ID: 1018252226

View in Genome Browser
Species Human (GRCh38)
Location 6:161882443-161882465
Sequence TTCCCTCCGGGCCTTCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018252217_1018252226 2 Left 1018252217 6:161882418-161882440 CCGCCTCCCCAGCCCAGGCGGCA 0: 1
1: 0
2: 5
3: 81
4: 707
Right 1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG 0: 1
1: 0
2: 1
3: 21
4: 197
1018252222_1018252226 -10 Left 1018252222 6:161882430-161882452 CCCAGGCGGCAGCTTCCCTCCGG 0: 1
1: 0
2: 0
3: 13
4: 151
Right 1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG 0: 1
1: 0
2: 1
3: 21
4: 197
1018252221_1018252226 -6 Left 1018252221 6:161882426-161882448 CCAGCCCAGGCGGCAGCTTCCCT 0: 1
1: 1
2: 3
3: 26
4: 323
Right 1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG 0: 1
1: 0
2: 1
3: 21
4: 197
1018252219_1018252226 -4 Left 1018252219 6:161882424-161882446 CCCCAGCCCAGGCGGCAGCTTCC 0: 1
1: 0
2: 2
3: 43
4: 423
Right 1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG 0: 1
1: 0
2: 1
3: 21
4: 197
1018252220_1018252226 -5 Left 1018252220 6:161882425-161882447 CCCAGCCCAGGCGGCAGCTTCCC 0: 1
1: 1
2: 1
3: 44
4: 354
Right 1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG 0: 1
1: 0
2: 1
3: 21
4: 197
1018252218_1018252226 -1 Left 1018252218 6:161882421-161882443 CCTCCCCAGCCCAGGCGGCAGCT 0: 1
1: 0
2: 4
3: 55
4: 530
Right 1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG 0: 1
1: 0
2: 1
3: 21
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018252226 Original CRISPR TTCCCTCCGGGCCTTCCTGC AGG Intronic
900981414 1:6048231-6048253 TTCCTTCCCGCCCTGCCTGCTGG + Intronic
901221119 1:7584374-7584396 TCTCCTCCTGGCCTGCCTGCAGG - Intronic
904319799 1:29689476-29689498 TGCCCTCCCAGCCCTCCTGCTGG + Intergenic
907514625 1:54985828-54985850 TTCACTCAGGGCCTCCCTCCAGG - Intronic
908109971 1:60887128-60887150 ATCCTTCCAGGCCTCCCTGCCGG - Intronic
912079574 1:105918437-105918459 TTCCCTCTGGGTCTTCCAACTGG - Intergenic
913542598 1:119836156-119836178 TTTCCTCCGGGGAGTCCTGCAGG + Intergenic
914256404 1:145963534-145963556 TTCCCTTGGTGCCTTCCAGCTGG - Exonic
915596170 1:156897667-156897689 TGCTCTCCAGGCCTTCCTGCAGG - Intronic
916023320 1:160813572-160813594 TTCTCTCAGCGCTTTCCTGCTGG + Intronic
918131664 1:181634953-181634975 TTCCCTGTGGGACTTCTTGCAGG - Intronic
918789930 1:188813068-188813090 CTCCCTCCAGGCCTCCCGGCAGG - Intergenic
920386165 1:205571457-205571479 GGCCCTCTGGGGCTTCCTGCTGG + Intronic
921055269 1:211538364-211538386 TTCCTCCCTGGCCTTCTTGCAGG + Intergenic
922326826 1:224535910-224535932 CTCCCTCCCTGCCTTGCTGCAGG - Intronic
922937674 1:229434138-229434160 TTCCCTCCGCGCCACCCCGCAGG + Intergenic
1064285819 10:13990449-13990471 TTCCTTCCTGGCCTTCCTTGTGG + Intronic
1070760735 10:79022855-79022877 TTCCCTCCAGGCCTCCTTACAGG - Intergenic
1072303408 10:94084310-94084332 TTCCCTCAGGCCCTTCCTTAGGG - Intronic
1073376745 10:103041784-103041806 TTCCCCCCTCCCCTTCCTGCTGG + Intronic
1075517379 10:123119511-123119533 TTCCCTCAGGGCCTTCTTTGGGG + Intergenic
1076238397 10:128883540-128883562 TTCCCGCTGTGCCTTCGTGCTGG - Intergenic
1076322675 10:129595019-129595041 GTCTCTCGGGGCCTTCCTTCAGG + Intronic
1076507021 10:130984915-130984937 TTCCCTCAGGGCCCCACTGCAGG - Intergenic
1076539285 10:131204056-131204078 TTCCCTTCGGGCCTTCCATGAGG - Intronic
1076851266 10:133094484-133094506 TGGCCGCCGCGCCTTCCTGCAGG - Intronic
1076869276 10:133185679-133185701 TTCCCTCTGGGGCTTCCTATGGG - Intronic
1077164980 11:1130875-1130897 TTCCCACAGGGGCTTCCTGGGGG - Intergenic
1077615354 11:3670085-3670107 TTCCTCCCTGGCCTGCCTGCAGG + Intronic
1083103817 11:60337620-60337642 ATCCCTCCGGGACTTCCTGAGGG + Intronic
1083768324 11:64852944-64852966 TTCCCACCAGGCTTTCCCGCGGG - Exonic
1083901706 11:65646537-65646559 CGACTTCCGGGCCTTCCTGCTGG + Exonic
1085527668 11:77173632-77173654 TTCCCCCTGTGCCTCCCTGCAGG - Intronic
1090182832 11:124716111-124716133 TATCCTCTGGGCCTTCCTGGGGG - Intergenic
1090255561 11:125281302-125281324 TTCCCTCAATGCCTTCCTGGTGG + Intronic
1093581726 12:20791110-20791132 TTCCCTCTGTGCTTTGCTGCAGG + Intergenic
1094497082 12:30995204-30995226 AGCCCTCAGGGCCTTCATGCAGG + Exonic
1098439658 12:70504458-70504480 CTCCCTGCAGGCCTCCCTGCAGG + Intergenic
1102284451 12:111644297-111644319 GTCCCTCCTGGATTTCCTGCCGG + Exonic
1102475300 12:113185037-113185059 GAGCCTGCGGGCCTTCCTGCCGG - Intronic
1103721514 12:122978000-122978022 GCCCCTTCTGGCCTTCCTGCTGG + Intronic
1104036525 12:125101146-125101168 TTCCCTCCTGGCCATCCTCAAGG - Intronic
1104164812 12:126217239-126217261 TTCCCTCCAGCACTTCCTACTGG - Intergenic
1105203055 13:18195274-18195296 TTCCCTCGGGGCCTGCATGCTGG - Intergenic
1106568788 13:30908466-30908488 TTCCCTCCTGGCCATCCTTCAGG - Intronic
1108710765 13:53029931-53029953 TTCACTCTGGGCCTTTCTGCGGG + Intronic
1112369155 13:98779667-98779689 TTTCCTTCGGGGTTTCCTGCTGG - Intergenic
1112540439 13:100306467-100306489 TAACCTCCGTGCCTTGCTGCTGG + Intronic
1113052606 13:106230460-106230482 TGCCCTCCTGGACTTCATGCAGG - Intergenic
1113407734 13:110057151-110057173 TTCCCACCTCACCTTCCTGCCGG + Intergenic
1113518352 13:110920144-110920166 ATCCTCCCGGGCCTGCCTGCAGG - Intergenic
1114494362 14:23122351-23122373 CTGCCTGTGGGCCTTCCTGCTGG - Intergenic
1117564134 14:56976527-56976549 TTCCCTCCGTCCCTTCCTTTGGG + Intergenic
1122571826 14:102708671-102708693 TTCCCTCCGCGCCTTCCTGGTGG + Intronic
1122770262 14:104094728-104094750 TGCCCTGCGGTCCTTGCTGCAGG + Intronic
1123017829 14:105384002-105384024 TCGCCTCCAGGCCTTGCTGCTGG - Intronic
1124138807 15:27059210-27059232 TGCCCTTCAGGCCTTCCTGCTGG - Intronic
1124617896 15:31255841-31255863 CTCCCTCAGGTCCTTCCTTCTGG - Intergenic
1125541500 15:40472239-40472261 TGCCCCCCGGGCCCTGCTGCAGG + Exonic
1125833783 15:42733803-42733825 TCCCCCCAGGTCCTTCCTGCCGG - Intronic
1127912748 15:63431649-63431671 TTCTCCCCAGGCCTCCCTGCAGG + Intergenic
1128143028 15:65315640-65315662 CTGCCTCCCGGCCTTTCTGCAGG - Intergenic
1129803930 15:78438483-78438505 TCCCCTCGGGGCCTGCCTGCTGG + Intronic
1131507352 15:93030128-93030150 TCCCTGCTGGGCCTTCCTGCTGG - Intergenic
1132882849 16:2170107-2170129 TTCCCTCTGAGCCTCCCAGCTGG + Intronic
1134269897 16:12724103-12724125 TTCCCTCTGGGGCTTCCTCCAGG + Intronic
1135721431 16:24821605-24821627 TCCCCATCTGGCCTTCCTGCTGG - Intronic
1136147750 16:28325515-28325537 ATCCCTCCCGCCCTTCCTTCAGG + Intergenic
1138591037 16:58000097-58000119 CTCCCGCCGGCCCTGCCTGCAGG + Intronic
1141134317 16:81455830-81455852 TTCCCACCAGGCCTCCCTGAAGG - Intronic
1141291574 16:82722732-82722754 TTCACTCCTGAACTTCCTGCAGG - Intronic
1141647738 16:85376534-85376556 TGCCCTCCCTGCCTGCCTGCCGG + Intergenic
1141937488 16:87251126-87251148 TTCCCTCAGGGTCTTCCTGTTGG - Intronic
1141996515 16:87639613-87639635 CTCCCTCCTGGCCTCCCTCCTGG + Intronic
1142122952 16:88396337-88396359 TCTCCTCCAGGCCTCCCTGCAGG - Intergenic
1142741919 17:1936531-1936553 TTCCCTGGGGGCCTCCCTCCTGG - Exonic
1143600161 17:7939902-7939924 TTACCCCCAGCCCTTCCTGCTGG - Intronic
1144582959 17:16470250-16470272 TTCCCGCGGGGCCTTCCTTCTGG - Intronic
1146184692 17:30717227-30717249 TTGCCTCCTGGCCTCCCTTCTGG - Intergenic
1150010285 17:61496693-61496715 TTCCCCGCGGGCCTTCCTGAAGG + Intergenic
1150338131 17:64344714-64344736 TTCCCTCTCTGCCTTCCTGTGGG - Intronic
1151849976 17:76684484-76684506 TTCCCTCCACACCATCCTGCTGG - Intronic
1151883469 17:76909373-76909395 ATTCCTCAGGGCCTTCCTTCAGG + Intronic
1152588514 17:81199752-81199774 CTCCTCCCGGGCCTTCCTCCTGG + Exonic
1152734765 17:81992000-81992022 TGCCCTCCTGGCCGTCCCGCTGG + Intronic
1152865999 17:82723418-82723440 TGCCCTCTGGTCCTGCCTGCTGG + Intronic
1153999941 18:10474342-10474364 TTCCCTCGGGGCCTTTGTGAAGG + Intronic
1158405876 18:57158525-57158547 CTCCCTCCCTGGCTTCCTGCAGG + Intergenic
1159642430 18:70879170-70879192 TTCCATCCAGCCCTTCCTGATGG + Intergenic
1160541499 18:79626326-79626348 GTCCCACCAGCCCTTCCTGCAGG - Intergenic
1162974091 19:14198466-14198488 TTGCCTCCTGGCCTCCCTTCTGG + Intronic
1163807190 19:19406282-19406304 TTCCGTCCTGCGCTTCCTGCGGG + Intronic
1164931105 19:32176904-32176926 TTTCATCCGTGCCTTCCTGAAGG - Intergenic
1165100271 19:33434945-33434967 TTCCCTCCAGGCCGTCCTCAGGG - Intronic
1165203641 19:34165583-34165605 TTCACTCCAGGGCTTCCTGTTGG + Intergenic
1166223996 19:41383762-41383784 CTCCCGCCGTGCCTTCCTGCTGG + Exonic
1166809369 19:45506681-45506703 TCACCTCCGGGCCCTCCTGAGGG + Intronic
1168287724 19:55342750-55342772 CTACCTCCGTGCCTTCCTGCCGG + Exonic
925652643 2:6107706-6107728 TTCCCTCCATGCTTTCCTTCTGG + Intergenic
926400034 2:12487752-12487774 TCCTCTCCTGGCCATCCTGCAGG + Intergenic
927216099 2:20668558-20668580 TTCCCTCCTGCCCTCCATGCTGG - Intronic
927358180 2:22199088-22199110 TATTCTCCGGGCCTTGCTGCAGG - Intergenic
927843325 2:26458606-26458628 TTCCCACCGGGCCCTGCTGAGGG + Intronic
927867085 2:26596340-26596362 TTCCCTGCAGGATTTCCTGCCGG + Intronic
928602417 2:32916163-32916185 TTACCTCCCTGCCTTCCTTCCGG + Intergenic
929090701 2:38214455-38214477 TTCCCTCCAGGCCTTTCTAGTGG + Intergenic
929918659 2:46156619-46156641 TTCCATCCTGACCTTCCTACAGG + Intronic
931653814 2:64491812-64491834 TTCCCTCCAGGCCTACCAACAGG + Intergenic
932459452 2:71872926-71872948 TTCTCTCCAGGCCCTTCTGCAGG + Intergenic
932571738 2:72941875-72941897 TTCCCTCTGGGCCTCCCAGCTGG + Intergenic
932591500 2:73070723-73070745 TTCCCTCCGGGACCTCCTCTGGG - Intronic
932796173 2:74698065-74698087 TTCCTTCTGGGCCATCTTGCAGG - Intergenic
935794881 2:106631491-106631513 TAGCCTCCAGGCTTTCCTGCAGG + Intergenic
936926993 2:117747346-117747368 TGCCCACCATGCCTTCCTGCAGG + Intergenic
942084136 2:172428259-172428281 TTCCCTCCGGGCGTGTTTGCTGG + Intronic
945977102 2:216279581-216279603 TTCCATCCGGGTCTCCCTGTTGG - Intronic
947662580 2:231880752-231880774 TTCCTCCAGGGCCTTCCTGCAGG + Intergenic
1169609471 20:7362874-7362896 TTTGATCCTGGCCTTCCTGCGGG + Intergenic
1170006123 20:11671134-11671156 TTCCCACCTGCCCTTCCTGATGG + Intergenic
1170981045 20:21213245-21213267 TTCTGTCCGGGCCTTCTTACCGG + Intronic
1170981053 20:21213271-21213293 TTCCGTCCGGGCCTTCCGACCGG + Intronic
1174038424 20:47682534-47682556 TTCCCTCCCATCCTTCCTGGAGG - Intronic
1174819786 20:53716430-53716452 TTCCCTCTGAGTCTTCCTGTTGG + Intergenic
1176095871 20:63344307-63344329 GTCCCTCCAGCCCTTCCTGTCGG - Exonic
1176270086 20:64231830-64231852 TTCCCTCCAAGCCTTGCTGCTGG - Intronic
1176714905 21:10342731-10342753 TTCCGTCGGGGCCTGCATGCTGG + Intergenic
1178852595 21:36225631-36225653 CGCCCTCCTGGTCTTCCTGCTGG + Exonic
1179437125 21:41369669-41369691 TGCCCCTGGGGCCTTCCTGCAGG + Intronic
1180021447 21:45130667-45130689 TTCCCTCTGAGCCTCCCTCCCGG + Intronic
1180603443 22:17037207-17037229 TTCCGTCGGGGCCTGCATGCTGG - Intergenic
1181474320 22:23159100-23159122 ATCCCCCTGGGCCTCCCTGCAGG + Intronic
1183300813 22:37058249-37058271 ATCCCTCCAGGCCATCCTGGGGG - Intronic
1183737426 22:39651578-39651600 TTCCCTGTGGGGCTTTCTGCAGG - Intronic
1184036551 22:41920769-41920791 TTCCTCCTGGGGCTTCCTGCAGG - Intergenic
1184246761 22:43239784-43239806 TTCCCTCTTCGCCTTGCTGCTGG + Intronic
1184458876 22:44626080-44626102 TCCCCGCTGGGCCTTCCTCCCGG + Intergenic
1184660999 22:45965462-45965484 CTCCCTCCTCCCCTTCCTGCTGG - Intronic
1184756207 22:46517273-46517295 TTCCCTCCTGTTTTTCCTGCGGG - Intronic
1185379892 22:50503516-50503538 TTCTCTCCGGTCCTCCCCGCTGG - Exonic
949407193 3:3726713-3726735 TTCCCCCAGGGCACTCCTGCTGG - Intronic
950646723 3:14381797-14381819 TTGCATCTGGGCCTTCCAGCAGG + Intergenic
950669641 3:14518397-14518419 TTTGCTCCAGGGCTTCCTGCTGG + Intronic
952723719 3:36560264-36560286 TTCTCTCTGGGGATTCCTGCTGG - Intergenic
954395330 3:50290425-50290447 TTTCCTCAAGGTCTTCCTGCTGG + Exonic
954400684 3:50317999-50318021 TGCCCTCCTGGGCTTCCTGGGGG + Exonic
955224574 3:57050292-57050314 TTGCCTCAGGGCCTTCCCACAGG + Intronic
960857144 3:122113794-122113816 TTCTCTCCAGGCCTTCTTTCAGG - Intronic
961146117 3:124594731-124594753 TTCCCACCTTGCCTTTCTGCAGG + Intronic
961628632 3:128280687-128280709 TTCCCTCTGGGCCCTCAAGCTGG + Intronic
961747460 3:129073866-129073888 TTCCCTCCGTGACTTCACGCTGG - Intergenic
962621170 3:137181299-137181321 TTCCCTCCAGTCCCTCCTACTGG + Intergenic
963038723 3:141052956-141052978 TGCCCTCCTCTCCTTCCTGCCGG - Intronic
964206376 3:154179485-154179507 TTCCCTCAAGGCCCTGCTGCAGG - Intronic
967982035 3:195071506-195071528 TTCCCTCCGGACATTCTTACAGG + Intronic
968087036 3:195878448-195878470 GGCCCTGCGGGACTTCCTGCTGG - Exonic
968872840 4:3250307-3250329 TCCCCTCCGGCCTTCCCTGCAGG - Intronic
968877972 4:3284138-3284160 TCCCCTCCAGGGCATCCTGCTGG - Intergenic
969053810 4:4389388-4389410 TTCCATCCCGGACTTCCCGCCGG + Intronic
969531126 4:7731063-7731085 TTGCCTCCGGTCCTTTCTGACGG - Intronic
970232269 4:13922981-13923003 GTCCCTCCGTGCCTCCCTTCTGG + Intergenic
970427863 4:15962546-15962568 TTCCCTCCGGGCCTGGGTCCAGG + Exonic
977998333 4:103523770-103523792 TTCCCTCCCTTCCTTCCTGTTGG + Intergenic
980954586 4:139415368-139415390 TTCCCTCCCTCCCTTCCTTCCGG + Intronic
982578156 4:157143900-157143922 TTCTCTCCTGGCTTTCCTTCTGG + Exonic
985972173 5:3387158-3387180 TTCCCTCAGGGCAATACTGCAGG - Intergenic
986128836 5:4908752-4908774 TTCCCTCCTTCCCTTCCTGCTGG + Intergenic
987389898 5:17366128-17366150 TTCCATGCTGGCCTTCCTTCTGG - Intergenic
988718007 5:33847140-33847162 TTCTCTCAGGGCCTTTGTGCTGG - Intronic
1001887877 5:175311837-175311859 TTCCATCCTGTCCTTCCTGATGG - Intergenic
1002189669 5:177472151-177472173 ATCCCTCCAGGCCTGGCTGCTGG + Exonic
1002421771 5:179152703-179152725 ATCCCTCAGGGACGTCCTGCAGG - Intronic
1003308689 6:4950220-4950242 TCCTCTCCCGCCCTTCCTGCAGG - Intronic
1003449628 6:6218883-6218905 TTTCCTCTGAGCCTCCCTGCTGG + Intronic
1003507227 6:6750081-6750103 TTCCCTCTGTGGCTTCCAGCGGG + Intergenic
1005475874 6:26207305-26207327 TTACCTCCATGCTTTCCTGCTGG - Intergenic
1006196359 6:32245050-32245072 CTCCCTCGGTGTCTTCCTGCTGG + Intergenic
1006239457 6:32664870-32664892 TCCCCTCCAGGACTTCCTTCTGG + Exonic
1006594292 6:35181834-35181856 TGCCCTCAGGGCCTCCCTGTCGG + Intergenic
1007123123 6:39400094-39400116 GTCCCTCCTGGCTTTACTGCTGG - Intronic
1007245980 6:40463032-40463054 TTCCCTCATCTCCTTCCTGCTGG + Intronic
1009028244 6:58025550-58025572 TTCCCTCCAATCCTTCCTCCAGG + Intergenic
1009203779 6:60776935-60776957 TTCCCTCCAATCCTTCCTCCAGG + Intergenic
1012959154 6:105604442-105604464 TTCCCTCTGGAGCTTCCTGAAGG + Intergenic
1013355131 6:109339816-109339838 TTCCCTCCGTGGCTCCCAGCTGG + Intergenic
1015364760 6:132385228-132385250 CTGCCTCCTGGCCTTCCTTCTGG - Intronic
1016620808 6:146107451-146107473 ATCCCTCAGAGGCTTCCTGCAGG + Intronic
1018246544 6:161829686-161829708 TGCTCTCCGGGGCATCCTGCAGG - Intronic
1018252226 6:161882443-161882465 TTCCCTCCGGGCCTTCCTGCAGG + Intronic
1019362260 7:610991-611013 TTCCAGCCGGCCCTTCCTGCGGG + Intronic
1020137471 7:5594875-5594897 TCCCCTCCGGGGCCTCCTGCAGG + Intronic
1020202218 7:6088859-6088881 TTCCCGCCGTCCCCTCCTGCGGG - Intergenic
1022208772 7:28187983-28188005 TCCACTCTGCGCCTTCCTGCTGG + Intergenic
1023028572 7:36073841-36073863 TTTCCTCTGCCCCTTCCTGCTGG - Intergenic
1024546653 7:50528166-50528188 CTCTCTCCAGGGCTTCCTGCAGG + Exonic
1026524158 7:71140144-71140166 CTCCCTTCGCTCCTTCCTGCAGG - Intronic
1026589456 7:71682487-71682509 TGCCATCCAGGCATTCCTGCTGG - Intronic
1028584764 7:92442088-92442110 TTCCATCCTTCCCTTCCTGCTGG - Intergenic
1034458998 7:151187648-151187670 TTCCCTCCGCCCCGGCCTGCCGG - Intronic
1035040335 7:155922180-155922202 CTCCCTCTGGGCCTTGCTCCTGG + Intergenic
1035091782 7:156319012-156319034 TTCCTTACCGGGCTTCCTGCAGG + Intergenic
1035548182 8:499749-499771 TTCCCTCCTGTCCTTCCCGGGGG - Intronic
1037581175 8:20246852-20246874 TTCCCTCTGGGCACGCCTGCTGG - Exonic
1037694436 8:21211016-21211038 TTCCCTCTGCCTCTTCCTGCAGG - Intergenic
1037832660 8:22198589-22198611 CTCACTCCCGGCCTGCCTGCTGG + Intronic
1038676782 8:29630049-29630071 GTCTCTCCGGGCCTTCCTTTTGG + Intergenic
1043969573 8:86514662-86514684 GTCCCGCCGGGCCCTGCTGCTGG + Intronic
1044023227 8:87133579-87133601 TTCCCTTCGGGCCCTTCTGTGGG + Intronic
1047965021 8:130040092-130040114 TTAGCTCCCGACCTTCCTGCAGG + Intergenic
1049348589 8:142152176-142152198 TTCCTTCCGGCTCTTCCTGGAGG - Intergenic
1053140219 9:35677783-35677805 TTTCTTCCGGGCCCTCCTGGGGG - Exonic
1058553213 9:106137996-106138018 TTCTCTCAGGGCCTGCCTGTAGG - Intergenic
1058835291 9:108854757-108854779 TTCCATCCTGGCCTCCCTGCAGG - Exonic
1060776406 9:126377977-126377999 TTCCCTGCGGGCATCACTGCCGG - Intronic
1061659705 9:132120876-132120898 TTCCCTCCTGGCCTTCCCTTTGG - Intergenic
1062383008 9:136296634-136296656 GTCCCTCTGGGGCTTCCTTCTGG - Intronic
1188297832 X:28471546-28471568 TTCCCTCCAGTCCTTCCAGAAGG + Intergenic
1190533798 X:51407099-51407121 TTGCCTCCGGGGATGCCTGCGGG + Exonic
1190582633 X:51903543-51903565 TTTCCTCCAGGCCTACCTGAGGG - Intergenic
1192937827 X:75879828-75879850 TCACCTCCAGGCCTGCCTGCAGG - Intergenic
1202604325 Y:26626289-26626311 TGCACTCCGGGCCTGCCCGCTGG + Intergenic