ID: 1018250530

View in Genome Browser
Species Human (GRCh38)
Location 6:161865446-161865468
Sequence CCATCTAGGACTTTCATAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 25, 2: 43, 3: 50, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018250530_1018250533 -3 Left 1018250530 6:161865446-161865468 CCAACTATGAAAGTCCTAGATGG 0: 1
1: 25
2: 43
3: 50
4: 143
Right 1018250533 6:161865466-161865488 TGGCATCTTTTTACAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018250530 Original CRISPR CCATCTAGGACTTTCATAGT TGG (reversed) Intronic
902165359 1:14566562-14566584 TCATCTAGGATTTTCATAAGTGG - Intergenic
904776883 1:32914812-32914834 TCATCTAGGACTTTCATAGCTGG - Intergenic
906495957 1:46303917-46303939 CCCTCTAGGGTTTGCATAGTCGG + Intronic
907875764 1:58486410-58486432 GCATGTAGGACATTAATAGTTGG - Intronic
909695084 1:78458910-78458932 CCATCTAGGACTTTCACAGCTGG + Intronic
909824109 1:80104407-80104429 CCATTTAGGAGTTTCATAGCTGG - Intergenic
917562223 1:176170795-176170817 CCATCTAGGACTTTAATTGCTGG - Intronic
917993590 1:180410381-180410403 CCGTCCAGGACTTTCATGGCTGG + Intronic
918632478 1:186734449-186734471 TCATCTAGGATTTTCATGGCTGG - Intergenic
921301750 1:213757730-213757752 ACAACCAGGACTTTCATAGCTGG + Intergenic
921870036 1:220130470-220130492 TCCTCTAGTAGTTTCATAGTTGG + Intronic
922389500 1:225125306-225125328 CCATCCAAGACTTTTGTAGTTGG - Intronic
924951086 1:248884038-248884060 TCTTCTAGGATTTTTATAGTTGG + Intergenic
1063039668 10:2324207-2324229 CCATCTAGGACTGCCATAGCTGG - Intergenic
1064413844 10:15131757-15131779 ACATCTTTGACTTTCATAGCTGG + Intronic
1075354622 10:121759883-121759905 CCATCTAGGATTTTCACAGCAGG + Intronic
1078306948 11:10198629-10198651 CCATCTAGGATTTTCATAGCTGG - Intronic
1081094181 11:38911509-38911531 CCATCTAGCACTTCCATAGCTGG + Intergenic
1082954526 11:58855660-58855682 CCATCAAGGACTTTCAGAGCTGG - Intronic
1083377000 11:62231953-62231975 TCTTCTAGGATTATCATAGTTGG - Intergenic
1085373021 11:76028943-76028965 CCATCTAGGACTTCGATAGCTGG + Intronic
1085854380 11:80159572-80159594 CTAGATAAGACTTTCATAGTTGG - Intergenic
1087375527 11:97335249-97335271 CCATCTAACACTGTCATTGTTGG + Intergenic
1091867177 12:3850882-3850904 CAACATAGAACTTTCATAGTTGG - Intronic
1092599929 12:10049421-10049443 ACATCTAGGACTTTTATAGCTGG - Intronic
1093768552 12:22993669-22993691 TCATCTTTGACTTTGATAGTGGG - Intergenic
1093914097 12:24781276-24781298 CCAGGTAGGACTTTCAGAGAGGG + Intergenic
1094637140 12:32237468-32237490 CAGGCTAGGACTTTCATAGCTGG + Intronic
1095729100 12:45486296-45486318 TCATCTAGGACTTTCATAGCTGG + Intergenic
1096130060 12:49151513-49151535 TCATCTGTGACTTTCATAGCTGG + Intergenic
1097773109 12:63613026-63613048 CCATCTAGGACTTTCTTTGTAGG - Intronic
1098514039 12:71353011-71353033 TCTTCTAGGATTTTTATAGTTGG - Intronic
1098537767 12:71614535-71614557 CCAACTATGAATTTCATAATAGG - Exonic
1098921714 12:76308515-76308537 CCACCTAGAACTTCCATAGCTGG - Intergenic
1099480879 12:83164813-83164835 CCATCTAGGACTTTCATAGCCGG - Intergenic
1100618792 12:96251988-96252010 CCATCTAGGACTTTCATAGCTGG + Intronic
1101495780 12:105253034-105253056 CTATCCATGACTTTCAAAGTGGG + Intronic
1101620528 12:106382890-106382912 CCATCTAGGACTTTGACAGCTGG - Intronic
1101857337 12:108454977-108454999 CCATTTGGGGCTTTCACAGTGGG - Intergenic
1102315679 12:111885456-111885478 ACATCTAGGAGTTTTATATTGGG + Intronic
1104113723 12:125728470-125728492 TCATCTAGGACATTCACAGCAGG + Intergenic
1104488363 12:129172002-129172024 TCATCTAGTGCTTTCATAGCTGG - Intronic
1104520687 12:129472156-129472178 CCATCTAGGAGCTTCACAGCTGG + Intronic
1104799597 12:131544874-131544896 CCATCTAGGACTTTCACAGTGGG + Intergenic
1105324987 13:19362591-19362613 CCATCTAGGACTTCCACAGCTGG - Intergenic
1105868298 13:24480955-24480977 CCATCTAGGACTTCCACAGCCGG + Intronic
1107257946 13:38453194-38453216 CCATCTAGGTCTTTCATAGCTGG + Intergenic
1108632954 13:52303779-52303801 CCATCCAGGACTTTTATATTTGG - Intergenic
1108653742 13:52508818-52508840 CCATCCAGGACTTTTATATTTGG + Intergenic
1108990591 13:56652154-56652176 CCTTCTAGGGCTTTTATAGTTGG - Intergenic
1109126009 13:58517811-58517833 CCATTTAGGATTTTCATCGCTGG + Intergenic
1111530676 13:89533545-89533567 TCATCTAAGATTTTCATAGCTGG - Intergenic
1111575760 13:90152494-90152516 CCATCTAGAACTTCCACAGCTGG - Intergenic
1111617587 13:90680719-90680741 CCATCTAGGACTTTCATAGCTGG - Intergenic
1111763762 13:92499895-92499917 CCATCTAGGATTTTCAGTTTGGG + Intronic
1111860754 13:93702559-93702581 CCATCGAGGACATTCACAGCTGG - Intronic
1112232874 13:97607047-97607069 CCACCTTTGATTTTCATAGTGGG + Intergenic
1112836530 13:103521720-103521742 CCATCTAGGACTTTGACAGCTGG + Intergenic
1113057273 13:106282283-106282305 CCATCTAGCACTGTCATAGCTGG + Intergenic
1113845997 13:113392001-113392023 TCTTCTAGGACTTTGATAGAAGG - Intergenic
1115709590 14:36036320-36036342 GCATCTAAGACTTTCGTAGCTGG + Intergenic
1116150593 14:41136688-41136710 CCATCTAAAACTTTCATGGCTGG - Intergenic
1116904065 14:50388249-50388271 CTAATTAGAACTTTCATAGTTGG - Intronic
1118490481 14:66254394-66254416 CCCTCTTGGACTTTCTTACTAGG + Intergenic
1118507769 14:66433025-66433047 CCATCTAGGACTTTTGGAGTAGG + Intergenic
1118656060 14:67950183-67950205 CCACCTCAGACTTTCATAGCTGG - Intronic
1119944399 14:78676709-78676731 CCATCTAGGACTTTCATAGCTGG + Intronic
1123839347 15:24231195-24231217 TCTTGTAGTACTTTCATAGTTGG + Intergenic
1125345534 15:38715097-38715119 CATTCTAGAACTTTTATAGTTGG - Intergenic
1125981516 15:44006036-44006058 CCATCTAGGACTTTCATAGATGG + Intronic
1128603454 15:69016575-69016597 CCATCTAGGACTTGCTGACTTGG + Intronic
1128848882 15:70930600-70930622 CCATCTAGGACTTTTATAGATGG - Intronic
1129624411 15:77181682-77181704 CCATCTGCCACTATCATAGTGGG + Exonic
1131219190 15:90567055-90567077 CCATCTAGGACTTTAATTCCTGG + Intronic
1131729676 15:95266809-95266831 CCATCTAGGACTCTGTTAGCAGG + Intergenic
1132353461 15:101154769-101154791 ACATCTATTACTTTCCTAGTGGG - Intergenic
1137844397 16:51673177-51673199 ACAACTTGGACTTTCATAGCAGG + Intergenic
1137894083 16:52192283-52192305 CCATCAGGGTCATTCATAGTTGG + Intergenic
1139373647 16:66483655-66483677 GCATCTAGGACTATGTTAGTGGG - Intronic
1141998685 16:87650965-87650987 CCATCTAGGACTTTCATGCTAGG + Intronic
1143442914 17:6989461-6989483 CCATCTAGGACTTTCATAGCTGG + Intronic
1150936096 17:69637288-69637310 CCATTTAAAAATTTCATAGTTGG + Intergenic
1151410872 17:73927757-73927779 CCATCTAGGCTTTTCTTAGCTGG + Intergenic
1153288002 18:3474218-3474240 CCATCTAGACCTTTAATAGCTGG + Intergenic
1153566358 18:6422063-6422085 CCATCTAGAACTGTCATAGCTGG - Intergenic
1154341556 18:13506683-13506705 CCATGTAGGATTTTCATAGCTGG + Intronic
1154341714 18:13508421-13508443 CCATGTAGGGTTTTCATAGCTGG + Intronic
1155314742 18:24560376-24560398 TCATCTAGGACTTTTAAATTAGG - Intergenic
1159656910 18:71040948-71040970 CCATCTAGGACTTTCATAGCTGG + Intergenic
1160402609 18:78621764-78621786 CCATAGGGGACTTTCATAGAGGG - Intergenic
1160546416 18:79659543-79659565 CCGTCTAGGACTTTCATAGGTGG - Intergenic
1160552134 18:79700766-79700788 CCGTCTAGGACTTTCATAGCTGG + Intronic
1160656343 19:273092-273114 CTTACTAGGACTTTCATAGCCGG + Intergenic
1164488808 19:28687635-28687657 CTATTTAGGCCTTTCAAAGTCGG + Intergenic
1164691861 19:30217312-30217334 CCATCTAAGACTTTGCTTGTGGG - Intergenic
1164901149 19:31925329-31925351 CCACCTAAGACTTTCATTGCTGG - Intergenic
1166392405 19:42416496-42416518 CCATCCAGGACTTTCCTAGCTGG + Intronic
924980240 2:212956-212978 CCATCTAGGACTTTCATAGCTGG - Intergenic
925081555 2:1072187-1072209 CCATCCAGGACTTTCATAGCTGG + Intronic
925104230 2:1276266-1276288 CCATCTAGGAATTTCTGAGCTGG + Intronic
925200412 2:1963506-1963528 GCATCTAGGAATTCCATAGCTGG - Intronic
925215483 2:2091638-2091660 CCATCTAGGGCCTTCAGAGCTGG - Intronic
926031985 2:9599418-9599440 CCATCAAGTACTTTCATAGGAGG + Intronic
926895328 2:17680947-17680969 CGATCTACGGCTTTCATAGCTGG - Intronic
927108656 2:19848695-19848717 CCATCTAGCACTTTGATGCTTGG + Intergenic
928126345 2:28619239-28619261 CCACCTAGGACTTTTAAAATAGG + Intronic
929375063 2:41275595-41275617 CCATCTAGGACTTTCTTAGCTGG - Intergenic
931855435 2:66297946-66297968 CCATCTCGCAGTTTTATAGTGGG - Intergenic
933301982 2:80551399-80551421 CCATTTACAACTTTCATAGCTGG - Intronic
933944456 2:87273450-87273472 CCATCTAGGACTTTCATAGCTGG - Intergenic
934148360 2:89118482-89118504 CCAACTAAGAATTTCATATTTGG + Intergenic
934218927 2:90063531-90063553 CCAACTAAGAATTTCATATTTGG - Intergenic
935608284 2:104993034-104993056 CCATCTAGGACTTTCATAGATGG + Intergenic
935796860 2:106650761-106650783 CCATGTAAGACTTTCATAGCTGG - Intergenic
936335760 2:111588131-111588153 CCATCTAGGACTTTCATAGCTGG + Intergenic
936920239 2:117681260-117681282 CCATGTAGGACTTTCATAGCTGG + Intergenic
939145886 2:138414030-138414052 CCTTCTTGGACTTCCATAATGGG + Intergenic
941322727 2:164075406-164075428 CCATATAGGACCTTGATAGCAGG - Intergenic
943562715 2:189483034-189483056 CAATCAAGGACTATCAGAGTTGG - Intergenic
944720091 2:202415157-202415179 CCATCTAGGACTTTTATAACTGG + Intronic
945791968 2:214316534-214316556 CCATCTACAACTTTCATCGCGGG - Intronic
946524277 2:220501364-220501386 TCATCTAGGACTTTCATAGCTGG + Intergenic
1169032776 20:2424225-2424247 CCATCTAGGACTTTCATAGCGGG - Intronic
1170174289 20:13451354-13451376 CCATCTAGGACTTTCATAGCTGG - Intronic
1170405403 20:16030198-16030220 CCATCTTGGACTTCCATAGTGGG - Intronic
1170502118 20:16985135-16985157 TCATCTAGGACTTCCATAGGTGG + Intergenic
1177191723 21:17859403-17859425 CCATATAAGACTTTCATTCTCGG - Intergenic
1179130776 21:38635195-38635217 CCATATGGTACTATCATAGTAGG + Intronic
1182815566 22:33160371-33160393 TCAGCTAGGAGTTTCATACTTGG + Intergenic
1185318328 22:50188658-50188680 CCTTCTAATACCTTCATAGTGGG + Intronic
950483346 3:13258432-13258454 CCATCTCGGCCTTCCAAAGTGGG - Intergenic
950632519 3:14292575-14292597 CCATCTAGGACTTACATAGCTGG + Intergenic
951307175 3:21079043-21079065 TCATCTAAGACTTGCATAGCTGG - Intergenic
951517504 3:23577733-23577755 CAATCTAGGACATTTATAGCTGG + Intronic
952016988 3:28970080-28970102 CCATCTATGATTTTCTTGGTGGG + Intergenic
953367276 3:42356070-42356092 CCATCTAGGACATTCATAGCTGG + Intergenic
955416487 3:58696641-58696663 CCATCTAGGATTTTCCTAGCTGG - Intergenic
957499680 3:81038210-81038232 CCATCTAGGACTTTTATAGCTGG - Intergenic
958534802 3:95386806-95386828 CCTTCTAGGATTTCCATAATAGG + Intergenic
959165160 3:102767642-102767664 CCATTTAGGACTTTCAGAGCTGG - Intergenic
960008584 3:112808266-112808288 CCATCTCAGACTTTTATAGCTGG - Intronic
963293175 3:143514474-143514496 CCATGTAGGACTTTCATAGCTGG - Intronic
964617075 3:158677855-158677877 CCATCTGTGACTTTCATAGCTGG + Intronic
965363326 3:167767053-167767075 CCATCTAGGACTTTCATAGCTGG + Intronic
965627578 3:170697040-170697062 CCACCTAGGACTTTTAGACTTGG + Intronic
965867980 3:173228958-173228980 CCATCTAGGACTTTCATAGCTGG - Intergenic
966356469 3:179085058-179085080 TCTTCTAGGATTTTTATAGTTGG - Intergenic
966356969 3:179090854-179090876 TCTTCTAGGATTTTTATAGTTGG - Intergenic
966717472 3:183028009-183028031 CCATCTAGGACTTTCATAGCTGG + Intronic
968438199 4:606562-606584 CCATCTGAGACTTTTATAGCTGG + Intergenic
969167295 4:5327830-5327852 TCATTTAGGACTTTCATAGCTGG - Intronic
969312804 4:6363920-6363942 CCATCAAGGACTTTCTAAGGAGG + Intronic
970332079 4:14997125-14997147 TCATCTAGGACTTTCATAGCTGG + Intergenic
970450748 4:16164777-16164799 CCAACTAGGTAATTCATAGTGGG - Intronic
972606652 4:40619807-40619829 CCCTCTGGGACTTTCTTTGTTGG - Intronic
972837391 4:42889660-42889682 CCATCTAGAACTTTCATAGCTGG + Intergenic
974791687 4:66698757-66698779 CTGTCTAGGATTTTCATAGCTGG - Intergenic
974791774 4:66700270-66700292 CCATCAAGGAATTTTTTAGTTGG - Intergenic
976985179 4:91285923-91285945 CTATCTAGAAATTTTATAGTTGG + Intronic
977071991 4:92402856-92402878 CCATGTAGGACTTTCATAGGTGG - Intronic
979811624 4:125043343-125043365 CCATCTAGGACTTTTATAGCTGG + Intergenic
979812025 4:125048146-125048168 CCTTATAGTATTTTCATAGTTGG - Intergenic
980529516 4:134033988-134034010 CCATCTAGAACTTTCATAGCGGG + Intergenic
980835472 4:138186571-138186593 CCATCTGCTACTTTCATATTAGG - Intronic
982148141 4:152420980-152421002 CCATCTAAGACTTTTCTAGCTGG - Intronic
982458925 4:155643711-155643733 CCATCTAGGATTTTCAGATCTGG + Intergenic
982837291 4:160135804-160135826 TCTTCTAGTAGTTTCATAGTTGG - Intergenic
983134462 4:164063273-164063295 CCATTTAAGACTTTCATACCTGG - Intronic
983739036 4:171104676-171104698 CCTTCTATGATTTTCATAGCTGG + Intergenic
984326208 4:178254646-178254668 CCATCTAGGACTTTCAAAGCTGG - Intergenic
984401044 4:179264458-179264480 CCATCTGGTCCTTTCATTGTTGG - Intergenic
984784930 4:183558775-183558797 CCATCTAGGGGCCTCATAGTAGG + Intergenic
990002986 5:50916595-50916617 TCATCTAGGGCTTTCATAGCTGG - Intergenic
990481634 5:56216979-56217001 CCACCTAGGACTTTCATAGCTGG + Intronic
991919355 5:71639212-71639234 CCACCTAGGACTTTCATAGCTGG - Intronic
992216760 5:74532601-74532623 CTATCTAGGACTTTCCTAGCTGG + Intergenic
993075711 5:83227690-83227712 ACATGAAGGATTTTCATAGTTGG + Intronic
993331839 5:86610296-86610318 TCTTCTAGTATTTTCATAGTTGG + Intergenic
994235935 5:97362223-97362245 CCATCTAGCACTTTTATAGCTGG - Intergenic
995291513 5:110461615-110461637 TCATCTTGGACTTTCATAGCTGG + Intronic
995572722 5:113497560-113497582 TCTTTTAGGAGTTTCATAGTTGG + Intergenic
995887008 5:116906557-116906579 CCATCTAGGACTTTCATAGCTGG + Intergenic
996194529 5:120587373-120587395 CCACCTAGGACTTTCATAGCTGG + Intronic
998883133 5:146665199-146665221 CAATCTAGGACTTTCATAGCTGG - Intronic
999509617 5:152235350-152235372 CCAACTAAGACTTTCACAGCTGG - Intergenic
1000389105 5:160704652-160704674 CCATCTACAACTTTCATAGCTGG - Intronic
1000482282 5:161793434-161793456 GCAGTTAGGACTTTCAAAGTAGG - Intergenic
1002149562 5:177216442-177216464 TCTTCTAGGAGTTTCATAGTTGG + Intronic
1003954739 6:11151377-11151399 CCATATAGGAGTTTCATTTTTGG + Intergenic
1006693497 6:35910632-35910654 CCATCTAGGACTTTCATAGCTGG + Intronic
1007017710 6:38485860-38485882 CCACCCAGGACTTTAATAGCTGG - Intronic
1007379781 6:41480921-41480943 ACATCTAGGACTTTCACAGCTGG + Intergenic
1008271018 6:49490113-49490135 ATCTCTAGGACTTTGATAGTTGG - Intronic
1008319476 6:50090439-50090461 CCATCTAGGATTTTCATAGCTGG + Intergenic
1008916938 6:56798229-56798251 CCACATAGGACTTTCATAGTTGG + Intronic
1009349062 6:62652000-62652022 CCATCTTGGTCTTTTATAATAGG - Intergenic
1009707398 6:67270043-67270065 TCAGCTATGACTTTCATGGTCGG + Intergenic
1009919852 6:70043924-70043946 CCATCTAAGACTTTCATAGCTGG - Intronic
1010652785 6:78474715-78474737 CCAGGTAGGAATTTCACAGTAGG - Intergenic
1011872002 6:91907177-91907199 TCATCTAGGACTTTCATAGCTGG - Intergenic
1012080222 6:94748927-94748949 CCATCTAGAACTTTCATAACTGG - Intergenic
1012284518 6:97372836-97372858 CCATCTATGACCTTCATAGCTGG + Intergenic
1012345244 6:98177876-98177898 TCTTCTAGGGCTTTTATAGTTGG - Intergenic
1013202870 6:107917977-107917999 CCATTTAGGACTTTCACTGCTGG + Intronic
1014354235 6:120384434-120384456 ACATCTAGGACTTTCATAGCTGG - Intergenic
1014661343 6:124177039-124177061 CCACATAGGACTTTTAAAGTAGG - Intronic
1016411490 6:143787918-143787940 CCATTTTGGTCTTTCTTAGTTGG - Intronic
1016572293 6:145528322-145528344 CCATGTAGAACTTTCATAGCTGG + Intronic
1016848106 6:148589020-148589042 GCATCCAGGAGTTTCATAGGAGG + Intergenic
1017352105 6:153454524-153454546 TCTTCTAGGAATTTTATAGTGGG + Intergenic
1017799624 6:157882017-157882039 CCATCTAGGACTTGCACAGCTGG + Intronic
1018250530 6:161865446-161865468 CCATCTAGGACTTTCATAGTTGG - Intronic
1020392713 7:7675685-7675707 CCATCTTGGACTAGCATAATTGG + Intronic
1020423861 7:8041507-8041529 TTGTCTAGGACTTTCATAGCTGG + Intronic
1021325394 7:19260178-19260200 TCTTCTAGGATTTTTATAGTTGG - Intergenic
1022594614 7:31700626-31700648 CCATCTAGGCCATTCATAGCTGG + Intronic
1022932673 7:35136730-35136752 CCATCTAGGACTTTCTTTGTAGG - Intergenic
1026642048 7:72135800-72135822 CCATCTAGGACTTTCATAGCTGG - Intronic
1027632034 7:80618955-80618977 CCATTTAGGACTTCCATAGCTGG + Intronic
1028853595 7:95564876-95564898 CCATCTAGAAATTTTATTGTGGG - Intergenic
1029828594 7:103229506-103229528 CCATCTAGGACTTTCTTTGTAGG - Intergenic
1031057377 7:117007643-117007665 CCATCTAGGCCTTTCATAGCTGG + Intronic
1031811956 7:126381501-126381523 CCATCTATGATTTTTATAGGAGG - Intergenic
1032892779 7:136217163-136217185 CAATCTAAGACTTACAGAGTAGG - Intergenic
1034981195 7:155478268-155478290 CCTTCTAGGACTTTCATGGCTGG + Intronic
1035036107 7:155895459-155895481 CCACTTAGGACTTTCAAAGCTGG + Intergenic
1035167038 7:156997399-156997421 CCATCTAAGACCTTCATAGCTGG - Intronic
1035958833 8:4114104-4114126 CCATCTAGGACTTTCATAGGAGG + Intronic
1036469164 8:9035296-9035318 ACATCTAGGACTTTGATAGCTGG + Intronic
1037392811 8:18412420-18412442 TCTTCTAGGATTTTTATAGTTGG - Intergenic
1038297566 8:26309556-26309578 CCACCTAGGACTCTCATAGCTGG - Intronic
1039212246 8:35230738-35230760 CTACCTAGGACATTCATAGCTGG - Intergenic
1040441320 8:47446114-47446136 TCACCTAGGACTTTCATAGCTGG + Intronic
1041586482 8:59526247-59526269 TCATCTAAAACTTTCATGGTTGG + Intergenic
1042042616 8:64609066-64609088 CAATCTAGGAAGTTCAAAGTTGG + Intronic
1044044147 8:87409565-87409587 CCATCTTCAACTTTCATAGCAGG + Intronic
1044691730 8:94887081-94887103 TCATCTAAGACTTTTATAGCTGG - Intronic
1049034675 8:140065444-140065466 CCATCTAGGACTTTCATAGCTGG + Intronic
1049677012 8:143894468-143894490 CCATCTAAGACTTTCGTAGCTGG - Intergenic
1050051042 9:1601788-1601810 CCATCTAGCGCTTTCATAAAAGG + Intergenic
1050349539 9:4727281-4727303 CCATCTAGGACTTCCATTGCTGG - Intronic
1051613520 9:18984373-18984395 CCATCTAGGACTTTTATAGCTGG - Intronic
1052456492 9:28705698-28705720 CCAGCGAGGACATTCATACTGGG - Intergenic
1053132586 9:35625620-35625642 CCATCTAGGACTTTCATAGCTGG + Intronic
1056227258 9:84508065-84508087 TAATCTAAGACTTTCATAGCTGG + Intergenic
1057975667 9:99603219-99603241 ATATTTAGGACATTCATAGTAGG + Intergenic
1059049666 9:110910115-110910137 CCACCTAAGACTTTCATAGCTGG + Intronic
1059833708 9:118127349-118127371 CCATCTAGGACTTTCATAACTGG + Intergenic
1187463690 X:19510107-19510129 CCGTCTAGGATTTTTTTAGTTGG - Intronic
1188469258 X:30518695-30518717 CCATCTAGGACTTTCATAGCTGG + Intergenic
1188914436 X:35892150-35892172 CCTTTTAGGACTGTCATAGAAGG - Intergenic
1189233358 X:39469386-39469408 CCCTGCAGGACTTTCACAGTGGG + Intergenic
1191957729 X:66664227-66664249 CCATCTAGGACTTTCAAAGCTGG - Intergenic
1192072995 X:67961062-67961084 GAATCCAGGATTTTCATAGTAGG + Intergenic
1193199380 X:78670179-78670201 TCTTCTAGGATTTTTATAGTTGG - Intergenic
1193278665 X:79622553-79622575 CAATATAGGACTTTCAAATTGGG + Intergenic
1193926669 X:87494959-87494981 CCAACTAGGACTTTCGTAGCTGG + Intergenic
1194180963 X:90712121-90712143 ACATCTAGGACTTTCATAGCTGG + Intergenic
1194846459 X:98815231-98815253 CCATCTATGACTTTCATAGCTGG - Intergenic
1195987779 X:110649558-110649580 CCATCTAGGACTTTCATAGCTGG - Intergenic
1196393245 X:115232161-115232183 GCATTCAGGACTTTCATTGTTGG - Intronic
1200527578 Y:4293993-4294015 ACATCTAGGACTTTCATAGATGG + Intergenic