ID: 1018252221

View in Genome Browser
Species Human (GRCh38)
Location 6:161882426-161882448
Sequence AGGGAAGCTGCCGCCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 1, 2: 3, 3: 26, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018252221_1018252226 -6 Left 1018252221 6:161882426-161882448 CCAGCCCAGGCGGCAGCTTCCCT 0: 1
1: 1
2: 3
3: 26
4: 323
Right 1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG 0: 1
1: 0
2: 1
3: 21
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018252221 Original CRISPR AGGGAAGCTGCCGCCTGGGC TGG (reversed) Intronic
900079056 1:842093-842115 AGGGAAGCTCCTCCCTGGGAGGG - Intergenic
900096633 1:942550-942572 CGGGCAGCTCCAGCCTGGGCCGG - Exonic
900130765 1:1086233-1086255 AGAGAAGCTGAGGCCGGGGCAGG - Intronic
900321920 1:2088728-2088750 AGAGACGCCGCCGCCTGGGAGGG - Intronic
900786549 1:4653911-4653933 AGCGCAGCTGCTGCCTGGCCAGG - Intergenic
900824422 1:4914527-4914549 AAGCAGGCTGCTGCCTGGGCTGG + Intergenic
900913734 1:5620104-5620126 AGGGAGGGTGCAGCCTGGGCGGG + Intergenic
901531975 1:9859374-9859396 AGGGAAGCTGGCCCCTAGCCGGG + Intronic
901556106 1:10032776-10032798 AGGGAGGCTGGCGGCTGGGCGGG - Intergenic
901819082 1:11814542-11814564 AGAGAAGCAGCAGTCTGGGCTGG - Intronic
901865769 1:12105793-12105815 AGGGCACCTGCTGCCAGGGCTGG - Intronic
902507782 1:16948964-16948986 TGGGAGGCTGCAGTCTGGGCTGG - Intronic
902884189 1:19393224-19393246 CGCGAAGCTGCCGCCTGTGCAGG - Intronic
904271408 1:29352820-29352842 AGGGAAGCATACTCCTGGGCAGG + Intergenic
904610147 1:31721355-31721377 AGGGAAGCTGAGGCCTGGAGAGG + Intergenic
905242323 1:36588993-36589015 AGGGTAGGGGCCTCCTGGGCAGG + Intergenic
906151982 1:43592786-43592808 AGGGCAGCAGCCGCCTGGACTGG - Intronic
906802199 1:48748192-48748214 AGGGAAGATGCCTCCGGAGCTGG + Intronic
907998541 1:59657343-59657365 AGGGAGGCAGCCTCCTGGACAGG + Intronic
909548192 1:76869345-76869367 CGGGAAGCTGCTGCATGGGGTGG + Intronic
911794500 1:102058881-102058903 GAGGGAGCTGCCACCTGGGCTGG + Intergenic
912682684 1:111739158-111739180 AGCGAAGCTGGCGCCGGGGCAGG - Intronic
913962418 1:143350650-143350672 TGGGAAGCAGCTGCCTGGTCAGG + Intergenic
914056773 1:144176227-144176249 TGGGAAGCAGCTGCCTGGTCAGG + Intergenic
914122373 1:144790135-144790157 TGGGAAGCAGCTGCCTGGTCAGG - Intergenic
915142397 1:153775682-153775704 AGGGGGGCTGCAGCCTGGCCTGG + Exonic
915544145 1:156586387-156586409 AGGGAAGCTGAGGCCAAGGCAGG + Intronic
915549684 1:156624918-156624940 AGGTGAGCTGGAGCCTGGGCGGG - Intronic
916570310 1:166019706-166019728 AGGTAATCTGCCACCTGGGTTGG + Intergenic
920375237 1:205504688-205504710 AGAGAAGCTGCAACCTGAGCTGG - Exonic
920394278 1:205632206-205632228 ACCCAAGCTGCCGCCTGGGCCGG + Intergenic
920516394 1:206587598-206587620 AGAGAAGCTGCAGCCTGCCCTGG + Exonic
922394582 1:225183216-225183238 AGGGAATCAGCTGCCTTGGCAGG + Intronic
923085607 1:230701547-230701569 AGGGCAGCTGCCGCCACTGCCGG + Intergenic
924708641 1:246517493-246517515 AGGGAATCTGATGCCAGGGCTGG - Intergenic
1063458998 10:6203588-6203610 AGGGACGCGCGCGCCTGGGCAGG + Intronic
1064254084 10:13729332-13729354 AGGGAGGCAGCCACCTAGGCCGG + Intronic
1067523635 10:47025965-47025987 AGGGAATCTGCCGTCAGCGCTGG - Intergenic
1067690624 10:48499150-48499172 AGGGAGGCAGCCCCCCGGGCTGG - Intronic
1069559059 10:69416886-69416908 AGGGAAGCTGCAGCGAGGGCTGG - Intergenic
1069727696 10:70591667-70591689 GGGGAAGCTGCTGCATGGACTGG + Intergenic
1071504530 10:86224582-86224604 AGGACAGCTGCCATCTGGGCTGG - Intronic
1073099220 10:100998263-100998285 AGCCCAGCTGCCGCCTGAGCTGG + Intronic
1074456611 10:113601114-113601136 AGGCAAGCTGCATCATGGGCAGG - Intronic
1076096898 10:127739436-127739458 AGGGAAGCTGCCGCAGGGGCTGG + Exonic
1076347421 10:129788887-129788909 AGGGACGCTGCTGCCTGGGAAGG + Intergenic
1076351342 10:129816807-129816829 AGGCAAGCTGGGGCCTGTGCAGG - Intergenic
1076696075 10:132248018-132248040 GGGGCAGCTGCCGCCTGGAACGG - Intronic
1076696403 10:132249389-132249411 AGGGAAGGTGCAGGCAGGGCAGG + Intronic
1076979453 11:196929-196951 AGGGAGGGGGCCGCCTGGGAGGG - Exonic
1076999501 11:315687-315709 AGGGAAGATGCCGGCTGGACTGG - Intergenic
1077031899 11:472137-472159 AGGGAAGCTGCTCCCGGTGCAGG - Intronic
1077267178 11:1656858-1656880 AGGGAAATTGCAGCCTGGCCGGG + Intergenic
1077606915 11:3618484-3618506 AGAGAAGCTGAGGCCTGGGAAGG + Intergenic
1077918693 11:6627108-6627130 ACTGAAGCTGGGGCCTGGGCGGG + Exonic
1080387618 11:31819101-31819123 AGGGAGGGGGACGCCTGGGCCGG + Intronic
1080596512 11:33778327-33778349 AGGGAAGCTGGGGGCTGGGATGG + Intergenic
1081616831 11:44596230-44596252 TGGGAAGCAGCTGCCTGTGCAGG + Intronic
1083547556 11:63560271-63560293 AGGGAATCTGCAGGCTGAGCTGG - Intronic
1083738438 11:64694857-64694879 AGGGCACCTGGCTCCTGGGCTGG - Intronic
1083886956 11:65577602-65577624 TGGGAAGCTGCAACCTGGGCAGG - Intronic
1084529948 11:69721301-69721323 AGAGGAGCTGCCCCCTGGGATGG + Intergenic
1088821083 11:113457954-113457976 AGGCCAGCAGCAGCCTGGGCTGG + Intronic
1089130756 11:116210040-116210062 AGGCAATCTGCAGCCTGGGCTGG - Intergenic
1089655259 11:119942447-119942469 AGGGAGGCAGCCACCTGGACTGG - Intergenic
1089681409 11:120120996-120121018 CGGGAAGCAGCAGCCTGGGTGGG - Intronic
1090794636 11:130124122-130124144 AAGGCAGCTGTCCCCTGGGCTGG + Intronic
1091300294 11:134503157-134503179 AGGGAAGCTGCTGCCTCACCAGG + Intergenic
1091300481 11:134504077-134504099 AGGGATGCTGGCGCCTTAGCAGG + Intergenic
1091347173 11:134863336-134863358 AGGGAGAATGCTGCCTGGGCTGG - Intergenic
1092161017 12:6315667-6315689 AGGGAAGATGGGGCCGGGGCTGG - Intronic
1092275323 12:7056485-7056507 TCCGAAGCTGCGGCCTGGGCTGG - Intronic
1094374412 12:29774971-29774993 AGGAAAGCTGCCCCATGGGAAGG + Intronic
1095989267 12:48023115-48023137 AAGGATGCAGCCACCTGGGCTGG - Intronic
1098951923 12:76648550-76648572 CAGGAAGCTGCAGCCTGGGAAGG + Intergenic
1101326083 12:103717084-103717106 AGAAAAGCTGCCTCCTGGGAGGG + Intronic
1102602484 12:114042541-114042563 AGCAAAGCTGCCACATGGGCAGG + Intergenic
1104843549 12:131835646-131835668 AGGCCAGCTGCTGCCTGGGTTGG - Intronic
1105243642 13:18628800-18628822 AGGGTGACTGCCGCCTGGCCGGG - Intergenic
1105308525 13:19186110-19186132 AGGGCAGCTCCCGCATGGGGAGG - Intronic
1106503859 13:30354893-30354915 AAGGAAGCTGGCGGTTGGGCAGG + Intergenic
1108572937 13:51768494-51768516 TGGGAGGCTGCAGCCAGGGCTGG + Intronic
1113707922 13:112446116-112446138 CGGGAAGCTGCTGCCTGGAGGGG - Intergenic
1113794914 13:113051255-113051277 AGGGAAGCTGCCGATGGGGTGGG + Intronic
1113857143 13:113453434-113453456 AGAGGAGCTGCCTCCTGGGATGG - Exonic
1114640396 14:24215814-24215836 AGGGAAGGTTCAGCCTGGGGCGG + Intronic
1117314959 14:54565489-54565511 ACGGAACCTAGCGCCTGGGCAGG + Intergenic
1118013041 14:61629288-61629310 AGGGAAGGTGACACCTGGCCAGG - Intronic
1119725714 14:76920746-76920768 AGGGGAACTGCCATCTGGGCAGG + Intergenic
1121096437 14:91220898-91220920 CAGGAAGCTGATGCCTGGGCAGG + Intronic
1121309332 14:92926722-92926744 AGGGCTGCTGCCTGCTGGGCTGG + Intronic
1121496048 14:94391790-94391812 AAGGAAGCTGGTGCCTGGGAAGG - Intergenic
1122145343 14:99685314-99685336 AGGGAAGCTGCGGGGGGGGCGGG - Intronic
1122263402 14:100535632-100535654 AGGGAGGCTGCTTCCTGGGACGG + Intergenic
1122768080 14:104085335-104085357 GGGGGAGCTCCTGCCTGGGCAGG - Intergenic
1124369121 15:29093372-29093394 AGGGAGGCTTGCGCCTTGGCTGG + Intronic
1127191845 15:56539578-56539600 AGGGAGGCTGCTGGCTGAGCTGG - Intergenic
1128155555 15:65389524-65389546 AGGGAAGCTGCTCCCTGGCCTGG + Intronic
1129030917 15:72616980-72617002 GGGGACGCTGCAGCCTGAGCAGG + Intergenic
1129454457 15:75669345-75669367 GGGGAAGGTGGCGCCTGTGCTGG - Intergenic
1129845295 15:78765328-78765350 AGGGAAGCTGCTGCCTGCTGGGG + Intronic
1130511527 15:84593842-84593864 AGGGACACTGCAGCCTGAGCAGG - Intergenic
1130990489 15:88873024-88873046 AGGTAAGCTGGCGCCTGGGAGGG + Exonic
1132055924 15:98649974-98649996 AGGGAAGTTGGTGCCGGGGCGGG + Intronic
1132302944 15:100787753-100787775 GGGGAAGCTGCAGCCTGGGCAGG - Intergenic
1132335775 15:101047506-101047528 AGGGAAGCTGCTGCCCGGAAGGG - Intronic
1132550947 16:553638-553660 TGGGAAGCTGAGCCCTGGGCTGG - Exonic
1132556876 16:576415-576437 AGGGGCGCTGGGGCCTGGGCAGG + Intronic
1132701041 16:1222241-1222263 AAGGATGCTGCCCCCGGGGCCGG + Exonic
1132851081 16:2025362-2025384 ATGGAAGCGGCCGGCCGGGCGGG + Intronic
1133267119 16:4591928-4591950 AGGGAAGCTCTGGCCTGAGCTGG + Intronic
1135322754 16:21507946-21507968 AGGGAAGCACGCGCCTGTGCTGG - Intergenic
1136116463 16:28097757-28097779 AGGGAGGCTGCAGTCTGGGAGGG - Intergenic
1136334238 16:29601109-29601131 AGGGAAGCACGCGCCTGTGCTGG - Intergenic
1136474624 16:30505105-30505127 AAGGCAGCTGGCTCCTGGGCAGG + Intronic
1137587084 16:49670090-49670112 AGGGAGGCTCACGCCAGGGCTGG + Intronic
1139160665 16:64504257-64504279 AGGGAAGCTGCCCCCAGTCCTGG + Intergenic
1139550892 16:67672484-67672506 ATGGAAGCTGCCACCTCTGCAGG + Intergenic
1140256949 16:73345858-73345880 AGGGAAGCAGGGCCCTGGGCTGG - Intergenic
1140272051 16:73474675-73474697 AAGGAAGCTGCCAGCTGGGATGG - Intergenic
1141125029 16:81395158-81395180 GGGGAAGATGCAGGCTGGGCTGG - Intergenic
1141691364 16:85598625-85598647 AGGGAAGACGCCTTCTGGGCAGG + Intergenic
1141909063 16:87046163-87046185 ACGGGAGCTGCCGCATGGGACGG + Intergenic
1142009009 16:87704356-87704378 AGGGAAGGAGGCGCCTGGGGAGG + Intronic
1142009020 16:87704393-87704415 AGGGAAGGAGGCGCCTGGGGAGG + Intronic
1142009043 16:87704467-87704489 AGGGAAGGAGGCGCCTGGGGAGG + Intronic
1142023066 16:87796017-87796039 AGGGTAGCTGCTGCCAGGGGAGG + Intergenic
1142034952 16:87856966-87856988 AGGGAAGCACGCGCCTGTGCTGG - Intronic
1142212142 16:88813319-88813341 GGGGAAGCTGCCACATGAGCCGG + Intergenic
1142276952 16:89123795-89123817 AGGCCAGCTGCCACCTGGGGAGG - Intronic
1203089957 16_KI270728v1_random:1207369-1207391 AGTGATGCTGCGGGCTGGGCTGG + Intergenic
1142968736 17:3597043-3597065 AGGGCAGCTGCTGCCAGGGCCGG - Exonic
1143013888 17:3881534-3881556 AGAGTAGCTGACCCCTGGGCTGG + Intronic
1143028186 17:3953185-3953207 AGGGAAGCTGAAGTCTGAGCAGG + Intronic
1143138034 17:4723030-4723052 GGGGAGGCTGCCGCCGTGGCGGG - Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143374882 17:6461619-6461641 AGGGCAGCTGCGGGCAGGGCAGG - Intronic
1143524843 17:7466096-7466118 AGGGGAGGGGCCGCCGGGGCAGG + Exonic
1146894917 17:36534407-36534429 AGGGCAGCTGCGCCCTTGGCTGG - Intronic
1147316256 17:39621861-39621883 ATGGAAGCAGCCGACTGGACCGG + Intergenic
1147653868 17:42077666-42077688 AGGGAAGCTGCTGGCTGGGCCGG - Intergenic
1150143672 17:62750663-62750685 AGGCCAGGTGCCTCCTGGGCAGG - Intronic
1150211794 17:63446002-63446024 AGGGCAGGGGCCGCCTGGACCGG + Exonic
1151155505 17:72121251-72121273 GGGGAAGCTGGCGCGTCGGCCGG - Exonic
1151183943 17:72349909-72349931 TAGGGAGCTGCCTCCTGGGCTGG + Intergenic
1151548711 17:74808939-74808961 GGGGAAGGTGCCACCTGGGAGGG - Intronic
1151890653 17:76948940-76948962 AAGGAAGCTCCGGCCTGGGGGGG - Exonic
1151943952 17:77309196-77309218 AGGGAAGCAACCGCCGGGGGAGG - Intronic
1151957049 17:77385675-77385697 AGGGGACCTGAGGCCTGGGCTGG + Intronic
1152722523 17:81929910-81929932 ACAGAAGCTGCAGCCTGGGGCGG - Intergenic
1152722559 17:81930028-81930050 ACAGAAGCTGCAGCCTGGGGCGG - Intergenic
1154189665 18:12219174-12219196 AGCGGAGCTGCCATCTGGGCTGG + Intergenic
1157223141 18:45841235-45841257 ATGGAGGCTGGGGCCTGGGCAGG + Intronic
1157491654 18:48127839-48127861 AGAGAAGCTGTCCCCTCGGCAGG + Intronic
1158931656 18:62329275-62329297 AGGGCATCTGCCCCCTGGCCAGG + Intronic
1160673083 19:375574-375596 AGGGCAGCAGCCCCCTGGGCGGG - Intronic
1162376758 19:10309628-10309650 AGGAAAGGTGCCGCCGAGGCTGG - Exonic
1162725738 19:12689004-12689026 TGGGAAGCGGCCCCCTGGGTGGG + Exonic
1162780519 19:13004546-13004568 AGGGGAGGTGCCACCAGGGCAGG - Intronic
1163006019 19:14397152-14397174 AGTGCCGCTGCCGCCCGGGCTGG + Exonic
1163061727 19:14766284-14766306 AGTGCCGCTGCCGCCCGGGCTGG - Exonic
1163415054 19:17181248-17181270 TGGGAAGCTGCCCCGTGTGCTGG - Intronic
1164240513 19:23384308-23384330 TGGGGAGCTGCAGCCTGGCCAGG + Intronic
1164669480 19:30064445-30064467 TGGGCAGGTGCCGCGTGGGCAGG - Intergenic
1164684288 19:30156853-30156875 AGGACACCTGCAGCCTGGGCAGG + Intergenic
1165073150 19:33267263-33267285 AGGGAAGCAGGCCCCTGGCCAGG - Intergenic
1165159130 19:33805623-33805645 AGAGAAGCTGCCACCTTGGCAGG + Intronic
1165561964 19:36687703-36687725 AGGGAGGCGGGAGCCTGGGCTGG + Intronic
1166750832 19:45163349-45163371 AGGGATGCGGCCCCGTGGGCGGG - Intronic
1167537768 19:50065865-50065887 AGAGAAGCTGAGGCCTGGCCAGG + Intergenic
1167662012 19:50800826-50800848 AGGGAAGCTGGCTTTTGGGCAGG - Intronic
1168095016 19:54109540-54109562 GGGGCAGCAGCCACCTGGGCAGG + Intronic
1202696257 1_KI270712v1_random:128912-128934 TGGGAAGCAGCTGCCTGGTCAGG + Intergenic
925091663 2:1161472-1161494 AAGGAGGCTGCCCCCTAGGCAGG + Intronic
926626636 2:15095987-15096009 AAGGGAGCTTGCGCCTGGGCTGG - Intergenic
927460857 2:23297001-23297023 AAGGAAGCTGAGGCCTGGGTAGG + Intergenic
928084809 2:28339366-28339388 AGGGAAGATGTCGCCTGCTCAGG - Intergenic
929033793 2:37672145-37672167 TGGGGAGCTGCGGCCTGGCCGGG - Exonic
931107135 2:59068572-59068594 AGGGAGGCTGCAGTCAGGGCGGG + Intergenic
931970618 2:67581842-67581864 AGGGAAGCATCAGACTGGGCAGG - Intergenic
932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG + Intronic
932743741 2:74313879-74313901 AGGGCAGCTGCCTCTTGGGTTGG - Intronic
933876067 2:86623223-86623245 AGGGACGCTTCCCCCGGGGCGGG + Exonic
934277420 2:91585937-91585959 TGGGAAGCAGCTGCCTGGTCAGG + Intergenic
934766772 2:96884190-96884212 ATGGAAGCTGCGGCATGGGGAGG + Intronic
934993446 2:98936771-98936793 AGGGAAGCTGCCGCCCCGTCTGG + Intergenic
936327591 2:111519112-111519134 AGGGAAGCTGCCCTCTAGGCAGG + Intergenic
937956557 2:127424939-127424961 AGGGGAGCTGGTGCCTGTGCAGG + Intronic
938026526 2:127953804-127953826 AGGAAAGCTGTAGCCAGGGCTGG - Intronic
938263655 2:129911745-129911767 AGGGAGGCTGGGGCCTGGGAAGG - Intergenic
939365879 2:141230691-141230713 AGGGAAGCTGCCACCTCAGAGGG + Intronic
942528799 2:176886070-176886092 AGGGAAGCAGAGGCCTTGGCAGG - Intergenic
944933678 2:204545676-204545698 CGCGGAGCAGCCGCCTGGGCCGG + Intergenic
946181246 2:217950497-217950519 AGCCAAGCTGGCTCCTGGGCTGG + Intronic
946413980 2:219530166-219530188 AGGGAAGGTGCTGCCTGTGATGG + Intronic
946729153 2:222691705-222691727 AGAGAGGCAGCCGCTTGGGCAGG - Intronic
947636154 2:231681530-231681552 AGGGAAGGTGGGGCCCGGGCTGG - Intergenic
947761381 2:232606077-232606099 AGGCAAGCAGCCGCCAAGGCCGG - Intronic
948934849 2:241157057-241157079 AGGGAAGCTGTCGCCTCAGCAGG + Intronic
1168965259 20:1894790-1894812 AGAGAAGGTGCCGGCGGGGCCGG + Intronic
1169263208 20:4152492-4152514 AGGGGAGCTGACCCCTGGACAGG + Intronic
1170569525 20:17625055-17625077 TGGGAAGCTGCAGCCTCTGCAGG + Intronic
1171481520 20:25458952-25458974 AGGGAAGGTGGGGCCAGGGCTGG + Intronic
1173374398 20:42470538-42470560 AGGCAAGAGGCAGCCTGGGCTGG + Intronic
1173896905 20:46558178-46558200 AGGGAAGGTGACACCTGAGCAGG + Exonic
1175824122 20:61927454-61927476 ATGGAAGCTCCCTCCTGGCCCGG - Intronic
1175835204 20:61989306-61989328 GGGGAAGCTGCAGAGTGGGCAGG + Intronic
1176000309 20:62828681-62828703 AAGGAGGCTGCCCCCAGGGCAGG + Intronic
1176164807 20:63667333-63667355 TGGGAAGCTGCTGCCTGGGATGG - Intronic
1176275395 20:64263363-64263385 AGGGAAGCCTTGGCCTGGGCTGG + Intronic
1176828858 21:13723796-13723818 AGGGTGACTGCCGCCTGGCCGGG - Intergenic
1177761497 21:25407106-25407128 AGGGAAGCTGCTGCCTTGAAAGG - Intergenic
1178885158 21:36479319-36479341 AAGGAAGCTGCAGGCTGGTCTGG - Intronic
1179867350 21:44225420-44225442 TGGACAGCTGCAGCCTGGGCAGG + Intronic
1179878815 21:44285062-44285084 AGGGATGCTGTGGCCTGGACAGG - Intergenic
1180876913 22:19178855-19178877 CGGGAAACTGAGGCCTGGGCGGG + Intergenic
1181005810 22:20012918-20012940 ATGGAGGATGCAGCCTGGGCTGG + Intronic
1181107396 22:20583246-20583268 AGGTAGGCTGCAGCCAGGGCAGG + Exonic
1181583795 22:23842136-23842158 AGGGCCTCTGACGCCTGGGCGGG + Intergenic
1182073119 22:27477172-27477194 AGAGGAGATGCTGCCTGGGCTGG + Intergenic
1182100153 22:27651846-27651868 AGGGACGTTGCCCCCTAGGCAGG - Intergenic
1182518576 22:30872606-30872628 ACGGAAGCTGTGCCCTGGGCTGG + Intronic
1183961218 22:41413007-41413029 TGGGAAGCAGGCGGCTGGGCCGG + Intergenic
1184120326 22:42445790-42445812 GGGGTAGCTCCAGCCTGGGCCGG + Intergenic
1184740503 22:46426158-46426180 AGTGAAGCTGCAGCCTGGTGAGG + Intronic
1185292174 22:50032640-50032662 AGGGGACCTGACGGCTGGGCAGG - Intronic
1185369570 22:50454793-50454815 AGGTAAGCTGGGGCCTGGGTCGG - Exonic
950291660 3:11789557-11789579 AGGGAAGTTACCTCTTGGGCTGG + Intergenic
950556869 3:13701286-13701308 AGGGAAGGGGCCTTCTGGGCTGG - Intergenic
951844192 3:27067979-27068001 AGTGAGGCTGCCGCCTAGGTAGG - Intergenic
952566639 3:34667086-34667108 AGGGAAGCTGCTGCCTTGAAAGG - Intergenic
953748804 3:45594429-45594451 AAGGCAGCAGCCGACTGGGCCGG - Intronic
954197027 3:49002994-49003016 AGGGAAGCTGTCTGCTGGGGTGG - Intronic
954369817 3:50164238-50164260 AGGGAAGCTGGAGCCAGGGAAGG - Intronic
954706403 3:52483081-52483103 AGGAGAGCAGCGGCCTGGGCAGG + Intronic
955165946 3:56511475-56511497 AGGGACTCTGCCACCTAGGCTGG - Intergenic
957917853 3:86709087-86709109 TGGGAAGCTGCAGCCTGGCGGGG - Intergenic
961033236 3:123624557-123624579 AGGGAAGCTGATGTCAGGGCGGG - Intronic
961519270 3:127457229-127457251 AGGGCAGCGGCCGGCAGGGCTGG - Intergenic
963804300 3:149707824-149707846 GGGGAAGCTGGAGCCTGAGCAGG - Intronic
964987806 3:162766136-162766158 AGGGAAGCTGCCCCATGTGAAGG - Intergenic
965648303 3:170908199-170908221 CGGGGACCTGCGGCCTGGGCTGG - Intronic
965805049 3:172533695-172533717 GGGGAAGCTGCAGTCTGGGAAGG + Intergenic
966714291 3:183000344-183000366 AGGGAAGCTGCAGTTTGGGTAGG + Intergenic
966876200 3:184323220-184323242 TGGGGAGCTGCCCCGTGGGCCGG + Exonic
967068098 3:185938292-185938314 AGGGAACCTGCCGAGTGTGCAGG + Intergenic
968066718 3:195763028-195763050 CTGGAAGCTGCGCCCTGGGCCGG + Intronic
968507976 4:980744-980766 AGGGAAGCTGCCCCCTAGAATGG - Intronic
969307817 4:6335758-6335780 AGGGAAGCTGCTTACAGGGCAGG + Intronic
974699188 4:65417099-65417121 AGGGAAGCTGCCCCTTGGCAGGG - Intronic
977716576 4:100190277-100190299 AGCGAAGCTGCGGCCTTGGTGGG - Intronic
981708313 4:147684134-147684156 GGCGGAGCTTCCGCCTGGGCTGG - Exonic
984238617 4:177192169-177192191 AGGGAAGCTTCGGCCTGAGACGG - Intergenic
985602091 5:840777-840799 AGGGAGGCGTCCACCTGGGCAGG - Intronic
985644067 5:1076863-1076885 AGAGAAGCTGCAGGCTGGTCAGG + Intronic
985927516 5:3029497-3029519 GGGGAAGCTGAGGCTTGGGCTGG + Intergenic
986297106 5:6448780-6448802 AGGGCAGCGGGCGCCAGGGCGGG + Exonic
986722027 5:10566278-10566300 AGGGCATCTGTCGCCAGGGCTGG - Intronic
987010244 5:13755724-13755746 AGGGAAGGTGCCAGCTGGGAAGG + Intronic
988682865 5:33501214-33501236 TGGGATGCTGCCACGTGGGCAGG + Intergenic
991900535 5:71455743-71455765 ACGGTAGCTGCCCCCTGAGCTGG + Exonic
992309635 5:75482430-75482452 TGGCAAGCTACCCCCTGGGCCGG - Intronic
995630207 5:114124630-114124652 AGGGAAAATGCCGCCTGGACTGG - Intergenic
995831691 5:116361567-116361589 AGGCAAGGAGCCGCCGGGGCTGG - Intronic
996348983 5:122517807-122517829 ATGGAAGCTCCCACGTGGGCAGG + Intergenic
997206519 5:132053542-132053564 AGGGAAGCTGCCACCTGGGCTGG - Intergenic
997410595 5:133687901-133687923 AGGGAAGCTGCCTCCTCCCCAGG + Intergenic
997569743 5:134917283-134917305 AGGGGTGTTGCCGCCTGGCCCGG - Intronic
998132873 5:139660021-139660043 GGGGAAGCAGCCGGGTGGGCAGG + Intronic
999148732 5:149412868-149412890 AGGGAGGCTGCCTGCTGGCCTGG + Intergenic
999308391 5:150535542-150535564 TGGGAAGCTGAGGCCTGGGAGGG - Intronic
1002309747 5:178307124-178307146 AGGGATGCGGCCACCTGGGGAGG - Intronic
1002337085 5:178487224-178487246 AGGGAAGCCCTGGCCTGGGCTGG - Intronic
1002763121 6:217281-217303 AGGGAGGCTGGCGCCCAGGCAGG - Intergenic
1002897754 6:1389427-1389449 AGGGAGGCGGCCGCCAGGTCGGG + Intergenic
1003152234 6:3562761-3562783 AGGGAATCTGAGGCCTGGGAAGG + Intergenic
1006395024 6:33781741-33781763 AGGGGAGATGGCCCCTGGGCTGG - Intronic
1006424562 6:33956120-33956142 AAGGAAGCTACCCCCTGGGATGG - Intergenic
1014205411 6:118651201-118651223 AGGGAAGCTGCGGGCTCCGCCGG + Intronic
1015325507 6:131918947-131918969 AGGGAAGCTGCAGTGTGGGGAGG - Intergenic
1017056949 6:150445166-150445188 AGGGAAGCTGACGCCTAGAGTGG + Intergenic
1017403773 6:154094537-154094559 AGGGCAGCTGCCCGATGGGCGGG + Intronic
1018252221 6:161882426-161882448 AGGGAAGCTGCCGCCTGGGCTGG - Intronic
1018826974 6:167415704-167415726 AGGGAAGCAGCCGTCTCAGCTGG + Intergenic
1019291987 7:255232-255254 AGAGCAGCTGCCGGCTGGGACGG - Intronic
1019451105 7:1098802-1098824 TGGGAAGCGGCTGCCGGGGCTGG + Intronic
1019473105 7:1231611-1231633 AGGAGAGCTCCGGCCTGGGCTGG - Intergenic
1020221009 7:6237117-6237139 AGAGCAGCTCCCGCCTCGGCAGG + Intronic
1021574333 7:22093909-22093931 AGGGCAGCTGGCCCCTGGGAAGG - Intergenic
1021844714 7:24753245-24753267 AGGGTTGCTGGGGCCTGGGCAGG - Intronic
1023972246 7:45000129-45000151 GGGGAAGGTGGGGCCTGGGCGGG + Intronic
1024964137 7:55006588-55006610 AGGGGAGCAGCCCCTTGGGCCGG - Intergenic
1026019666 7:66697471-66697493 AGGGGAGCTGGCGGCTGGGATGG - Intronic
1026880718 7:73905109-73905131 AGGGGAGCTGGCGGCTGGGATGG + Intergenic
1026941214 7:74289208-74289230 AGGACAGCTGCGGCCTGGGAAGG + Intergenic
1029362113 7:100095421-100095443 AGGGGGGCTGCCGGCTGTGCTGG + Exonic
1030693259 7:112556725-112556747 AAGGAAGCTGCAGCATGAGCAGG - Intergenic
1032037623 7:128531646-128531668 CGGGCAGCAGCCGCCTGCGCCGG - Intergenic
1032497249 7:132371614-132371636 AGGGAAGCAGCCACTTGGGAGGG + Intronic
1033768477 7:144521969-144521991 AGGGAAACTGGCACCTAGGCTGG + Intronic
1034894105 7:154864374-154864396 AGGGAAGCAGCCTCATGAGCAGG + Intronic
1035004401 7:155644580-155644602 AGGGCTGCTGCGGCCTCGGCGGG + Intronic
1035275341 7:157744992-157745014 AAGGAAGGTGCCGCCTGGAAGGG - Intronic
1035431859 7:158828914-158828936 AGGGAAGCGCCTGCCTGGACCGG + Intronic
1035526574 8:317590-317612 AGGGAAGCTCCTCCCTGGGAGGG + Intergenic
1035574696 8:697052-697074 AGGCCAGCTGCCTCCTGGGAGGG - Intronic
1035589563 8:802350-802372 AGGGAAGCTGTGGCCTGAGGTGG - Intergenic
1035846637 8:2872815-2872837 AGGGAAGCAGAAGCCTGGTCAGG + Intergenic
1036770003 8:11572349-11572371 AGGGAAGGTGCTGTCTGGCCTGG - Intergenic
1037891070 8:22624022-22624044 AGAGGAGCTGCGGCCTGTGCGGG - Exonic
1038500871 8:28042521-28042543 AGGGAAGGTGCCTCATGGGAAGG - Intronic
1040413705 8:47179828-47179850 AGGGAAGCTCCGGCCTTGGGAGG - Intergenic
1042374736 8:68037443-68037465 AGGAAAGCTGCCCCCTGAGTTGG - Intronic
1044613862 8:94119873-94119895 AGGGAGGCTGCCGAATGGGGAGG + Intergenic
1047192778 8:122693414-122693436 TGGGAAGCTGCTTCTTGGGCAGG - Intergenic
1048986594 8:139738163-139738185 AGGGAAGCAGCAGCCTAGGGAGG + Intronic
1049398271 8:142412009-142412031 AGGAATGCTGCCCCGTGGGCTGG - Intergenic
1049684552 8:143934107-143934129 AGGGAAGGGGCCGCGTTGGCCGG + Intronic
1052666362 9:31499997-31500019 AGAAAATCTGCAGCCTGGGCAGG + Intergenic
1052803037 9:32987771-32987793 GGTGAAGCTGCAGCCTGGCCAGG - Exonic
1055862731 9:80772400-80772422 AGGGCAGCTGCAGCCTGCGTGGG + Intergenic
1056607220 9:88096128-88096150 AGGGAAGATGCCTGCTGGCCAGG + Intergenic
1057311506 9:93946061-93946083 AGCGGAGCTGCCGCGGGGGCTGG + Intergenic
1057739112 9:97696814-97696836 AGGGATGCAGCCGCCCCGGCCGG - Intronic
1058711385 9:107682220-107682242 GGGGATGCTGCCCTCTGGGCTGG - Intergenic
1059256488 9:112935774-112935796 AGGGAAGCAGGAGCCTTGGCTGG + Intergenic
1059399037 9:114057294-114057316 AGGCAAGCTGGGGCCTGAGCAGG + Intergenic
1060119290 9:120973196-120973218 ATGGAAGCAGCATCCTGGGCTGG + Intronic
1060209294 9:121700091-121700113 AGAGAAGCAGCTGCCTAGGCTGG - Intronic
1060267782 9:122122245-122122267 AGGGAAGCTGAAGCCAGGGCAGG - Intergenic
1060477240 9:123995939-123995961 AGGGTTCCTGCCTCCTGGGCTGG - Intergenic
1061037826 9:128123222-128123244 CGGGAAGCTGAAGCCTGAGCAGG + Intronic
1061098352 9:128473090-128473112 GGGGCAGCTGCAGGCTGGGCAGG + Intronic
1061167735 9:128933914-128933936 TGGGAATCTGCCCCCTGGGCTGG + Intronic
1061444674 9:130631123-130631145 ATGAAAGCTGCCTGCTGGGCTGG - Intronic
1062306150 9:135907932-135907954 AGGGCAGCTGCGGGCTCGGCAGG - Intergenic
1062363913 9:136199951-136199973 AGGCAAGCGGCTGCCTGGGAAGG + Intronic
1062468646 9:136692481-136692503 AAGGAAGCTGCAGCCTCGTCTGG - Intergenic
1062723085 9:138054532-138054554 TGGGACGCTGCCGCGTGGGCAGG - Intronic
1186036424 X:5428606-5428628 AGGCAAGCTGGTGCCTGGGCTGG + Intergenic
1187397170 X:18928759-18928781 AGGGCAGCAGCAGCCTGGGCTGG + Intronic
1189308790 X:40006093-40006115 AGGGAGGCTGCTGCCTGAACTGG + Intergenic
1192304469 X:69944415-69944437 AGGGAACCTGCCGCCTTGAAGGG - Intronic
1193282022 X:79663492-79663514 AGAGATTCTGCCACCTGGGCTGG - Intergenic
1195732797 X:107982522-107982544 AGGGAACCTGCCACATGGTCGGG + Intergenic
1195839251 X:109154649-109154671 AGGGAAGCTGTAGGCTGAGCAGG + Intergenic
1200105536 X:153710021-153710043 AGAGGAGGTGCCGGCTGGGCCGG + Intronic
1200134704 X:153869249-153869271 AGGAGAGGTGCCACCTGGGCTGG + Intronic
1200252044 X:154558993-154559015 AGGGCAGGAGCCGCCAGGGCAGG + Intronic
1200265724 X:154645423-154645445 AGGGCAGGAGCCGCCAGGGCAGG - Intergenic
1200827780 Y:7661079-7661101 TGGGAAGCAGCTTCCTGGGCTGG - Intergenic
1202232054 Y:22668564-22668586 CGGGAAGCAGCTCCCTGGGCTGG + Intergenic
1202311102 Y:23527594-23527616 CGGGAAGCAGCTCCCTGGGCTGG - Intergenic
1202559700 Y:26143000-26143022 CGGGAAGCAGCTCCCTGGGCTGG + Intergenic