-2006804 AAAAAAAAAAAAAGGATTCCAGG + Intronic
970491131 4:16574841-16574863 GATGAAAAAAATTGGATTCGGGG + Intronic
970613502 4:17746735-17746757 AAAAAAAAAAAGTAGATTCCTGG + Intronic
970613544 4:17747053-17747075 AAAAAAAAAAAGTAGATTCCTGG + Intronic
970741490 4:19243994-19244016 AATAAAAAAGAATCAATTCATGG - Intergenic
970957264 4:21828528-21828550 AATAAAAATAAATCCATTCCTGG + Intronic
971022545 4:22551851-22551873 GATTAAAAAAAATCTCTTCCTGG - Intergenic
971619711 4:28840380-28840402 AATAAAATAAAATAAATTCCAGG + Intergenic
971750717 4:30644367-30644389 AAAAAAAAAAAAACGATTCGTGG - Intergenic
972101938 4:35431376-35431398 GAAAAAAAAAAATGGTTTCATGG + Intergenic
972402442 4:38718241-38718263 GAGAGAAAAAAATGGATTTCTGG + Intergenic
972818245 4:42668807-42668829 GATAAAAATAAATGGAATCTTGG + Intergenic
974974069 4:68867691-68867713 GATAAAAAAAAATCACTTTTTGG + Intergenic
975396695 4:73883317-73883339 GAAAAAAAAAAATCCATCTCAGG + Intergenic
975438489 4:74382002-74382024 AAAAAAAAAGAATTGATTCCAGG + Intronic
975695528 4:77009113-77009135 AATAAAAAGAAATGTATTCCTGG - Intronic
976316686 4:83666382-83666404 AATAAAAAGAAATAGATTTCTGG - Intergenic
976441159 4:85076245-85076267 GAGAAAAAATAATTGATTCCTGG - Intergenic
976457356 4:85263736-85263758 GACAGAAAAAAATCTATGCCTGG + Intergenic
976637558 4:87302073-87302095 GATAAAAAAGAAATGATTCCTGG + Intergenic
978459716 4:108937594-108937616 GAGAAAAAGAAAGAGATTCCAGG - Intronic
978646762 4:110942308-110942330 AATAAAAAAAAATCAATTCCTGG - Intergenic
979796322 4:124850849-124850871 GCAAAAAAAAAATGGCTTCCTGG - Intergenic
980160752 4:129158944-129158966 GATAAAAGAACATCAATTTCAGG - Intergenic
980163097 4:129190198-129190220 CATAAACAAAAACCAATTCCAGG + Intergenic
980344352 4:131593515-131593537 TATAAAAAAAAATAGAGGCCAGG - Intergenic
980639327 4:135555015-135555037 GAGAAAAAAAAAACTATTCCTGG - Intergenic
980646530 4:135650573-135650595 GATTAAAAAAAGTTTATTCCTGG - Intergenic
980767785 4:137330380-137330402 CATAAACAAAAGTCAATTCCAGG - Intergenic
980790990 4:137619365-137619387 GATAAAAAGAAATCCAGGCCGGG + Intergenic
981144179 4:141305520-141305542 AAAAAAAAAAAAAAGATTCCAGG + Intergenic
981202825 4:142001959-142001981 ATTAAAAACAAATCAATTCCAGG - Intergenic
981726558 4:147853289-147853311 GAAAAATAAAAACCGATTCGTGG - Intronic
981861203 4:149358621-149358643 GATAAAAACAAGTCAAATCCTGG + Intergenic
984658863 4:182351351-182351373 GACAAAAAACAATAGATGCCTGG - Intronic
986244083 5:5989549-5989571 GAGAAAAAATAATCACTTCCTGG - Intergenic
987332756 5:16871608-16871630 AAAAAAAAAAAATCTATCCCTGG + Intronic
987897859 5:23971829-23971851 AATAAAAAAATATTGATTCTAGG - Intronic
987907646 5:24098271-24098293 GATGAGAAAAAATTGATTTCTGG + Intronic
988234424 5:28522767-28522789 GAAAAAAAATAATTGATTCCTGG + Intergenic
988316515 5:29637006-29637028 GATAGAAAAAAAAATATTCCAGG + Intergenic
988808253 5:34760410-34760432 GAACAAAAAATATAGATTCCTGG - Intronic
988888709 5:35589890-35589912 CAAGAAAAAAAATGGATTCCTGG + Intergenic
988988702 5:36647766-36647788 AATAAAACAAAATGGATCCCTGG - Intronic
989219169 5:38935786-38935808 GATGATAAAAAATAGATTCCAGG - Intronic
989536325 5:42568215-42568237 AATAAAAAAAAATCCTTTCAGGG - Intronic
989818307 5:45763735-45763757 GAAAAAAAAAAAACAAATCCAGG - Intergenic
990252859 5:53934433-53934455 GAAAAAAAAAAATAGAAACCTGG + Intronic
990950872 5:61297236-61297258 GAAAAAAAAAAATCCATTAATGG - Intergenic
990970176 5:61497111-61497133 AAAAAAAAAAAAAAGATTCCTGG + Intronic
991312990 5:65265884-65265906 GGTAAAAAAAAATCCATTGGAGG + Intronic
991343116 5:65633922-65633944 GACAAAAAAAAATCAATTAAAGG - Intronic
991372985 5:65938952-65938974 GATAAATAAAAATCCAGTTCAGG - Intronic
993374938 5:87139853-87139875 AAAAAAAAAAAGTCAATTCCTGG + Intergenic
993559479 5:89387236-89387258 CATACACAAAAATCAATTCCAGG + Intergenic
993759339 5:91773127-91773149 CATAAACGAAAATTGATTCCTGG - Intergenic
993816798 5:92558490-92558512 TAAAAAAAAAAAAAGATTCCGGG + Intergenic
994216860 5:97147473-97147495 GGTAAAAAAAAATTCATTCCTGG + Intronic
994675959 5:102822545-102822567 AGAAAAAAAAAATCGATTCCTGG - Intronic
995048586 5:107675492-107675514 TGAGAAAAAAAATCGATTCCAGG - Intergenic
996054279 5:118965975-118965997 GAAAAAAAAAAAGAGATGCCAGG + Intronic
997885587 5:137626998-137627020 AAAAAAAAAAAATCCATTTCTGG + Intronic
998639371 5:143992208-143992230 GAAAAAAAAAAATCAGTTCTAGG + Intergenic
998776755 5:145612122-145612144 AATATATAAAAATCGATTCCAGG + Intronic
998967621 5:147557710-147557732 GAAAAAAAAAAATCAACTCATGG - Intergenic
999412863 5:151367351-151367373 AAAAAAAAAAAATGCATTCCTGG - Intergenic
999696788 5:154194285-154194307 GAGAAAAAAACATTGATTTCTGG - Intronic
999898198 5:156057831-156057853 GCTAAAAAAAAATCAATCACTGG + Intronic
1000880098 5:166687350-166687372 AAAAAAAAAAAATCAATTCCAGG - Intergenic
1001301158 5:170534820-170534842 AAAAAAAAAAAATCTATGCCGGG - Intronic
1001361483 5:171090653-171090675 GAAAAAAAAAAATGGTTTCATGG + Intronic
1001612857 5:173017540-173017562 AAAAAAAAAAAAGCGATTCCTGG + Intronic
1003295391 6:4821740-4821762 GAAAAAAAAAAAGCGATCCTTGG + Intronic
1003859135 6:10306013-10306035 GATATTAAATAATTGATTCCTGG - Intergenic
1004076212 6:12346427-12346449 GGAAAAAAAAAATGGATTCCTGG + Intergenic
1004767147 6:18742415-18742437 AAAAAAAAAAAATCGAATCTAGG - Intergenic
1004988650 6:21112059-21112081 GAAAAAAAAAAATCAACTCCAGG - Intronic
1005142651 6:22651141-22651163 AATAAAAAAAAAATGAGTCCAGG - Intergenic
1006171079 6:32093264-32093286 GAGAAAAGAAAAACAATTCCTGG - Intronic
1006260275 6:32862237-32862259 GATAAAAAATAATTGGCTCCAGG + Intergenic
1006661886 6:35653354-35653376 AATAAAAAAAGATGGATTCTAGG + Intronic
1006704180 6:36003215-36003237 CATACACAAAAATCTATTCCTGG - Intronic
1007017489 6:38483281-38483303 GGTAACAGAAAATCGACTCCTGG - Intronic
1008769169 6:54958428-54958450 GAGAAAAAATAATCCCTTCCTGG - Intergenic
1008880223 6:56374059-56374081 GATCAATAAAAATCTTTTCCTGG - Intronic
1008922386 6:56855936-56855958 GAGAAAAAAAAATGAATTCCTGG - Intronic
1010012494 6:71065250-71065272 CAGAAAAAAAAATAAATTCCTGG - Intergenic
1010018097 6:71128103-71128125 AATAAAAAAAAATAGATTTGGGG - Intergenic
1010243963 6:73645489-73645511 GATTAAAAAAAAAGGATGCCGGG + Intronic
1010375264 6:75161232-75161254 GAGAAAAAAGAATTGGTTCCTGG - Intronic
1010694724 6:78956684-78956706 GATGAAAAGAAAGCCATTCCAGG - Intronic
1010695162 6:78964221-78964243 GATAAAAAAAAATATATTATTGG + Intronic
1010775713 6:79882817-79882839 CATATAAAAAAATCAATTCTAGG + Intergenic
1011271319 6:85582485-85582507 CAAAAAAAAAAATCGGCTCCTGG - Intronic
1011476573 6:87754661-87754683 GAAAAAAGAAAATATATTCCAGG + Intergenic
1011684942 6:89816436-89816458 GAAAAAAAAAAATCATTTACAGG + Intronic
1012045182 6:94264037-94264059 GAGAAAAAAAAATGGTTTCATGG - Intergenic
1012492961 6:99802708-99802730 GAACAAGAAAAATCAATTCCTGG - Intergenic
1012751356 6:103167916-103167938 GAAAAAAAAAAATGGTTTCATGG + Intergenic
1012762250 6:103317321-103317343 GAAAAAAAAAAATCATTACCTGG + Intergenic
1012875263 6:104719212-104719234 GATATAAAAATACCTATTCCAGG + Intergenic
1013070567 6:106725349-106725371 CATATACAAAAATCAATTCCAGG + Intergenic
1013303208 6:108823294-108823316 CAAAAAATAAAATCCATTCCTGG - Intergenic
1013657227 6:112258591-112258613 AAAAAAAAAAAATCAATTCCTGG - Intergenic
1013980919 6:116128079-116128101 GACACAAAAAAATCCATACCAGG + Intronic
1014288392 6:119529481-119529503 GAGAAAAAAAAATGGCTGCCTGG - Intergenic
1014458433 6:121665877-121665899 GAAAAAAAAAAAAAAATTCCTGG + Intergenic
1014633359 6:123814392-123814414 AATAAAAATAAATCTATTCCAGG - Intronic
1015174081 6:130287513-130287535 GATAAAATAAAATAGAATACAGG - Intronic
1015754090 6:136590475-136590497 GAAAAAAAAGAATTGATTCCTGG + Intronic
1017051385 6:150397222-150397244 GATAACAAATCATAGATTCCAGG + Intronic
1017746255 6:157449223-157449245 GATAAACAAAAATCTTTTCATGG - Intronic
1017925237 6:158906090-158906112 TATAAACAAAAATCAATTCCAGG + Intronic
1018250529 6:161865424-161865446 GATAAAAAAAAATCGATTCCTGG - Intronic
1018338135 6:162818004-162818026 ATTAAAAAAAAAGCTATTCCTGG - Intronic
1018470061 6:164087064-164087086 CAAAAAGAAAAATCCATTCCTGG + Intergenic
1019033631 6:169035060-169035082 GATAAAAAGAAATCCATCACAGG - Intergenic
1019201541 6:170320320-170320342 GCTTAAAAAAAATCGAATGCTGG - Intronic
1020249601 7:6456845-6456867 GAAAAAAAAAAGTCGAGGCCAGG - Intronic
1020266152 7:6561419-6561441 AAAAAAAAAAAAAAGATTCCTGG - Intergenic
1020380305 7:7537398-7537420 GAGAAAAAAAATTCAATTCCTGG - Intergenic
1020648724 7:10848386-10848408 GATAAAATAAAATATGTTCCGGG + Intergenic
1020893081 7:13903772-13903794 AAAAAAAAAAAATTGTTTCCTGG + Intronic
1020965641 7:14864589-14864611 GATAGGAAACAATTGATTCCGGG + Intronic
1021796405 7:24258781-24258803 AATAAAAAAAAATGGAGTCCAGG + Intergenic
1022677783 7:32515886-32515908 AAGAAAAAAAAATCAATTTCTGG + Intronic
1023469812 7:40504428-40504450 GAAAAAAAAAAATCTATTCTTGG - Intronic
1024383762 7:48727572-48727594 GAGAACAAAAAATCTATTCCTGG + Intergenic
1024706978 7:51971762-51971784 GAAAAAAAAAAAAAAATTCCAGG + Intergenic
1024801157 7:53081207-53081229 GATACAATCAAATCGATTTCAGG - Intergenic
1025970734 7:66322217-66322239 AATGAAAAGAAATCAATTCCAGG - Intronic
1026193259 7:68149188-68149210 GAGAAAAAAAAATACATGCCTGG - Intergenic
1026245183 7:68613291-68613313 GAAAAAAAAAAATTGATTTGGGG - Intergenic
1026268760 7:68818461-68818483 GAAAGAAGTAAATCGATTCCAGG + Intergenic
1026432540 7:70361333-70361355 AAAAAAAAAAAATCGATTCTTGG + Intronic
1026901956 7:74042429-74042451 AAAAAAAAAAAATCCATTACCGG + Intronic
1027296670 7:76780670-76780692 GATAGAAAGAAATTGTTTCCTGG + Intergenic
1027461618 7:78461357-78461379 CAAAAAAGAAAATAGATTCCTGG + Intronic
1027475803 7:78630090-78630112 GATAAAAAGAAAGGGCTTCCAGG - Intronic
1027926258 7:84467541-84467563 AAAAAAAAAAATTCAATTCCAGG + Intronic
1027939805 7:84662227-84662249 AATAAAAAAAAATGGATTGATGG + Intergenic
1027979972 7:85205602-85205624 GATTAAAAAAAATCAAACCCTGG + Intergenic
1029387482 7:100253104-100253126 GAAAAAAAAAAAAAGATGCCAGG - Intronic
1029644913 7:101848229-101848251 GAGAAAAAAAAATCAATCTCTGG - Intronic
1030289912 7:107861829-107861851 TCTAAAAAAATATCGATGCCTGG - Intergenic
1030527076 7:110667168-110667190 GAAAAAAAAGAATTTATTCCAGG - Intronic
1031602892 7:123733923-123733945 AAAAAAAAAAAATCAAATCCAGG + Intronic
1031764422 7:125760216-125760238 GAAAAAAAAAATTTGATTCAAGG + Intergenic
1031764765 7:125764169-125764191 CATGAAAAAAAATCCATTCGAGG + Intergenic
1032260802 7:130335269-130335291 GAAAAAAAAAAATCGAAGTCTGG + Intergenic
1032623385 7:133561633-133561655 GAGAAAAAGAAATTGATTCCTGG + Intronic
1033373134 7:140730291-140730313 AATAAAAAAAAATCAATTTGAGG + Intronic
1033491590 7:141848754-141848776 GAGACAAAAAAATTGTTTCCAGG - Intergenic
1034117674 7:148598703-148598725 TATAAAAAAAATTTCATTCCTGG + Intronic
1034423909 7:151003526-151003548 GCTAAAAAAAAGTCAATTGCTGG - Intronic
1034728627 7:153364163-153364185 GTTAAAAAAAAATCAATTGCAGG - Intergenic
1036405106 8:8447732-8447754 TATAAAAAATTATAGATTCCGGG + Intergenic
1037131246 8:15410525-15410547 GATAATAAAAAATGCATTCATGG + Intergenic
1037405174 8:18534838-18534860 GAGTAAGAAAAATCTATTCCTGG + Exonic
1037455702 8:19061505-19061527 TAAAAAAAAAAATCACTTCCCGG + Intronic
1038042175 8:23733047-23733069 TAGAAAAAAAAAAAGATTCCTGG - Intergenic
1038043644 8:23748149-23748171 AAAAAAAAAAAACAGATTCCCGG - Intergenic
1038274043 8:26105085-26105107 AAAAAAAAAAAACTGATTCCCGG + Intergenic
1038293361 8:26269337-26269359 GAAAAGAAAAGATAGATTCCTGG + Intergenic
1038375318 8:27034298-27034320 GAAAAAAAAAAAAAGATACCAGG + Intergenic
1038850107 8:31267484-31267506 AATAAAAAAAAATATACTCCAGG + Intergenic
1038992453 8:32883560-32883582 GAGAAAAAAAAATTGACTGCAGG - Intergenic
1039142117 8:34402036-34402058 GATAAAAATAAAAAGACTCCTGG - Intergenic
1039214405 8:35253418-35253440 GGAAAAAAAAAATCTACTCCAGG - Intronic
1039593172 8:38767762-38767784 GATAAAAGAAAATAGATTAGGGG + Intronic
1040781809 8:51118239-51118261 AATAAAAACAAATCCATTTCAGG - Intergenic
1040875735 8:52149911-52149933 CATGAAAAAAAATCGAATCCTGG - Exonic
1041026502 8:53692140-53692162 AAAAAAAAAAAACGGATTCCTGG + Intergenic
1041829607 8:62139111-62139133 GAAAAAAAAAAATAAAATCCAGG - Intergenic
1042163354 8:65920751-65920773 GAAAAAAAAACATGGATTCTGGG + Intergenic
1042181103 8:66088322-66088344 GAGAAAAAAAAATGGTTTCTTGG - Intronic
1042802531 8:72735243-72735265 AATAAAAAAAAGTCACTTCCTGG - Intronic
1042997156 8:74713644-74713666 GATTTAAAAAAATGGATTCATGG + Intronic
1043215966 8:77588442-77588464 TATAAAAAAAAATGGTTTCCTGG - Intergenic
1043465101 8:80497675-80497697 AAAAAAAAAAAAAAGATTCCAGG - Intronic
1044287778 8:90429260-90429282 GAGAAAAAAAAAATGTTTCCTGG + Intergenic
1044679876 8:94766739-94766761 GATAAAAAATACTCGATGGCCGG + Intronic
1045883305 8:107065637-107065659 AAAAAAAAATAATCGATTGCTGG - Intergenic
1046005866 8:108482885-108482907 CATACATAAAAATCAATTCCAGG - Intronic
1046224705 8:111262470-111262492 GATAAAAAAAAAAAAAGTCCTGG - Intergenic
1047178118 8:122560984-122561006 GAAAAAAAAAAAGTGATTCCTGG - Intergenic
1047803367 8:128332916-128332938 GAAAAAAAAAAATCGAGCCCTGG - Intergenic
1047923864 8:129663458-129663480 GAAAAAAAAAAATCGAGGCCAGG + Intergenic
1050218274 9:3354475-3354497 GACAAAAAAAGATAGATACCAGG + Intronic
1050269331 9:3925441-3925463 TGAGAAAAAAAATCGATTCCTGG + Intronic
1050543592 9:6690930-6690952 AATAAAAAAAAATGGTTTTCAGG + Intergenic
1050746474 9:8882234-8882256 TATAAAAATAAATCTAATCCAGG - Intronic
1050775649 9:9256908-9256930 CATAAAAACAACTTGATTCCTGG - Intronic
1050814014 9:9786770-9786792 AATAAAAAAAAATCACTTGCAGG + Intronic
1050966318 9:11807887-11807909 GAAAAAAAAAAATTAAGTCCAGG + Intergenic
1051189553 9:14497154-14497176 GATAAAAAAACCTAGATACCTGG - Intergenic
1051610796 9:18959775-18959797 AAAAAAAAAAAAAAGATTCCAGG + Intronic
1051692577 9:19732111-19732133 GTTAAAAAAAAAACTCTTCCTGG + Intronic
1052166864 9:25340459-25340481 AAAAAAAAAAAATCCGTTCCTGG - Intergenic
1052525462 9:29612989-29613011 TATAAAAAAAAATCATTGCCAGG - Intergenic
1053623038 9:39840410-39840432 GATAAAAAAAAATCACCTCTTGG - Intergenic
1053890840 9:42691473-42691495 GATAAAAAAAAATCACCTCTTGG - Intergenic
1054220857 9:62410281-62410303 GATAAAAAAAAATCACCTCTTGG + Intergenic
1054229857 9:62498891-62498913 GATAAAAAAAAATCACCTCTTGG - Intergenic
1054892420 9:70265667-70265689 GATGAAAAAAAATACATGCCAGG + Intronic
1054900595 9:70364814-70364836 GGAAAAAAAAAATCCATTTCAGG + Intergenic
1056249914 9:84737258-84737280 GATAAAAAAAAATATATTGTGGG - Intronic
1056810865 9:89762882-89762904 GATAAAGAAAAAGCCATTGCTGG + Intergenic
1057197780 9:93124574-93124596 GATAAAAAAAAAAAGATTTCTGG - Intronic
1058424049 9:104861442-104861464 GTTAAAATAAAATTGATTTCTGG - Intronic
1058625633 9:106930166-106930188 GATAAAATAAAATCTACTCCTGG - Intronic
1059639722 9:116204896-116204918 GAAAAAAAAAAATCCTTTCAAGG + Intronic
1059644957 9:116256009-116256031 GAAAAAAAAAAAAAGATTCCAGG + Intronic
1059725546 9:117005070-117005092 AAAAAAAAAAAATCGACTACAGG - Intronic
1060100416 9:120835745-120835767 AATAAAATAAAGTAGATTCCTGG + Intronic
1060388485 9:123256890-123256912 AAAAAAAAAAAAAAGATTCCTGG - Intronic
1060938993 9:127532730-127532752 AAAAAAAAAAAATCGCTTTCTGG + Intronic
1060951575 9:127607207-127607229 AAAAAAAAAAAATCCATTGCTGG + Intergenic
1061320766 9:129827761-129827783 GAAAAAGAAAAATGGCTTCCAGG - Exonic
1061622431 9:131819797-131819819 AATAACAAAATATCCATTCCAGG - Intergenic
1062206130 9:135338449-135338471 GAAAAAAAAAAAAAGAGTCCAGG + Intergenic
1186574467 X:10750660-10750682 AATAAAATAAAATAAATTCCCGG + Intronic
1187096469 X:16153921-16153943 GTGAAAAAAAACTCGATTCAGGG - Intergenic
1187471308 X:19571596-19571618 GATATAAAGAAATACATTCCTGG + Intronic
1187686769 X:21823178-21823200 GAGAGAAAAAAATGGATTCTGGG - Intergenic
1187902924 X:24041286-24041308 GAAAAAAAAAAATCTAGGCCAGG - Intergenic
1187959662 X:24556458-24556480 AATAAAAAAAAATTGTTTCTAGG + Intergenic
1188525972 X:31088292-31088314 AAAAAAAAAAAATCACTTCCCGG + Intergenic
1188598242 X:31927632-31927654 GAAAAAAAAAAATCCCTTCTTGG - Intronic
1189412367 X:40783967-40783989 GAAAAAATAAAATTGATTCCTGG - Intergenic
1189809445 X:44767361-44767383 GAAAAAAAAAAAAAGAATCCTGG + Intergenic
1190482171 X:50888509-50888531 GATAAAAAGAAGTCAATGCCTGG - Intergenic
1191639717 X:63416925-63416947 GATCAAATAAAATTTATTCCAGG - Intergenic
1192395084 X:70772277-70772299 GATAAAAAATAATCAAGGCCAGG + Intronic
1192508028 X:71702095-71702117 AAAAAAAAAAAAAAGATTCCTGG + Intergenic
1192518668 X:71779458-71779480 AAAAAAAAAAAAAAGATTCCTGG - Intergenic
1192737462 X:73862917-73862939 GAAACAAAAAAATTCATTCCAGG + Intergenic
1192750373 X:73984221-73984243 GATTAAAAAATATGGATTCTAGG - Intergenic
1193197702 X:78654313-78654335 GATAGAAAAATATAGAGTCCAGG + Intergenic
1193290265 X:79764615-79764637 GAGAGAAAAAAATAGATTTCAGG - Intergenic
1193538580 X:82743035-82743057 GGTAAAAAAAAAAGGCTTCCTGG - Intergenic
1193562933 X:83042259-83042281 AATAAAAAAAAAAAGTTTCCAGG + Intergenic
1193859207 X:86643163-86643185 AAAAAAAAAAAAACAATTCCTGG - Intronic
1194925193 X:99816087-99816109 AAAAAAAAAAAGTCAATTCCTGG - Intergenic
1195252072 X:103058767-103058789 GAAAAAAAAAAATGGCTTCTTGG + Intergenic
1196607916 X:117676493-117676515 AATAAAATAAAATCCTTTCCAGG + Intergenic
1196989348 X:121311080-121311102 GATAAAAAAAAGTCAAGTCAAGG - Intergenic
1197088702 X:122510498-122510520 GAAAAAAAAAAATGGTTTCTTGG - Intergenic
1197512737 X:127390948-127390970 AAAAAAAAAAAAACAATTCCAGG + Intergenic
1198064817 X:133085838-133085860 GAAAAAAAAAAATCAATTCCCGG + Intronic
1198319642 X:135507091-135507113 GATAAAAAAAAATCCCTCTCAGG + Intergenic
1198461421 X:136866389-136866411 AAAAAAAAAAAATCAACTCCTGG + Intronic
1198671842 X:139089565-139089587 GATAAAAAAAAATTGAGTCCAGG - Intronic
1199072796 X:143498229-143498251 GAAAAAAAAAAATGGTTTCCTGG - Intergenic
1199107351 X:143885869-143885891 AATATAAAAAAATCTATTGCTGG - Intergenic
1199111865 X:143945220-143945242 GAGAAAATAAAATCAATTTCCGG + Intergenic
1199387288 X:147237626-147237648 GAAAGGAAAAAATAGATTCCTGG - Intergenic
1200130898 X:153845038-153845060 TACACAAAAAAATCAATTCCAGG - Intergenic
1200816298 Y:7536511-7536533 GATAAATAAAAATAGATACATGG + Intergenic
1202329098 Y:23726951-23726973 AATAAAAAAAAATCGATGTCTGG + Intergenic
1202541673 Y:25943103-25943125 AATAAAAAAAAATCGATGTCTGG - Intergenic