ID: 1018253662

View in Genome Browser
Species Human (GRCh38)
Location 6:161896679-161896701
Sequence TTGTAAACACTTACGAAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018253662_1018253667 0 Left 1018253662 6:161896679-161896701 CCAAGCTTCGTAAGTGTTTACAA 0: 1
1: 0
2: 1
3: 8
4: 182
Right 1018253667 6:161896702-161896724 GATGGTGTTGTCACTGTTGGGGG No data
1018253662_1018253670 30 Left 1018253662 6:161896679-161896701 CCAAGCTTCGTAAGTGTTTACAA 0: 1
1: 0
2: 1
3: 8
4: 182
Right 1018253670 6:161896732-161896754 CAATATTATACTCTTGCCTGTGG No data
1018253662_1018253665 -2 Left 1018253662 6:161896679-161896701 CCAAGCTTCGTAAGTGTTTACAA 0: 1
1: 0
2: 1
3: 8
4: 182
Right 1018253665 6:161896700-161896722 AAGATGGTGTTGTCACTGTTGGG No data
1018253662_1018253666 -1 Left 1018253662 6:161896679-161896701 CCAAGCTTCGTAAGTGTTTACAA 0: 1
1: 0
2: 1
3: 8
4: 182
Right 1018253666 6:161896701-161896723 AGATGGTGTTGTCACTGTTGGGG No data
1018253662_1018253664 -3 Left 1018253662 6:161896679-161896701 CCAAGCTTCGTAAGTGTTTACAA 0: 1
1: 0
2: 1
3: 8
4: 182
Right 1018253664 6:161896699-161896721 CAAGATGGTGTTGTCACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018253662 Original CRISPR TTGTAAACACTTACGAAGCT TGG (reversed) Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
905782541 1:40725091-40725113 TTCTAAACCCTTACATAGCTGGG - Intronic
905790152 1:40785163-40785185 TTGGAAACACTGACGCTGCTGGG + Intronic
906349102 1:45041831-45041853 TAGTAAAAACTTACTAGGCTGGG - Intronic
906594016 1:47057007-47057029 TTGTAAAGACCATCGAAGCTAGG - Intergenic
907435871 1:54447354-54447376 TTGTAAAGACTGTCGATGCTAGG - Intergenic
907750050 1:57254154-57254176 TTGGAAACCGTTAGGAAGCTGGG - Intronic
908583977 1:65548896-65548918 TTGTAAAGACCTTCGAGGCTAGG - Intronic
909668342 1:78160717-78160739 TTGTAAAGACTGTCGATGCTAGG + Intergenic
909770572 1:79416195-79416217 TTGTAAACACCATCGATGCTAGG + Intergenic
910241798 1:85094657-85094679 TTGTAAACATTTATAAAGTTAGG + Intronic
911079496 1:93914679-93914701 TTGTAAAGACTATCGATGCTAGG - Intergenic
911298361 1:96144954-96144976 TTTTAAACACTTAATGAGCTCGG - Intergenic
911339083 1:96615853-96615875 TTGTAAAGACTATCGATGCTAGG - Intergenic
911560832 1:99403905-99403927 TTGTAAAGACCATCGAAGCTAGG - Intergenic
911636281 1:100239306-100239328 CTGTAAACACTTAGGAACTTTGG - Intronic
912973472 1:114306027-114306049 TTGTAAAGACCATCGAAGCTAGG + Intergenic
913418707 1:118639791-118639813 TTGTAAACACCATCGAGGCTAGG + Intergenic
914142876 1:144966545-144966567 TTGTAAACACCATCGATGCTAGG + Intronic
914208521 1:145557404-145557426 TTGTAAACACCATCGATGCTAGG - Intergenic
914441224 1:147709068-147709090 TTGTAAAGACCATCGAAGCTAGG - Intergenic
915425346 1:155821368-155821390 TTGTAAACAGTTTGGCAGCTGGG - Intronic
915760419 1:158305985-158306007 TTGTAAAGACTGTCGAGGCTAGG + Intergenic
916252055 1:162748054-162748076 TTGTAAACACCATCGATGCTAGG + Intronic
917192610 1:172433657-172433679 TTGTAAAGACTATCGATGCTAGG + Intronic
917573475 1:176295166-176295188 TTGTAAAGACTATCGATGCTAGG - Intergenic
921686479 1:218094857-218094879 TTATAAACAATTCTGAAGCTTGG - Intergenic
921760905 1:218913331-218913353 TTATAAGCACTTAGTAAGCTTGG + Intergenic
1064153255 10:12882906-12882928 TTGTCAAAACTTACTGAGCTAGG + Intergenic
1064792272 10:18971294-18971316 TTGTAAAAACTATCGATGCTAGG + Intergenic
1065594975 10:27301283-27301305 TTGTAAAGACCATCGAAGCTAGG + Intergenic
1065606219 10:27420295-27420317 TTGTAAAGACCATCGAAGCTAGG + Intergenic
1066051623 10:31641904-31641926 TTGTAAAGACTGTCGATGCTAGG - Intergenic
1069256146 10:66334315-66334337 TTGTAAAGACTATCGAGGCTAGG - Intronic
1070372942 10:75802454-75802476 TTGTAATGACTTACACAGCTAGG - Intronic
1071323561 10:84489827-84489849 TTGTAAACACCAACGATGCTAGG - Intronic
1077948461 11:6927786-6927808 CTGTAAACAGTTACAGAGCTAGG - Exonic
1078750906 11:14162862-14162884 TTATAAACACTGACAGAGCTAGG - Intronic
1079516375 11:21273956-21273978 TTGTAAAGACTATCGAGGCTAGG + Intronic
1084551645 11:69846859-69846881 TTGTAAATACTTAGAAAACTGGG + Intergenic
1085222810 11:74889457-74889479 TTGTAAAGACTATCGAGGCTAGG + Intronic
1087696132 11:101378227-101378249 TTGTAAAGACCATCGAAGCTAGG + Intergenic
1087737878 11:101854530-101854552 TTGTAAAGACTATCGAGGCTAGG + Intronic
1091576932 12:1746222-1746244 TTATAAACACTTAAGAGGCTGGG + Intronic
1093707543 12:22291054-22291076 AGGTAAATACTTACGAAGCCTGG + Intronic
1094862052 12:34478345-34478367 TTGTAAAGACTGTCGAGGCTAGG + Intergenic
1095065233 12:37763747-37763769 TTGTAAAGACCATCGAAGCTAGG + Intergenic
1096029700 12:48402333-48402355 TTGTAAAGACTGTCGATGCTAGG - Intergenic
1097550594 12:61063024-61063046 TTGTAAAGACCATCGAAGCTAGG + Intergenic
1098053149 12:66474882-66474904 TTGTAAAGACTATCGATGCTAGG + Intronic
1098136222 12:67405245-67405267 TTATTAACACTTACTAAGCTAGG - Intergenic
1100424713 12:94473603-94473625 ATGTGAACACTTACGCAGCCTGG - Intergenic
1102909389 12:116700999-116701021 TTCTAAACCCTTCTGAAGCTGGG - Intergenic
1104372014 12:128231810-128231832 TTGTCAACACCTAGGAACCTGGG + Intergenic
1111928208 13:94485330-94485352 TTGGAAACACTGATGATGCTCGG - Intergenic
1113590896 13:111500211-111500233 TTGTAAAGACTTTCGATGCTAGG - Intergenic
1115931423 14:38500424-38500446 TTGAAAACTCTTACCAAACTAGG - Intergenic
1116145822 14:41067526-41067548 TTTTAAAAATTTACAAAGCTTGG + Intergenic
1123188270 14:106540870-106540892 TTGTAAAGAGTAACAAAGCTGGG + Intergenic
1124804769 15:32870525-32870547 TTGGAAAGACTTGCAAAGCTGGG + Intronic
1125258659 15:37797155-37797177 TTCCAAACACTTTCAAAGCTAGG + Intergenic
1127516872 15:59704094-59704116 TTGTAAACACTCACAATGCCTGG + Intergenic
1130798224 15:87233858-87233880 TTGTAAAGACTATCGAGGCTAGG - Intergenic
1137803036 16:51278382-51278404 TTTTAAACACTTTCTGAGCTGGG - Intergenic
1145981408 17:29014344-29014366 TAGTAAGCAATGACGAAGCTCGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1148691097 17:49527452-49527474 TTGTAAAAAATAACAAAGCTTGG + Intergenic
1156678355 18:39558833-39558855 ATGTAAACACTTGCTAATCTAGG + Intergenic
1160149143 18:76386013-76386035 TTCTAAACACTTACGAAGTTAGG - Intronic
926028011 2:9561548-9561570 TGGTCAACATTTAGGAAGCTGGG - Intergenic
926164147 2:10507769-10507791 TGTTAAACACTTACAAAACTGGG + Intergenic
927819383 2:26249669-26249691 TTGCAAACATTAACAAAGCTAGG - Intronic
928864786 2:35904970-35904992 TTGTAAAGACTATCAAAGCTAGG - Intergenic
939893867 2:147768560-147768582 TTGTAAAGACCTTCGAGGCTAGG + Intergenic
940432084 2:153604232-153604254 TTGAAATCACTTACGACCCTTGG - Intergenic
941054236 2:160768524-160768546 TTGTAAAGACCATCGAAGCTAGG + Intergenic
941426958 2:165359204-165359226 CTGTAAACAATTACGCATCTTGG - Intronic
1169796026 20:9463320-9463342 TTGTAAAGACCAACGAGGCTAGG + Intronic
1171513185 20:25704773-25704795 TTGTAAAGACTTTCCATGCTAGG - Intergenic
1172456100 20:35075345-35075367 TTGTAAAGACCTTCGATGCTAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1179293035 21:40035068-40035090 TTGTAAAGACTGTCGAGGCTAGG + Intronic
1179301144 21:40111469-40111491 TTGTAAAGACTGTCGAGGCTAGG + Intronic
1181800257 22:25342948-25342970 TTGTAAAGACTATCGAGGCTAGG - Intergenic
1182166716 22:28182174-28182196 TTGAAAATGCTTATGAAGCTAGG - Intronic
1183147064 22:36002951-36002973 TTGGAAAAACTTACTAAGGTAGG - Intronic
1183855965 22:40635448-40635470 ATGTAAAAACATACGAAGCATGG + Intronic
949856294 3:8464480-8464502 TTGTAAACACTTACAAAAATCGG - Intergenic
950028083 3:9834365-9834387 GTGTAAACACTAAAGGAGCTGGG - Intronic
951559144 3:23948153-23948175 TTGTAAACATTGACCAAGGTGGG + Intronic
955730668 3:61982206-61982228 TTATAAACACTTAAGATGTTTGG + Intronic
956207205 3:66767750-66767772 TTGTAAAGACTATCGATGCTAGG - Intergenic
958017876 3:87963844-87963866 TTGTAAACCCTTTGGAAGCAAGG + Intergenic
958127423 3:89375259-89375281 TTGTAAATACTTAGGAATATTGG - Intronic
960254902 3:115501514-115501536 TTGTAAACACTGAAGAACCAAGG + Intergenic
960752987 3:120977632-120977654 TTGTAAAGACCATCGAAGCTAGG - Intronic
962941554 3:140129125-140129147 TGATAAACACTTACTAAACTGGG - Intronic
965441177 3:168716829-168716851 TTGTAAAAAGTTACTAAACTGGG - Intergenic
966157473 3:176932675-176932697 TTGTGAACATTTAGCAAGCTTGG + Intergenic
967757049 3:193181451-193181473 TTGTAAACACCAACGATGCTAGG + Intergenic
970974941 4:22032971-22032993 TTGTATCCACTTTAGAAGCTTGG - Intergenic
973640587 4:52899237-52899259 TTGTAAAGACTATCGAGGCTAGG - Intronic
974336145 4:60547300-60547322 TTGTAAACAAGTACTAAGCCTGG - Intergenic
975236073 4:71998103-71998125 TTGTAAAGACCATCGAAGCTAGG + Intergenic
977134495 4:93286384-93286406 TTGTAAATAAGTACTAAGCTTGG - Intronic
978205124 4:106072183-106072205 TTGTAAAGACTATCGATGCTAGG - Intronic
978595886 4:110376703-110376725 TTAAAAACACTTAGGAAACTAGG + Intronic
978624287 4:110666880-110666902 TTTTAAACACTCTCCAAGCTAGG + Intergenic
979076602 4:116278607-116278629 TTGAAAACTCTTAACAAGCTAGG + Intergenic
979750489 4:124273452-124273474 TTGTAAAGACCTTCGATGCTAGG - Intergenic
983041114 4:162928446-162928468 TTGTGCACATTTATGAAGCTGGG - Intergenic
983053288 4:163073627-163073649 TTTTAAAGACTTAAGAAGATTGG + Intergenic
985825417 5:2187410-2187432 TTGCACACACTTACGAAGATCGG - Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989956727 5:50368800-50368822 TTGTAAAGACTTTTGAGGCTAGG + Intergenic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
992094745 5:73352554-73352576 TTATAAACACTTATGAATTTAGG - Intergenic
993199418 5:84794732-84794754 TTTAAAACACTTAGGAAGTTGGG + Intergenic
993497233 5:88621532-88621554 TTGTAAAGACTGTCGATGCTAGG - Intergenic
994161086 5:96557263-96557285 TTGTAAAGACTATCGATGCTAGG + Intronic
994438606 5:99770714-99770736 TTCCAAACACTTACTATGCTTGG + Intergenic
995727602 5:115198080-115198102 TTGAAAACAATTACGAAGTGGGG - Intergenic
996964233 5:129289315-129289337 TTGTAAAGACCATCGAAGCTAGG - Intergenic
997097155 5:130925608-130925630 TTGTAAAGACTATCGATGCTAGG + Intergenic
1000109788 5:158097383-158097405 TTGTAAACTCTCATTAAGCTAGG - Intergenic
1001009051 5:168081518-168081540 TTGTAAACACCATCGATGCTAGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005622824 6:27635670-27635692 TTGTAAACTCTGATGAAGCCGGG - Intergenic
1006041343 6:31258568-31258590 TTGTAAAGACTATCGATGCTAGG - Intergenic
1008398336 6:51035484-51035506 TTGTAAAGACCTTCGAGGCTAGG - Intergenic
1008414741 6:51226382-51226404 TTGTAAAGACCTTCGAGGCTAGG + Intergenic
1010721424 6:79286693-79286715 TTGTAAACACCATCGATGCTAGG + Intergenic
1011160701 6:84386983-84387005 TTGTAGTCTCTTACGATGCTTGG + Intergenic
1012691012 6:102311006-102311028 TGGTAAACACTTACATACCTGGG - Intergenic
1018253662 6:161896679-161896701 TTGTAAACACTTACGAAGCTTGG - Intronic
1020251627 7:6473371-6473393 TTGTGAACACCTACAGAGCTGGG - Intronic
1020586165 7:10071093-10071115 AAATAAACACTTAGGAAGCTAGG + Intergenic
1021767086 7:23960669-23960691 TCATAAACACTCATGAAGCTCGG + Intergenic
1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG + Intronic
1027574687 7:79917129-79917151 TTGTAAAGACCATCGAAGCTAGG + Intergenic
1028643649 7:93071904-93071926 TTGTAAACACCATCGATGCTAGG - Intergenic
1028647122 7:93110361-93110383 TTGTAAACACCATCGATGCTAGG + Intronic
1028994658 7:97086477-97086499 TTTTAAACAAGTACTAAGCTAGG - Intergenic
1029951486 7:104591201-104591223 TTGTAAAGACTATCGAGGCTAGG - Intronic
1036074949 8:5487720-5487742 TTGTAAAAAGTTACAAAGTTAGG + Intergenic
1040095327 8:43437081-43437103 TTGTTAACACTTGTGAAGGTGGG + Intergenic
1040992905 8:53371038-53371060 TTGTAAAGACTCTCGAGGCTAGG + Intergenic
1042441060 8:68827425-68827447 TTTTAAACATTTCCAAAGCTGGG + Intergenic
1042958182 8:74274179-74274201 TGGTAAACACCTAGGAAGCGGGG - Intronic
1043109151 8:76156336-76156358 TGGAAAACACTTAGAAAGCTTGG - Intergenic
1044708203 8:95028820-95028842 TTTTAAACACTTCTGAAGTTTGG + Intronic
1046222901 8:111238595-111238617 TTGAAAACAACTACGGAGCTGGG + Intergenic
1046811039 8:118534030-118534052 TTGTAAAGACCATCGAAGCTAGG - Intronic
1047665167 8:127083816-127083838 TTATTAACACTTACAAAGCATGG - Intergenic
1048118252 8:131549520-131549542 TTGTAAAGACCTTCGAGGCTAGG - Intergenic
1049538624 8:143194822-143194844 TAGTCAACATTTGCGAAGCTTGG - Intergenic
1050960413 9:11722766-11722788 TTGTAAAGACCATCGAAGCTAGG - Intergenic
1050977078 9:11952343-11952365 ATGTATACACTCACGAAGCAAGG - Intergenic
1056261313 9:84851458-84851480 TTATACACACTTATAAAGCTGGG - Intronic
1058208078 9:102132855-102132877 TTGTAAAGACTGTCGATGCTAGG + Intergenic
1059913043 9:119067505-119067527 TTGTAAAGACTATCGAGGCTAGG - Intergenic
1186617395 X:11203627-11203649 CTGTAAACATTTACAAAACTGGG - Intronic
1186931223 X:14392870-14392892 TTGTAAAGACCTTCGATGCTAGG + Intergenic
1187116997 X:16362107-16362129 TTGTAAAGACTATCGAGGCTAGG + Intergenic
1187596001 X:20773217-20773239 TTGTAAAGACCTTCGATGCTAGG + Intergenic
1187635478 X:21223333-21223355 TTGTAAAGACCAACGACGCTAGG - Intergenic
1187848313 X:23564754-23564776 TTGTAAAGACTATCGATGCTAGG - Intergenic
1189004515 X:36982107-36982129 TTGCAAACACACACAAAGCTGGG + Intergenic
1189044458 X:37575437-37575459 TTGCAAACACACACAAAGCTGGG - Intronic
1189969653 X:46405237-46405259 ATCTAAACACTTAGAAAGCTTGG - Intergenic
1190590468 X:51995389-51995411 TTGTAAACACCATCGAGGCTAGG - Intergenic
1190593016 X:52024522-52024544 TTGTAAACACCATCGAGGCTAGG - Intergenic
1191070144 X:56392567-56392589 TTGTAAGGACTTTCGAGGCTAGG - Intergenic
1191072743 X:56419655-56419677 TTGTAAAGACCATCGAAGCTAGG - Intergenic
1191129905 X:56996149-56996171 TTCTAAGCTCTTACAAAGCTTGG + Intergenic
1191161368 X:57332866-57332888 TTGTAAAACCTTACTAAGTTAGG - Intronic
1191173047 X:57469152-57469174 TTGTAAAGACCTTCAAAGCTAGG + Intronic
1191592672 X:62905270-62905292 TTGTAAACACCATCGAGGCTAGG - Intergenic
1191647170 X:63494143-63494165 TTGTAAAGACTATCGAGGCTAGG + Intergenic
1191968991 X:66793127-66793149 TTGTAAAGACCTTCGAGGCTAGG - Intergenic
1194862037 X:99011413-99011435 TTGTAAGCACTGAGGAAGCAGGG - Intergenic
1197961570 X:132011940-132011962 TTGTAAACACTATATAAGCTTGG - Intergenic
1198098571 X:133404082-133404104 TTGTAAACATTTACCAAACTAGG - Intronic
1198646029 X:138807497-138807519 TTGTAAAGACTATCGATGCTAGG + Intronic
1198689205 X:139261573-139261595 TTGTAAAGACCTTCGAGGCTAGG + Intergenic
1198926576 X:141803330-141803352 TTGTAAAGACCATCGAAGCTAGG - Intergenic
1199074620 X:143513663-143513685 CTGTAAACACTTCCGATTCTAGG + Intronic
1201664057 Y:16428972-16428994 TTGTAAAGACTATCGAGGCTAGG + Intergenic
1202089129 Y:21170874-21170896 TTGTAAAGACCTTCAAAGCTAGG - Intergenic
1202374742 Y:24223926-24223948 TTGTAAAGACCTTCGAGGCTAGG + Intergenic
1202496038 Y:25446194-25446216 TTGTAAAGACCTTCGAGGCTAGG - Intergenic