ID: 1018250592

View in Genome Browser
Species Human (GRCh38)
Location 6:161866163-161866185
Sequence TCTTATTTGGGCATGGTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 1, 2: 37, 3: 156, 4: 482}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018250592 Original CRISPR TCTTATTTGGGCATGGTTTT TGG Intronic
901215821 1:7554813-7554835 TCTTTTTTTGGCATGGGGTTGGG - Intronic
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
902626738 1:17680930-17680952 ACTTATCTGGGCATGGTGGTGGG - Intronic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
904427045 1:30434721-30434743 TCTTTTTTTGACATTGTTTTGGG - Intergenic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906224655 1:44111503-44111525 TCTTATTTGGGAATAATTTTAGG + Intergenic
906533323 1:46536340-46536362 AATTATCTGGGCATGGTGTTGGG - Intergenic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
908139682 1:61171580-61171602 CCTTATTTAGGAAAGGTTTTTGG + Intronic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910832511 1:91475035-91475057 TCTTGTTTGATCAGGGTTTTTGG + Intergenic
910997033 1:93116940-93116962 TCTTAGGTGGGCACGGTTTTTGG + Intronic
911056881 1:93716534-93716556 TCCTTTTAGGGCCTGGTTTTGGG - Intronic
911173509 1:94795466-94795488 TCTTAAATTGGCATGGTTTTAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911649653 1:100373337-100373359 TCTTATTTGGGTACAGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912804982 1:112748552-112748574 GCTTATTTGTGCATGATATTTGG - Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
914975893 1:152361547-152361569 TCCTATCTGGGCATTGCTTTGGG + Intergenic
916877499 1:168985366-168985388 ATTTATTTGGGCGTGGGTTTTGG - Intergenic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917552327 1:176045901-176045923 TCTTTGTTGGACATGGTTGTTGG - Intronic
918386200 1:184010645-184010667 TGTTCTTTGGTCATGGTTCTAGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919204081 1:194397640-194397662 TGTTATCTGGACATGGTTTGTGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919548905 1:198959941-198959963 TCTTATATGGGTGTGGTTTATGG + Intergenic
919702991 1:200650721-200650743 TCTTTTTTGGGGGTGGTTCTGGG - Intronic
919791620 1:201294323-201294345 TCTGATTTGATCATGGATTTGGG + Intronic
921485237 1:215707689-215707711 TCTTTTTCTGGCATGGTTCTAGG + Intronic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922747316 1:228051656-228051678 TTTTATAAGGGCATTGTTTTAGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923350524 1:233100742-233100764 TTATATTTGGGCATTGTCTTAGG + Intronic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924500770 1:244636247-244636269 TCTGTTTTGGGCCTGGTGTTTGG + Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1063129275 10:3163554-3163576 TCTTACTTGGACATTGATTTTGG - Intronic
1063329483 10:5142692-5142714 TCTTATATGGGCACAGTTTAGGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1069342915 10:67433308-67433330 TCTCAAATGGGCTTGGTTTTTGG + Intronic
1070019996 10:72575698-72575720 CCATCTTTGGGCATGGTTTTTGG - Intronic
1071151889 10:82645619-82645641 TCTTATTTTGCCATGGATTTGGG - Intronic
1071783434 10:88873016-88873038 ACATATTTGGGCATGTTTCTGGG - Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1072580825 10:96738991-96739013 TCTTATATGGGCACAGTTCTGGG - Intergenic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1073865034 10:107792648-107792670 TGTTATTTGGGATGGGTTTTAGG - Intergenic
1074381148 10:112981792-112981814 TCTGTTTTGGTCATGGTTTGTGG + Intronic
1075627952 10:123976815-123976837 TATTCTTAGAGCATGGTTTTAGG - Intergenic
1076047540 10:127306645-127306667 TCTGACTTTGGCATGGTGTTAGG + Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1077968240 11:7159022-7159044 TGATGTTTGGGAATGGTTTTTGG + Intergenic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1078255913 11:9658700-9658722 TCTTATTTGCTCTTGTTTTTGGG - Intergenic
1078348142 11:10569841-10569863 TCTCTTTCGGGCATGGTGTTAGG - Intronic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1079379223 11:19922398-19922420 TCTTCCTTGAGCATGGTTTAGGG + Intronic
1080127132 11:28748865-28748887 TCCTATTGAGGCTTGGTTTTAGG + Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080526077 11:33120552-33120574 TATTATTTGTGCATGTATTTAGG + Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1082170899 11:49003942-49003964 TCTTAGCTGGGCATGGTGGTGGG - Intergenic
1082766647 11:57173882-57173904 TCTAAAATGGGCATGATTTTAGG - Intergenic
1084380754 11:68811188-68811210 TCATAATTGGGCTTTGTTTTGGG - Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1086318601 11:85620216-85620238 TCTTATGTGGGTATGATTTGTGG - Intronic
1086822449 11:91450762-91450784 TCTTATTTGGGTAAAGATTTAGG + Intergenic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087452254 11:98339795-98339817 AATTAGCTGGGCATGGTTTTGGG + Intergenic
1087607641 11:100395646-100395668 ATTTATTTTGGCATTGTTTTAGG + Intergenic
1087644798 11:100796267-100796289 TCTTATTTGGGTAGGGTCTGTGG - Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088348411 11:108856877-108856899 TATTATTTGGGCAAGGCTCTAGG + Intronic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1090068195 11:123521557-123521579 TCCTTTATGGGCATTGTTTTTGG + Intergenic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1090411501 11:126512828-126512850 TCTCATTTGCTCATGGTTTGGGG - Intronic
1091027557 11:132155622-132155644 TTTTGTTTGGGCATGTTTTATGG + Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092573576 12:9753229-9753251 TCATTCTTGGGCATGGTTATTGG + Exonic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093149911 12:15608294-15608316 TCTTGTCAGGGCATGGTTCTAGG - Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1093969005 12:25357409-25357431 TCTCATTTAGGGATGGTTTGTGG - Intergenic
1093979620 12:25461612-25461634 TCTAATTTGGGGATAGTTATGGG - Intronic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1095429997 12:42122919-42122941 TCTTCTTTGGGCATGCTATCAGG - Intronic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1095688130 12:45058966-45058988 TCTTATATGGGCACAGTTCTTGG + Intergenic
1097068204 12:56336111-56336133 TCTTTTTTGTTCTTGGTTTTTGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1097723889 12:63052642-63052664 TCTTATCTGGGCCAGGTATTTGG + Intergenic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098752084 12:74306434-74306456 TCTTATATGGGTTTGGTTTATGG + Intergenic
1098785665 12:74751091-74751113 TCTTATGTGGGTATAGTTTGTGG - Intergenic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1099120132 12:78679268-78679290 TATTAGTTGGGCATGGTGGTGGG + Intergenic
1099161997 12:79253398-79253420 TCTCATATGGGCATAGTTCTTGG - Intronic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099804794 12:87505306-87505328 AATTATCTGGGCATGGTTGTGGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100171929 12:91984767-91984789 TCTTCTTTATACATGGTTTTAGG - Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1101489198 12:105196294-105196316 CCTTCTTTGGGCATGGTTTGAGG - Intronic
1102158349 12:110748184-110748206 TTTTATTTTGGAATAGTTTTAGG + Intergenic
1103661065 12:122517805-122517827 TCAAATTTGTGAATGGTTTTTGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1105387136 13:19941540-19941562 CCTTATTTGGGTATAGTTTGAGG + Intergenic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1105475750 13:20727071-20727093 AATTAGTTGGGCATGGTGTTGGG - Intergenic
1105747018 13:23386939-23386961 TCTTATTTGGGCACAGTTCGTGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106464257 13:29998828-29998850 TTTTATTTTGGAATAGTTTTAGG + Intergenic
1106848831 13:33766523-33766545 TCTTATTTGTGCATGAGGTTAGG + Intergenic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107068731 13:36245992-36246014 TTTTATATGGGCTTGGTTTATGG - Intronic
1108467958 13:50737610-50737632 TCTTCTATGGGCATGGCTTATGG - Intronic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109870529 13:68327117-68327139 GGTTAGTTGGGCATGGTGTTGGG - Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110574749 13:77042458-77042480 GCTTATTTGGTTTTGGTTTTTGG - Intergenic
1110622138 13:77608586-77608608 TATTATTTTGGCATGGTGTTTGG - Intronic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1112015881 13:95331085-95331107 TCTTGTGTGTGCATGGTTATGGG - Intergenic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1113040124 13:106095666-106095688 TCTATTTTGAGCATGCTTTTAGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113648976 13:112020703-112020725 TCCTGTATGGGCATGGTTTATGG - Intergenic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1114734261 14:25027401-25027423 TCATTTTTGGGCATGGTTTGTGG - Intronic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1115109997 14:29810099-29810121 TCTTATATGGGCACAATTTTTGG + Intronic
1115154669 14:30324333-30324355 TCTTATTTGGATGTGGTTTGTGG - Intergenic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115426994 14:33271514-33271536 TTTCATTTGGGTATTGTTTTCGG + Intronic
1115486796 14:33918224-33918246 TCTTATATGGGCACAGTTTTTGG - Intergenic
1116193761 14:41694818-41694840 TCTTGTATGGGAATGTTTTTTGG - Intronic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1118929475 14:70227532-70227554 TCTTATTTGTATTTGGTTTTTGG + Intergenic
1119179172 14:72593143-72593165 TCTTTCTTGGGCATGGTTGTGGG - Intergenic
1119828779 14:77682054-77682076 TCAAATTTGGGTGTGGTTTTGGG + Intronic
1120174986 14:81284025-81284047 TCTTATATGGGCACAGTTTATGG - Intronic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1122869160 14:104627466-104627488 TCATGTTTGGGGGTGGTTTTGGG - Intergenic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1125981349 15:44004572-44004594 TCTTCTATGGGCATGGCTTATGG - Intronic
1126391690 15:48162792-48162814 TTTTATTTGGGCACGGTTGATGG - Intronic
1126407363 15:48334835-48334857 TCTTGTTTGGCCATGGGGTTAGG + Intronic
1126828224 15:52572196-52572218 TCTTATGTGGGAGTGGTTTGTGG - Intergenic
1126939348 15:53749380-53749402 TCTTATATGGGCATAATTTATGG - Intronic
1127250479 15:57231353-57231375 CCTTATTTAGGCATTTTTTTTGG + Intronic
1127447136 15:59075028-59075050 TCTTATATGGGCACAGTTCTTGG + Intronic
1128344758 15:66846532-66846554 TATTATCTGGGCATGGTGCTGGG - Intergenic
1128969476 15:72094894-72094916 TCTTATATGGTCATGATTTTTGG - Intronic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131697237 15:94891044-94891066 TCTTAATTGAGCATGCTTTTAGG + Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1131978217 15:97967486-97967508 TCTTAATTTGGAGTGGTTTTGGG - Intronic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1132538080 16:493413-493435 GCTTATTTGGTCATGCTTTGTGG + Intronic
1133512993 16:6478804-6478826 TCTTATATGGGCACAGTTTTTGG + Intronic
1133910413 16:10060858-10060880 TTAGATTTGGGGATGGTTTTTGG - Intronic
1134334306 16:13283295-13283317 TCTTATTTGGGTTTTCTTTTAGG + Intergenic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1139840656 16:69876330-69876352 TTTTTTTGGGGCATGTTTTTTGG + Intronic
1141239280 16:82250115-82250137 TCTGATTTAGCCATGGTTGTGGG + Intergenic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1141863732 16:86735541-86735563 TGTTATTTGGGTATGTTATTTGG - Intergenic
1142439685 16:90088418-90088440 ACTTAGCTGGGCATGGTGTTAGG + Intronic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1144328984 17:14207374-14207396 TCTTATTTGGGGAGCATTTTGGG - Exonic
1144382166 17:14711490-14711512 AAATATTTGGGCATTGTTTTGGG + Intergenic
1145136479 17:20413714-20413736 TCTTATGTGAGCATAGTTTGAGG + Intergenic
1145371859 17:22312829-22312851 AATTATTTGGGCATGGTGGTGGG + Intergenic
1146392029 17:32431433-32431455 TCTCATTTGGGAATTGTATTAGG + Intergenic
1146632231 17:34479115-34479137 TCTTATTTGGGCAATTTTTAAGG + Intergenic
1146786516 17:35726327-35726349 TCTTATTGGGTCCTGTTTTTCGG + Intronic
1148432335 17:47651778-47651800 TGCTGTTTGGGCACGGTTTTTGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1149326054 17:55530829-55530851 TCTTATTTGGGAATTGTCTGCGG + Intergenic
1151076762 17:71282296-71282318 TGTTAGGTGGGAATGGTTTTTGG - Intergenic
1152673269 17:81622278-81622300 TGTTCTTTGGGCCTTGTTTTAGG - Exonic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154227170 18:12515933-12515955 TTTTATTGGGGCATGCTTTTGGG - Intronic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155367716 18:25065190-25065212 ACTTATTTGGTCATTGTTTTTGG - Intronic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1159802717 18:72920778-72920800 TTTATTTTGGCCATGGTTTTCGG + Intergenic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160358960 18:78254175-78254197 ACTTGCTTGGGCAAGGTTTTAGG + Intergenic
1161168124 19:2799564-2799586 TCTTCTTTCGGCCTGGTTCTTGG + Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1163323518 19:16588342-16588364 TCTTATTTGGGCTCTGTCTTTGG - Intronic
1164356575 19:27440375-27440397 TGTTATTTGTGAACGGTTTTAGG + Intergenic
1167066648 19:47191260-47191282 AGTTATTTGGGCGTGGTTGTGGG + Intronic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
925954271 2:8946731-8946753 TCTTATGTGGGCACAGTTTGTGG - Intronic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928227167 2:29460630-29460652 TTTTATTTTGGCGTGGTTTTTGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
931712844 2:65004165-65004187 TGGTATTTGGCCATGGTATTTGG - Intronic
933548935 2:83749566-83749588 TCTTATTTAGGCATGATTCATGG - Intergenic
934062436 2:88307621-88307643 AATTAGTTGGGCATGGTTGTGGG + Intergenic
934085525 2:88506040-88506062 TCTTTTTTGTTCATGGTTTCAGG + Intergenic
934869664 2:97851710-97851732 TCTTATGTGGGCATAATTTGTGG - Intronic
936045093 2:109181190-109181212 TGTTATTTGGGAATGATCTTAGG + Intronic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
936837638 2:116727239-116727261 TATTATCTGGTCATGGTGTTTGG + Intergenic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
937262861 2:120597562-120597584 TCTTATTTGGGCTGGGTCTAGGG - Intergenic
937502614 2:122496923-122496945 TCTTATTTGTGCAAGGTTGTTGG + Intergenic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
939901911 2:147860620-147860642 CCTTAATTTGGAATGGTTTTGGG + Intronic
940061763 2:149578797-149578819 TCATATTTTTGCATAGTTTTAGG - Intronic
940106319 2:150104852-150104874 TATCAGTTAGGCATGGTTTTAGG - Intergenic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941115475 2:161467314-161467336 AATTAGTTGGGCATGGTTGTGGG - Intronic
941214960 2:162695136-162695158 TCTTATTTTGCAGTGGTTTTTGG + Intronic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
942050744 2:172138442-172138464 GTTTATATGGGCATGGTTCTTGG - Intergenic
942833193 2:180261533-180261555 TCTTATATGGGTGTGGTTCTTGG + Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944382059 2:199122499-199122521 TCTTTTTTAGGCATGGTAGTGGG + Intergenic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
945189317 2:207169809-207169831 TCTTATTTGGGCACAGTTCATGG - Intergenic
945702304 2:213187358-213187380 TCTTACTTTGGCATAATTTTTGG + Intergenic
946133109 2:217622842-217622864 TCTGATATGGGAATGGTTTTTGG - Intronic
946660540 2:221994445-221994467 TCTTATTTTGTAATGGTTTTTGG + Intergenic
946853209 2:223928044-223928066 TCTTATGTGGGCACAGTTTGTGG + Intronic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1169750797 20:8991349-8991371 TCTTTTATGGGCATGGGTCTTGG + Intergenic
1170533946 20:17322175-17322197 TCTTAATGGAGAATGGTTTTAGG + Intronic
1170814280 20:19699556-19699578 TCTTATGTGGGAATTATTTTGGG + Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1171368248 20:24641832-24641854 TTTTATTTTAGAATGGTTTTAGG + Intronic
1172131909 20:32661584-32661606 TCTTCCTTGGGCCTGGTTCTGGG + Intergenic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1173707368 20:45121794-45121816 TCTTATGTGGGCACAGTTTATGG + Intergenic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177572889 21:22910180-22910202 TCTTTTTAAGGCATGGGTTTTGG - Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1178197568 21:30365888-30365910 TCATATGTGGGAGTGGTTTTGGG - Intronic
1178865772 21:36326056-36326078 AATTATTTGGGCATGGTGGTGGG + Intronic
1179465875 21:41572290-41572312 CCTTATGTGGGCATGGTGTCAGG + Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1184825400 22:46947241-46947263 TGTTGTTTGGACATGGTTCTTGG + Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
951401337 3:22235496-22235518 TGTCATTTTGGCATTGTTTTGGG - Intronic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951741373 3:25928102-25928124 TTATATGTGGGCATGGTTTGTGG + Intergenic
952559758 3:34577645-34577667 CCTTATTTGAGCCTGATTTTAGG - Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953862412 3:46556463-46556485 TTATATCTGGGCATGGATTTTGG + Intronic
953971359 3:47350308-47350330 TCATTTTTGGGCATGGTGTAAGG + Intergenic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
955993778 3:64656867-64656889 TCCTGTTTGGGCATAGCTTTAGG - Intronic
956010783 3:64829364-64829386 TTTTATTTGCTCATGATTTTGGG - Intergenic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
956631175 3:71317688-71317710 TCTTATTTGAGTATTGTATTTGG - Intronic
956963965 3:74436694-74436716 TCTAATTTGGCACTGGTTTTGGG - Intronic
957280153 3:78140796-78140818 TCATTTTTGGGCATGTTTTTTGG - Intergenic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
958510919 3:95047792-95047814 TCTAAATTGGAAATGGTTTTGGG + Intergenic
958926732 3:100166431-100166453 TCTTATTTTGCTCTGGTTTTGGG + Intronic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
961780909 3:129319573-129319595 TCATATTTGGCCATTTTTTTTGG - Intergenic
962262303 3:133919680-133919702 TCTCATTAGGGCTTGATTTTAGG - Intergenic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965427443 3:168545115-168545137 TCTTCTTTGAGCATGAATTTAGG - Intergenic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
968153586 3:196359252-196359274 TCTTGTGTGGGCGTGGTTTGTGG - Intronic
968356864 3:198114916-198114938 ACTTATCTGGGCATGGTGGTGGG + Intergenic
970030852 4:11673077-11673099 TGATATTTGGACATGGATTTTGG + Intergenic
970448005 4:16140018-16140040 CCTTATTTGGGAATGGGGTTGGG + Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971477907 4:27089583-27089605 TCATACATTGGCATGGTTTTGGG + Intergenic
971563883 4:28115183-28115205 TCTGATGAGGGCTTGGTTTTTGG - Intergenic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
971830828 4:31692530-31692552 TTTTATGTGGGCATAGTTTTTGG - Intergenic
971868554 4:32205636-32205658 TATTAATTGGGTATGGTTTGTGG - Intergenic
972233170 4:37099012-37099034 TCTTATTTGTGTTTGGCTTTAGG + Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973589416 4:52425587-52425609 TCTTATTTGGACCTGGTGGTGGG - Intergenic
974212066 4:58791042-58791064 TCTTATATGAGCATGGCTTATGG - Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975009989 4:69339115-69339137 TCTTATATGGGCGTGGATTATGG - Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
975864583 4:78713742-78713764 ATTTATTTGATCATGGTTTTAGG - Intergenic
976281185 4:83328544-83328566 TCTTATTTGGTCTTTGTTATGGG - Intronic
976465460 4:85363207-85363229 TCTTGTATGGGTATGGTTTCTGG + Intergenic
976513102 4:85933039-85933061 TCTTAAGTTGGCATGGTTTTAGG - Intronic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977466600 4:97389907-97389929 TATGATTTGGGGATGGTCTTTGG + Intronic
977659644 4:99568256-99568278 TCTTTTTTTGGTATGTTTTTGGG - Intronic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978102852 4:104863840-104863862 CCTTATTTGGCCATGGTTCATGG + Intergenic
978173548 4:105703102-105703124 TCTGTTTTGGCCATGGGTTTAGG - Intronic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979151314 4:117319005-117319027 TTTTATTTGGGCAATGTTTATGG + Intergenic
979167865 4:117559058-117559080 CCATCTTTGGGCATTGTTTTGGG - Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
980433685 4:132740133-132740155 TCTTATATGGGCATGATGTTTGG - Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
981003240 4:139848883-139848905 TATTCTTTGGCCATGATTTTGGG + Intronic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
981827548 4:148961064-148961086 TCTTATTTGGGTATCATTTCAGG - Intergenic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982153133 4:152485664-152485686 TCTTAGTGGGGAATGGTATTTGG - Intronic
982169975 4:152652049-152652071 TCTTCTGTGAGCATGGTTTCAGG + Intronic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
984201058 4:176721729-176721751 GCTTATTTGGGCAAGGTGGTAGG + Intronic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984685546 4:182664336-182664358 TCTTATGTGGGTGTGGTTTCTGG - Intronic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989993173 5:50793412-50793434 TCTTATTTGGGAAAGGTCTTTGG - Intronic
990419801 5:55620271-55620293 TTTTATTTTGTAATGGTTTTGGG + Intergenic
990788756 5:59453170-59453192 TCTTATATAGGCATGGCTTATGG - Intronic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
991315873 5:65305702-65305724 TCTCATTTGTGGAGGGTTTTAGG + Intronic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
991642771 5:68771172-68771194 TGTTATTTTGGCATGGATTATGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992781487 5:80132139-80132161 TATTATTTGCTCATGGTTTGGGG - Intronic
992859627 5:80897415-80897437 GCTTAATTGGGTATTGTTTTTGG + Intergenic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
993080065 5:83285616-83285638 TCTAATTTGTTCATAGTTTTGGG + Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
993270230 5:85787026-85787048 ACTTATTTGGGCATTGTTTGAGG - Intergenic
993715388 5:91270992-91271014 AATTATTCGGGCATGGTGTTAGG - Intergenic
994079569 5:95692390-95692412 TCTTATTTGGGGACCGGTTTTGG + Intronic
994200675 5:96972253-96972275 TTTTATTAGGGCTTGGTTTTAGG + Intronic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994474180 5:100246324-100246346 TTACTTTTGGGCATGGTTTTGGG - Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996374372 5:122788939-122788961 TCTTATTTGGTCACATTTTTTGG + Intronic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
997649544 5:135505462-135505484 TATTATCTGGGCATGGTGGTGGG + Intergenic
997706574 5:135959624-135959646 TCTTATTTATGTATGGATTTGGG - Intergenic
998994089 5:147851713-147851735 TCTTCATTGGGCATGATTTCTGG - Intergenic
999274891 5:150323651-150323673 TCTCATCTGTGCATGGTGTTTGG - Intronic
999728372 5:154455851-154455873 TGTGATTTGTGCATGGTTTAAGG + Intronic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001366044 5:171141189-171141211 TCTTATCTTGGCCTGGATTTAGG - Intronic
1001950506 5:175813471-175813493 TGTTTTTTGAGCATGGTTCTAGG - Intronic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003646689 6:7918399-7918421 TCTAATTTGGGCATTGTTCCTGG - Intronic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004526368 6:16412199-16412221 TCTTTGTTGTGCATGTTTTTAGG + Intronic
1004613079 6:17264578-17264600 GCTTGTCTGGACATGGTTTTAGG - Intergenic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1006650009 6:35543800-35543822 TCTTCTCTCGGCTTGGTTTTGGG + Intergenic
1007884227 6:45207735-45207757 TTTTATATGGGCCTGGTTCTTGG - Intronic
1008197693 6:48544779-48544801 TGTCATATGGGTATGGTTTTTGG + Intergenic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1010544493 6:77133684-77133706 TCTTCCTGAGGCATGGTTTTAGG - Intergenic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1011868797 6:91866288-91866310 TATTATATGGGCATGGTGGTGGG + Intergenic
1012428459 6:99140726-99140748 ACTTGTTTGGTCATGGTGTTGGG + Intergenic
1012967372 6:105688980-105689002 ATTTATTTTGGGATGGTTTTGGG - Intergenic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013425142 6:110004959-110004981 TCTAATTTGGGCACTTTTTTTGG - Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013796102 6:113890882-113890904 TCTTCTATGGGTGTGGTTTTTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015337014 6:132050954-132050976 TGTTTTGTGGGCATGGTTTGTGG - Intergenic
1015683030 6:135829075-135829097 TTTTATTTTGGGATAGTTTTAGG + Intergenic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016847995 6:148587968-148587990 TCTTATCTGAGCATGGTTGGTGG - Intergenic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018798605 6:167206154-167206176 TCTTATTTGGAACTGGTCTTTGG - Intergenic
1018814104 6:167318011-167318033 TCTTATTTGGAACTGGTCTTTGG + Intergenic
1019084501 6:169462638-169462660 TCTTATTTGGCCTTGGTATTGGG - Intronic
1019172722 6:170143099-170143121 TTTTATTTGGGAATAATTTTAGG - Intergenic
1019821954 7:3250789-3250811 TGTCATATGGGCGTGGTTTTTGG - Intergenic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1022186804 7:27977387-27977409 TCTTATGTGGGTTTGGTTTTAGG + Intronic
1022392218 7:29953082-29953104 TCATATTTGGGAATGCTTTGAGG - Intronic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1024079446 7:45844134-45844156 AATTATCTGGGCATGGTTGTGGG + Intergenic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1024424492 7:49210459-49210481 TCTTATTTATGCAGGGTCTTTGG - Intergenic
1024560418 7:50640225-50640247 TCCTTGTTGGGTATGGTTTTTGG + Intronic
1024786150 7:52910618-52910640 TCTTATATGGGCTTAGTTTTTGG + Intergenic
1025297162 7:57784424-57784446 AATTATTTGGGCGTGGTGTTGGG + Intergenic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1027206597 7:76105306-76105328 AATTATCTGGGCATGGTTGTGGG + Intergenic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027596045 7:80175744-80175766 TCTTATGTGGGCAGAGTTTATGG - Intronic
1028462585 7:91112520-91112542 TCTTTTTTGCTCATGTTTTTAGG + Exonic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030505170 7:110412293-110412315 TCTTATATGGTCATAGTTTATGG + Intergenic
1030693340 7:112557441-112557463 TCTGATTTGGGTATGGTATGTGG - Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031879776 7:127184169-127184191 TCTTATTTGCTCCTGGTGTTAGG - Intronic
1033669840 7:143481031-143481053 TCTTTTTTGGGTTTGGCTTTTGG + Intergenic
1033800773 7:144899303-144899325 TCACACTTGGGCATGGTATTGGG + Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1036091777 8:5673368-5673390 TCTAATTTGGGGACGGTTTTTGG - Intergenic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1037435633 8:18860234-18860256 CGTTATATGGGCATGGTTTATGG + Intronic
1038827915 8:31026132-31026154 TCTTATAAGGGCAAGGTCTTTGG + Intronic
1039165488 8:34674953-34674975 TCTTCATTGTTCATGGTTTTGGG + Intergenic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040052425 8:43030029-43030051 TCTGATGTGGACATTGTTTTTGG - Exonic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1041399308 8:57425176-57425198 TCCTATTTGGGCATGAGTTTTGG - Intergenic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042695459 8:71549387-71549409 TTCTATTTGGGCAAGGTATTGGG - Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044167079 8:88999005-88999027 TTTTATTTGGATATAGTTTTTGG - Intergenic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1046574485 8:116009246-116009268 TCATATTTTAGAATGGTTTTAGG - Intergenic
1046652977 8:116859581-116859603 TATTATTTGGGCATCCTTTGTGG - Intronic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1047576963 8:126166714-126166736 TCTCATATGGGCATGGCTTATGG + Intergenic
1048167219 8:132073768-132073790 TCAAACTTGGGCATGATTTTTGG + Intronic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052144768 9:25035739-25035761 CCTTGTTTGGGCAGGATTTTTGG - Intergenic
1053208709 9:36209589-36209611 TCTTATCTGGGAACGGTTTGAGG + Intronic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1053779039 9:41583328-41583350 AATTATCTGGGCATGGTTGTGGG - Intergenic
1054166998 9:61793569-61793591 AATTATCTGGGCATGGTTGTGGG - Intergenic
1054216935 9:62368011-62368033 AATTATCTGGGCATGGTTGTGGG - Intergenic
1054994493 9:71370039-71370061 TGTTATGTGGGTATGGTTTGTGG - Intronic
1055569715 9:77604231-77604253 TCTTATTTGGCTGTGGTTTTGGG - Intronic
1055679386 9:78699321-78699343 TCTTTTGTGGTCATAGTTTTGGG - Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1056964243 9:91152808-91152830 TGTTATTTGGGCAAGGTTGTGGG - Intergenic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1059482593 9:114603126-114603148 TCTAATCTGGGGGTGGTTTTTGG - Intergenic
1059909197 9:119023588-119023610 TATTAGCTGGGCATGGTTGTGGG - Intergenic
1060435511 9:123589474-123589496 TTTTAATTGGGTAGGGTTTTTGG - Intronic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1061562208 9:131412364-131412386 TCTTATTGTAGGATGGTTTTTGG + Intronic
1186307399 X:8277253-8277275 TTTTATTTGTGCATGTTTATGGG - Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187030452 X:15482183-15482205 TCTTATTTGCTAATGGTTGTTGG - Intronic
1187474470 X:19598766-19598788 TCTTATATGGGCACAGTTTATGG + Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187687653 X:21831609-21831631 TCTTTTTAGGTCATAGTTTTAGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187935306 X:24330239-24330261 TAATTTTTGGGTATGGTTTTAGG - Intergenic
1187955624 X:24515287-24515309 TCTTATTCGCACGTGGTTTTAGG + Intronic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1188844446 X:35056313-35056335 TCTTATATGGGTACTGTTTTTGG + Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189869037 X:45362898-45362920 TCTTATTTTGGCAAGGTTTATGG - Intergenic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1190938018 X:55013925-55013947 TCTTAGTTTGGGATGGTTCTGGG + Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1193055918 X:77150301-77150323 TCTTATATGGGTGTGGTTCTTGG + Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193850018 X:86525782-86525804 TCTCATTTGGGGATGGTTTGAGG - Intronic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194326333 X:92522387-92522409 TCTTATCTAGGCCTGGTTTGTGG + Intronic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196858382 X:120004821-120004843 AATTAGTTGGGCATGGTATTGGG + Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1197771298 X:130091277-130091299 AATTAGTTGGGCATGGTTGTGGG + Intronic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198621366 X:138514343-138514365 TCTTATATGAACATGGTTTTTGG + Intergenic
1198882028 X:141292166-141292188 TCTTATTTGGGTTTCGTTATGGG + Intergenic
1198999700 X:142620220-142620242 TCTTATATGGGTGTGGTTTATGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1200391759 X:155952656-155952678 TCTGACTTGGGCTTGGTTTTAGG + Intergenic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic
1201671792 Y:16530215-16530237 TCTAACTTGGACATCGTTTTTGG - Intergenic