ID: 1018250533

View in Genome Browser
Species Human (GRCh38)
Location 6:161865466-161865488
Sequence TGGCATCTTTTTACAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018250530_1018250533 -3 Left 1018250530 6:161865446-161865468 CCAACTATGAAAGTCCTAGATGG 0: 1
1: 25
2: 43
3: 50
4: 143
Right 1018250533 6:161865466-161865488 TGGCATCTTTTTACAACAGAAGG No data
1018250529_1018250533 19 Left 1018250529 6:161865424-161865446 CCAGGAATCGATTTTTTTTTATC 0: 1
1: 0
2: 9
3: 70
4: 616
Right 1018250533 6:161865466-161865488 TGGCATCTTTTTACAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018250533 Original CRISPR TGGCATCTTTTTACAACAGA AGG Intronic
No off target data available for this crispr