ID: 1018255192

View in Genome Browser
Species Human (GRCh38)
Location 6:161911541-161911563
Sequence ACAGAGACATTATCCAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 297}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018255192_1018255197 30 Left 1018255192 6:161911541-161911563 CCAACCCTGGATAATGTCTCTGT 0: 1
1: 0
2: 0
3: 22
4: 297
Right 1018255197 6:161911594-161911616 ATCTGCTATTCAACATATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018255192 Original CRISPR ACAGAGACATTATCCAGGGT TGG (reversed) Intronic
900015343 1:145112-145134 AAAGAGACATTAGCCAGGTGTGG + Intergenic
900045609 1:503706-503728 AAAGAGACATTAGCCAGGTGTGG + Intergenic
900067809 1:745421-745443 AAAGAGACATTAGCCAGGTGTGG + Intergenic
900973003 1:6001724-6001746 ACAGAGAAATGATCCAGTGTGGG + Intronic
901777164 1:11568121-11568143 ACAAAAAAATTATCCAGGCTTGG - Intergenic
901866761 1:12111613-12111635 ACAGAGCCATGAGACAGGGTTGG + Intronic
904516718 1:31061458-31061480 ACACAGAAATTAGCCAGGCTTGG + Intronic
905145138 1:35882651-35882673 ACTGTGACATCTTCCAGGGTAGG + Intronic
905245250 1:36608434-36608456 AGAGGGACATTCTCCTGGGTGGG + Intergenic
907495947 1:54844809-54844831 ACAAAAACATTATCCAGGCGTGG - Intergenic
910033431 1:82760407-82760429 ACAGAAACATTTTTCAGTGTTGG + Intergenic
910752968 1:90654344-90654366 AAAGGGAAATTATCCTGGGTGGG - Intergenic
916029467 1:160863445-160863467 ATAGAGAAATTAGCCAGGCTGGG + Intergenic
918385879 1:184006746-184006768 ACAATGATATTATGCAGGGTTGG - Intronic
922263492 1:223963312-223963334 AAAGAGACATTAGCCAGGTGTGG + Intergenic
923276347 1:232400223-232400245 GGAGAGTCAGTATCCAGGGTGGG - Intronic
923496395 1:234529285-234529307 AAAGAGAGATTATCCTGGGTGGG + Intergenic
923527267 1:234782157-234782179 ACAGTGTCATTATCAAGGGGTGG - Intergenic
923677102 1:236089354-236089376 ACAAAGACATTAGCCAGGCGTGG + Intergenic
1063154890 10:3369741-3369763 ACAGAAAAATTAGCCAGGTTTGG + Intergenic
1063508933 10:6627718-6627740 ACAGAGACACCAACCAGGGGAGG - Intergenic
1065433183 10:25680651-25680673 ACAGAGTCATAAACCAGAGTTGG + Intergenic
1065859049 10:29855627-29855649 ACAGAAACGTTATCCAGGCGTGG - Intergenic
1066018912 10:31276954-31276976 AAAGAGAGATTATCCTGGTTGGG + Intergenic
1067273964 10:44818479-44818501 AGAGGGACATAATCCAGGCTGGG - Intergenic
1067558437 10:47288013-47288035 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1068194597 10:53699318-53699340 TAAGGGAGATTATCCAGGGTGGG - Intergenic
1068430914 10:56931283-56931305 AGGGAGACATTATCCAGAGCAGG - Intergenic
1068692302 10:59929504-59929526 AAACAGACATTATCAAGTGTTGG + Intergenic
1070011517 10:72479679-72479701 ATAGAAAAATTATCCAGGCTTGG - Intronic
1071083281 10:81838501-81838523 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1071562963 10:86657466-86657488 ACAGAGACAGTGTGCAGGGCAGG + Intronic
1072491096 10:95906790-95906812 ACAGAGACTATAGACAGGGTGGG + Intronic
1074401562 10:113145170-113145192 ACAGAAACTATACCCAGGGTTGG - Intronic
1074570021 10:114615865-114615887 TCAGAGAGCTTAGCCAGGGTTGG - Intronic
1074705731 10:116128568-116128590 ACAAAAACATTAGCCAGGCTTGG + Intronic
1074911310 10:117911876-117911898 AAAGAGAGATTATCCTGGGTGGG - Intergenic
1076971935 11:140180-140202 AAAGAGACATTAGCCAGGTGTGG + Intergenic
1077591088 11:3491529-3491551 AAAGGGAGATTATTCAGGGTGGG + Intergenic
1078267922 11:9768795-9768817 ACCAAGACATTATCCTGGATCGG - Intergenic
1078553695 11:12300427-12300449 AAAGAGAGATTGTCCTGGGTGGG + Intronic
1081039160 11:38189406-38189428 TAAGAGAGATTATCCTGGGTGGG - Intergenic
1084246801 11:67863280-67863302 AAAGGGAGATTATTCAGGGTGGG + Intergenic
1084825878 11:71731212-71731234 AAAGGGAGATTATTCAGGGTGGG - Intergenic
1085798328 11:79564272-79564294 ACAGAGAGAATATTCAAGGTGGG + Intergenic
1085989774 11:81827878-81827900 ACAGAGAAATTAGCCAGGCATGG - Intergenic
1087303211 11:96459280-96459302 TCAAAGCCATTATTCAGGGTTGG - Intronic
1088938293 11:114426448-114426470 ACTGAGACACTAGCCAGGGCAGG - Intronic
1089473398 11:118738998-118739020 ACAGAGAAATTAGCCAGGTGTGG + Intergenic
1089676036 11:120090387-120090409 ACACAGACAGTATCCAAGGATGG + Intergenic
1090053514 11:123401751-123401773 ACAAAGAAATTAGCCAGGGGTGG + Intergenic
1090374423 11:126278908-126278930 ACAGACACCTCACCCAGGGTGGG + Intergenic
1091157800 11:133389946-133389968 ACAGAAACATGCTCCAGGGATGG - Intronic
1091277777 11:134364031-134364053 ACAAAAAAATTAGCCAGGGTTGG - Intronic
1091293664 11:134457311-134457333 ACAGAGACCTTATGCAAGGGTGG - Intergenic
1091392717 12:135620-135642 AAAGAAACATCACCCAGGGTGGG + Intronic
1091396089 12:155028-155050 ACAGTGACACTGTCCAGGGCTGG - Intronic
1097017651 12:55998668-55998690 ACAGAAAAATTAGCCAGGCTTGG + Intronic
1097053861 12:56238793-56238815 ACAAGGAGATTGTCCAGGGTGGG + Exonic
1098491318 12:71083273-71083295 AAAGAGACAGAATTCAGGGTGGG + Intronic
1099054865 12:77826775-77826797 AGTGAGACATTATCTACGGTAGG + Intergenic
1099715199 12:86284127-86284149 GCAAATACACTATCCAGGGTTGG + Intronic
1100833026 12:98536507-98536529 ATACAAACATTAGCCAGGGTTGG - Intronic
1101525593 12:105526072-105526094 ACATAGACAATATCAAGTGTTGG - Intergenic
1102605205 12:114063171-114063193 ACAAATACATTCTCAAGGGTGGG - Intergenic
1106328439 13:28717008-28717030 AAAGAGATAGTATCCAGGTTTGG - Intronic
1108418446 13:50224801-50224823 ACAGAGCCGTTCTCTAGGGTTGG + Intronic
1108481140 13:50873087-50873109 AAAGTGACATTATCCAGATTTGG + Intergenic
1108646036 13:52429504-52429526 AAAGAGGCATTATCCACGGTGGG - Intronic
1108669059 13:52663622-52663644 ACAGAGTAATTAGCCAGGCTTGG - Intronic
1110733248 13:78905450-78905472 ACAGGGAGATTATCCTGGGTGGG + Intergenic
1112377543 13:98857442-98857464 ACAAAAAAATTAGCCAGGGTTGG - Intronic
1113949276 13:114062370-114062392 AAAGAGACAGTAACAAGGGTAGG + Intronic
1114725457 14:24931738-24931760 ACAGTCACATTATCCAGCCTTGG - Intronic
1114738224 14:25065147-25065169 ACAGAAAAATTATCCAGGTGTGG - Intergenic
1115654160 14:35427223-35427245 ACAGAGACTTGTTCCTGGGTGGG - Intergenic
1117013173 14:51491367-51491389 ACTCAGACATTTTCCAGAGTGGG - Intronic
1120540893 14:85749042-85749064 AAAGAGAGATTATTCTGGGTGGG + Intergenic
1120592477 14:86391772-86391794 ACAGAGAAATTATTCAGGAAAGG - Intergenic
1124660817 15:31549557-31549579 AAAGGGAGATTATCCTGGGTTGG + Intronic
1125326272 15:38538773-38538795 ACAGAGAGATAATCCAGAGATGG + Intronic
1125452646 15:39825049-39825071 AAAGAAAAATTATCCAGGCTTGG + Intronic
1126781549 15:52143278-52143300 ACAGAGAAATTACTCAGGATGGG - Intronic
1127489946 15:59453110-59453132 AAAGGGACATTAGCCAGGGAAGG + Intronic
1127737579 15:61858541-61858563 ACAGAGATATATACCAGGGTTGG - Intronic
1128715452 15:69904518-69904540 ACAGAGACACTATCCCTGGCAGG - Intergenic
1129200831 15:73998178-73998200 AAAAAGACGTTATCCAGGGCGGG - Exonic
1132103841 15:99048679-99048701 ACAAAAATATTAGCCAGGGTAGG + Intergenic
1133356467 16:5140560-5140582 AAAGGGAGATTATTCAGGGTGGG + Intergenic
1133488876 16:6247918-6247940 CCAGAGCCATTAACCAGTGTTGG - Intronic
1134890233 16:17835022-17835044 ACAGAGGCTGTATCCAAGGTAGG - Intergenic
1135696896 16:24596234-24596256 ACACAAACATTAGCCAGGGGTGG + Intergenic
1138217522 16:55217601-55217623 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1139004994 16:62559178-62559200 AGAGAGACACTAGCCAGGGCAGG - Intergenic
1139482806 16:67240053-67240075 ACAGACACACTCTCCCGGGTGGG - Intronic
1140429864 16:74893214-74893236 ACAGAGAGACTATCCTGGGTGGG + Intronic
1141484796 16:84331634-84331656 AGAGAGTTATGATCCAGGGTGGG + Intergenic
1142448311 16:90157343-90157365 AAAGAGACATTAGCCAGGTGTGG - Intergenic
1142459175 17:77982-78004 AAAGAGACATTAGCCAGGTGTGG + Intergenic
1144932435 17:18870651-18870673 ATAAAGAAATTAGCCAGGGTTGG + Intronic
1146027770 17:29337639-29337661 ACAGAAAAATTAGCCAGGGATGG - Intergenic
1146096866 17:29938489-29938511 ACAGAGAAATTATCCAAGACAGG - Intronic
1146542037 17:33704467-33704489 AGAGAGACAGAATTCAGGGTGGG - Intronic
1148453659 17:47798376-47798398 ACAGAAACATTATCAAGGCCTGG + Intergenic
1149092930 17:52805312-52805334 AAAGAGGCATTATGGAGGGTGGG - Intergenic
1149609575 17:57950304-57950326 ACAAAAAAATTATCCAGGTTTGG - Intronic
1150557053 17:66263710-66263732 ACAAAAACATTATCCAGGCATGG + Intergenic
1150792559 17:68210338-68210360 ACAGATACATTATTCAGCCTTGG + Intergenic
1151266834 17:72963027-72963049 AAAGGGAGATTATCCTGGGTGGG - Intronic
1151445849 17:74163304-74163326 ACACACACATGTTCCAGGGTGGG - Intergenic
1151854987 17:76714582-76714604 ACAGAGACAGTAACGGGGGTTGG + Exonic
1152159095 17:78656107-78656129 ACAAAAACATTAGCCAGGCTTGG + Intergenic
1156088998 18:33442315-33442337 AAAGGGAGATTATCCAGGATGGG + Intergenic
1156329853 18:36110692-36110714 ACAAAAAAATTAACCAGGGTTGG - Intronic
1156619784 18:38835877-38835899 ACAGAAAGATTAACCAGGGTTGG - Intergenic
1157451578 18:47793300-47793322 ACACAAAAATTAGCCAGGGTTGG + Intergenic
1158670678 18:59470983-59471005 CCAGAGACAGTTTGCAGGGTTGG - Intronic
1158691297 18:59663575-59663597 ACAGAGACATCCTCCTGGCTTGG - Intronic
1159088026 18:63816775-63816797 ACAAAGAAATTAGCCAGGCTTGG - Intergenic
1159223102 18:65491376-65491398 ACAGAGACATTATCCTAATTAGG + Intergenic
1159406228 18:68006380-68006402 AAAGGGAGATTATCCTGGGTGGG - Intergenic
1159892059 18:73962241-73962263 AAAGAGAGATTATCCTGGGAGGG - Intergenic
1160052215 18:75444642-75444664 ACTGACACATTATACAGAGTTGG + Intergenic
1160648893 19:210488-210510 AAAGAGACATTAGCCAGGTGTGG + Intergenic
1163026753 19:14517356-14517378 AAAGACACATGGTCCAGGGTCGG + Intronic
1163411883 19:17160054-17160076 ACAGAGAAAACATCCAGGCTGGG - Intronic
1164142844 19:22488580-22488602 AAAGAGACATTATCCTGATTGGG + Intronic
1164231593 19:23293780-23293802 CCAGAGTCATTTTCCAGGCTGGG - Intergenic
1164247735 19:23448298-23448320 CCAGAGTCATTTTCCAGGCTGGG - Intergenic
1165209074 19:34218157-34218179 ACAGAAACATTAGCCAGGCGTGG - Intronic
1165422411 19:35728802-35728824 GCATAGACATGATCCAGGGATGG - Exonic
1165997713 19:39856367-39856389 ACAGGGAGATTATCCTGGATTGG - Intergenic
1166057293 19:40299733-40299755 AGAGAGACATTAGCCAGGCACGG + Intergenic
1166103627 19:40586714-40586736 ACAGAGACAGAAACCAGGGCAGG - Intronic
1166380069 19:42351113-42351135 ACAGGGACAGTCTGCAGGGTGGG + Intronic
1166967499 19:46538418-46538440 ACAGAAAAATTATCCAGGTGTGG - Intronic
1168251070 19:55142274-55142296 ACAGAAAAATTAGCCAGGCTTGG - Intronic
1168428545 19:56258557-56258579 ACAGACACACTTTCCAGTGTAGG + Intronic
1168491955 19:56818381-56818403 AAAGATACATTGTACAGGGTGGG - Intronic
927155362 2:20218096-20218118 AGAGAGACCTTATCCTGGGAAGG - Intronic
927952245 2:27179773-27179795 ACAAAAAAATTATCCAGGCTAGG - Intergenic
928152708 2:28846419-28846441 ACAAAAACATGATCCAGTGTAGG + Intronic
929102924 2:38334183-38334205 ACAGAAAAATTAGCCAGGGGTGG - Intronic
931286820 2:60839346-60839368 ACAGAATCTTTATCCAGGGATGG + Intergenic
931288426 2:60851569-60851591 ACAGGCACATTATCCACTGTAGG - Intergenic
933552837 2:83795886-83795908 ACAGAGCCATTATTCAGACTTGG + Intergenic
933894550 2:86798815-86798837 AAAGATACATTATGCAGGCTGGG - Intronic
936017461 2:108970580-108970602 ACACAGAGAATAACCAGGGTGGG + Intronic
936706435 2:115080171-115080193 ACACAGAAATTAGCCAGGCTTGG - Intronic
938713127 2:133992669-133992691 ACAGACACATGCTCCAGGGTTGG - Intergenic
938941513 2:136173516-136173538 ACAGAGACTTCATCCAGAGCTGG + Intergenic
939930838 2:148231039-148231061 ACTGAGACACCAGCCAGGGTGGG - Intronic
941046473 2:160681434-160681456 ACAGAGAGAATAACCAGTGTTGG - Intergenic
942666715 2:178327379-178327401 CCAGAGATATTATCCATGGATGG + Intronic
943682680 2:190784817-190784839 AAAGGGAAATTATCCTGGGTGGG + Intergenic
943696847 2:190945507-190945529 ACAAAGAAATCATCCAGGTTTGG + Intronic
943712045 2:191107988-191108010 AGAAAGACATTATCCATTGTTGG + Intronic
944423868 2:199558767-199558789 AAAGAGATATTATCCAAGTTTGG - Intergenic
945982973 2:216329223-216329245 ACAAAGAAATTAGCCAGGCTTGG + Intronic
947269323 2:228316348-228316370 ACTGAGACATGATCCAGAGTTGG - Intergenic
949015064 2:241704236-241704258 ACAGAGACAGAATACAGAGTGGG + Intronic
1169840078 20:9926211-9926233 ACAGTTCCATTAGCCAGGGTTGG + Intergenic
1172233267 20:33351559-33351581 ACAGAGAAATTAGCCAGGTGTGG - Intergenic
1172934976 20:38613580-38613602 CCAGAGACCTTCTCCAGGGCAGG - Intronic
1172935771 20:38619071-38619093 GCAGAGACGTAATCCAGGTTAGG + Intronic
1173472754 20:43336445-43336467 ATACAGAAATTATCCAGGGGTGG + Intergenic
1173988644 20:47282567-47282589 ACAGAAACATTAACCAGGCGTGG + Intronic
1174165908 20:48583512-48583534 ACAGTGACATTCGCCTGGGTGGG - Intergenic
1174294303 20:49533803-49533825 ACAAACACATTATCCGGGGGTGG + Intronic
1176895233 21:14369688-14369710 ACATGGATATTATCCAGGTTTGG + Intergenic
1178167844 21:30002314-30002336 ACAGAGAAATTATCCATCTTAGG - Intergenic
1181617353 22:24064149-24064171 ACAGAGTCATTATGGAGGTTGGG - Exonic
1182095705 22:27623890-27623912 ACAGAAACGTTATCCAGTGTTGG - Intergenic
1182926034 22:34126232-34126254 ACAAAAACATTATCCAGGCTTGG + Intergenic
1183100626 22:35581699-35581721 ATAGGGACATTATCCTGGATTGG - Intergenic
1183119812 22:35721699-35721721 ACTCAGACATTATCATGGGTTGG - Intronic
1183728378 22:39602225-39602247 AAAGAAAAATTAGCCAGGGTTGG - Intronic
1183923094 22:41184881-41184903 AAAGAAACATTAGCCAGGCTTGG - Intergenic
1184940117 22:47758346-47758368 GCCGAGACAATATCCATGGTTGG + Intergenic
1185416575 22:50713908-50713930 ACAGAGTCAGTGTACAGGGTGGG + Intergenic
950210923 3:11122505-11122527 ACAGCGACATGATGCATGGTGGG - Intergenic
951658428 3:25035275-25035297 ATACAAAAATTATCCAGGGTTGG - Intergenic
955414997 3:58683937-58683959 ACAGAGAGATTATCCTCAGTGGG - Intergenic
956401367 3:68883402-68883424 AAAGAGAGACTATCCTGGGTGGG - Intronic
956540121 3:70327402-70327424 CCAGAGAGATTTTACAGGGTTGG + Intergenic
957021496 3:75133280-75133302 ACAGAAACATTAGCCAGGCGTGG + Intergenic
957061111 3:75482029-75482051 AAAGGGAGATTATTCAGGGTGGG + Intergenic
957915672 3:86685326-86685348 ACAGAAACATTAGCCAGGCATGG + Intergenic
958749795 3:98181864-98181886 ATAGAAAAATTACCCAGGGTTGG + Intronic
958757912 3:98272135-98272157 ACTGAGACATCGTCCAGGGTGGG - Intergenic
958991284 3:100848787-100848809 AAAGAGACATTTACCAGGTTTGG + Exonic
961292274 3:125857387-125857409 AAAGGGAGATTATTCAGGGTGGG - Intergenic
961544609 3:127623688-127623710 ACAGAGAAATGATCCAGGCTGGG + Intergenic
961894922 3:130159014-130159036 AAAGGGAGATTATTCAGGGTGGG + Intergenic
962103795 3:132369993-132370015 ACACCGACCTTATACAGGGTTGG + Intergenic
963686579 3:148442566-148442588 AAAGGGAGATTATCCTGGGTTGG - Intergenic
963921570 3:150910651-150910673 AAAGGGAGATTATCCTGGGTGGG - Intronic
964543991 3:157812429-157812451 AAAGTGACAATATCAAGGGTTGG - Intergenic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
965784973 3:172325977-172325999 ACAAAGACATTACCCAGGCGTGG - Intronic
967518862 3:190404440-190404462 AATGAGACATTTTCCAGAGTAGG + Intronic
968368957 3:198209639-198209661 AAAGAGACATTAGCCAGGTGTGG - Intergenic
969253045 4:5982553-5982575 ACAGAGACATCATCCAGTTGGGG + Intronic
969747845 4:9088081-9088103 AAAGGGAGATTATTCAGGGTGGG - Intergenic
969808886 4:9632614-9632636 AAAGGGAGATTATTCAGGGTGGG - Intergenic
970224100 4:13839204-13839226 ATAGAGAGATTATTCTGGGTTGG - Intergenic
970423107 4:15923327-15923349 ACACAGAAATTAGCCAGGGTTGG - Intergenic
972486975 4:39551062-39551084 ACAGAAAAATTAGCCAGGGTTGG - Exonic
972652222 4:41029182-41029204 ACAGTGACATTCCTCAGGGTAGG - Intronic
972697747 4:41464529-41464551 ACACAAAAATTAGCCAGGGTGGG - Intronic
972869588 4:43280690-43280712 AAAGAGAGATTATCCTGTGTGGG - Intergenic
973139605 4:46750236-46750258 ACACACACATTATCCAGGTGTGG + Intronic
973987753 4:56372089-56372111 AAAGGGAGATTATCCAGGGTTGG + Intronic
974172519 4:58284291-58284313 ACAGAAAAATTATCCAGGTGTGG - Intergenic
974530909 4:63107060-63107082 ACAGAGACATTGAAGAGGGTAGG + Intergenic
974680371 4:65153273-65153295 ACAGACACATTACTCAGGGCCGG - Intergenic
978586228 4:110278634-110278656 AAAAAGACATTACACAGGGTTGG + Intergenic
978787153 4:112622601-112622623 ACAGACAGATTTTACAGGGTCGG - Intronic
978843004 4:113236664-113236686 ACAGAGGCATTATTTAGGATTGG + Intronic
979096719 4:116560063-116560085 ATAGAAAAATTATCCAGGGGTGG + Intergenic
979411066 4:120380356-120380378 AAAGGGAGATTATCCTGGGTGGG - Intergenic
979448898 4:120845480-120845502 ACAGTGCCATCATCCAGGCTTGG - Intronic
982060805 4:151602493-151602515 ACAGAGAAAGTAGCCAGGGCAGG + Intronic
983997309 4:174198987-174199009 ACAGATGCATTAACCAGGCTTGG + Intergenic
984098448 4:175460456-175460478 ACAGTGACATTTTCCACGATGGG + Intergenic
985321153 4:188712637-188712659 AAAAATACATTATCCAGTGTTGG + Intergenic
985335495 4:188888598-188888620 ACAATGAAATCATCCAGGGTTGG - Intergenic
986122877 5:4858168-4858190 ACAGTGTCATTTTCCAGAGTAGG - Intergenic
986180262 5:5386470-5386492 ATACAGAGATTATCCTGGGTGGG + Intergenic
986725843 5:10595765-10595787 CCAGAGAAAATGTCCAGGGTTGG - Intronic
989433781 5:41386612-41386634 AAAGAGAGATTATCCTGAGTGGG + Intronic
990219100 5:53567002-53567024 ACAAAGAAATTATCCAGGCGTGG - Intronic
992412136 5:76516029-76516051 ACACAAACATTATCCAGGCATGG - Intronic
992905198 5:81338923-81338945 ACACAAAAATTATCCAGGGGTGG + Intronic
994681519 5:102893740-102893762 ACAGAAATAGTTTCCAGGGTTGG + Intronic
995623987 5:114056652-114056674 AAAGAAACATTCTCCTGGGTGGG + Intergenic
998582815 5:143398470-143398492 AAAGAGACATCCTCCAGGTTAGG + Intronic
1000863188 5:166481176-166481198 ATAGAGATATTATCCAGGCCTGG - Intergenic
1002709505 5:181186152-181186174 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1002728233 5:181315204-181315226 AAAGAGACATTAGCCAGGTGTGG - Intergenic
1002848078 6:966711-966733 ACAAAAACATTATCCAGGCGTGG - Intergenic
1004227897 6:13804165-13804187 ACAGAAAAATTATCCAGGTGTGG + Intronic
1004594726 6:17088320-17088342 AAGGAGATATTATCCTGGGTGGG + Intergenic
1004910416 6:20277580-20277602 ACAGGAACATGACCCAGGGTGGG + Intergenic
1005361851 6:25038440-25038462 AAAGAGAGATTATCCTGGGTGGG + Intronic
1006558803 6:34891081-34891103 ACAGAGACATCATTTAGGGATGG + Intronic
1006648627 6:35532997-35533019 AAAGAGAAATAATCCAGGGATGG - Intergenic
1006716442 6:36123678-36123700 ACAGAGTCATTGTCCAGAGGTGG + Intergenic
1007110250 6:39309537-39309559 ACAGAGGCATAATCCAAGCTAGG + Intronic
1010388059 6:75305123-75305145 AAGGAAACATTATCCAGGTTGGG + Intronic
1010486264 6:76418135-76418157 AAAGTGAAATTATCCTGGGTGGG + Intergenic
1015208820 6:130672312-130672334 AAAAAGAGATTATCCTGGGTGGG + Intergenic
1018255192 6:161911541-161911563 ACAGAGACATTATCCAGGGTTGG - Intronic
1019821118 7:3243491-3243513 AGGGAGACATTGCCCAGGGTAGG - Intergenic
1020325154 7:6968553-6968575 AAAGGGAGATTATTCAGGGTGGG + Intergenic
1020565840 7:9794478-9794500 AAAGGGATATTATCCTGGGTGGG + Intergenic
1020666655 7:11052589-11052611 ACAGAAACATTATCCATTGCTGG - Intronic
1020798763 7:12707702-12707724 GCAGAGACCTCATCCAGGGTTGG + Intergenic
1021014216 7:15512406-15512428 ACAGAAACATTAGCCAGGCATGG - Intronic
1022241392 7:28516056-28516078 ATAAAAAAATTATCCAGGGTTGG + Intronic
1024535934 7:50433176-50433198 ATAGTGACATTACCCAGTGTTGG - Intergenic
1025019063 7:55466546-55466568 CCAGAGAAATTTTCCAAGGTGGG + Intronic
1025265680 7:57454868-57454890 ACAGAAACATTAGCCAGGCGTGG + Intronic
1026303535 7:69120083-69120105 ACAAAAAAATTATCCAGGGGTGG + Intergenic
1026501666 7:70947916-70947938 ACAGTGACATCATGTAGGGTTGG + Intergenic
1026653177 7:72233561-72233583 ACAGAAACATTAGCCAGGAGTGG + Intronic
1028750321 7:94375643-94375665 ACAGAGGCATTAAACAGTGTTGG + Intergenic
1029905846 7:104092932-104092954 ACTGAAAGATTATCAAGGGTGGG - Intergenic
1030481051 7:110104104-110104126 AAAAACACATTATCCAGGGGTGG + Intergenic
1030621341 7:111794496-111794518 AAAGAGACATGGTGCAGGGTAGG + Intronic
1031193224 7:118581840-118581862 AGAAAGAAATCATCCAGGGTAGG + Intergenic
1031319291 7:120302413-120302435 ACAGAGAAATTAGCCAGGCCTGG - Intronic
1033948893 7:146759358-146759380 ACAGAGACATTAGAAAGGGGAGG + Intronic
1036370910 8:8162276-8162298 AAAGAGAGATTATTCAGGGTGGG - Intergenic
1036423213 8:8617421-8617443 ACAGATACATTATTTATGGTTGG - Intergenic
1036879984 8:12503360-12503382 AAAGAGAGATTATTCAGGGTGGG + Intergenic
1037503535 8:19507781-19507803 ACAAAAACATTAGCCAGGGGTGG - Intronic
1039189074 8:34951853-34951875 AAAGAGGAATTATCCAGGGCAGG + Intergenic
1039311413 8:36321639-36321661 ACAGAAAAATTAGCCAGGGGTGG + Intergenic
1040542369 8:48371901-48371923 ACAGAGGCATTAGCCTGGCTTGG + Intergenic
1040645186 8:49389110-49389132 AAAGGGACATTATCCAGGTGAGG + Intergenic
1041568375 8:59306875-59306897 ACAGAAACATTTTTCAGGGTGGG - Intergenic
1042428456 8:68676176-68676198 ACAGAAAAATTATCCAGGTGTGG + Intronic
1045465719 8:102468105-102468127 ACAAAAAAATTATCCAGGGATGG - Intergenic
1046593101 8:116229056-116229078 ACAAAGAAATTATCCAGGCATGG - Intergenic
1046797643 8:118390160-118390182 ACAAAAACATTATCCAGGCATGG - Intronic
1048086099 8:131181537-131181559 AAAGAGACAATCTACAGGGTAGG - Intergenic
1048603893 8:135947610-135947632 GCAGAGAGATTATCCTTGGTGGG - Intergenic
1050483609 9:6111379-6111401 ACATGAACATTACCCAGGGTAGG - Intergenic
1050761055 9:9071366-9071388 AGAGGGAAATTATCCTGGGTGGG + Intronic
1051724346 9:20073350-20073372 AAAGAGACATTATTCTGAGTGGG - Intergenic
1052052919 9:23868165-23868187 GCATAGATGTTATCCAGGGTTGG - Intergenic
1055326481 9:75135998-75136020 AAAGGGACATTATCCCAGGTGGG - Intronic
1055554533 9:77461286-77461308 TCAGAGTCATTATCTGGGGTGGG - Intronic
1056364511 9:85890166-85890188 ACAGATTCCTTATCCAGGGGGGG - Intergenic
1057410023 9:94809885-94809907 ACTGAGTCAGTCTCCAGGGTAGG - Intronic
1057938751 9:99262254-99262276 AAAGAGACATTCTCCAGGGGAGG + Intergenic
1059343180 9:113611154-113611176 ACAGTGACATTCTCCAGGACTGG + Intergenic
1059585905 9:115606016-115606038 ATAGGGAGATTATCCTGGGTAGG + Intergenic
1059589532 9:115643332-115643354 ACAGAGACATGATCAAGAGAGGG - Intergenic
1060149658 9:121280162-121280184 GCAGAGAAATTTTCCAGTGTGGG + Intronic
1061537003 9:131256591-131256613 ACAGGCTCATCATCCAGGGTGGG - Intergenic
1062753298 9:138272345-138272367 AAAGAGACATTAGCCAGGTGTGG - Intergenic
1203575810 Un_KI270745v1:7122-7144 AAAGAGACATTAGCCAGGTGTGG - Intergenic
1186075737 X:5876399-5876421 ACACAAACATTAGCCAGGCTTGG + Intronic
1186388117 X:9130637-9130659 ACAGAGACTTTGTCAAGGATAGG + Intronic
1187084076 X:16023566-16023588 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1189364497 X:40377857-40377879 AAAGGGAGATTATCCTGGGTGGG + Intergenic
1189869339 X:45366161-45366183 AAACAGATATTATCCTGGGTGGG + Intergenic
1192192694 X:69001953-69001975 ACACAGAAAGTATCCAGGGAAGG + Intergenic
1193070516 X:77301122-77301144 GCTGAGACATTCTACAGGGTGGG - Intergenic
1193077658 X:77372486-77372508 ACAGAGATTTTGTCCACGGTAGG + Intergenic
1193432762 X:81431107-81431129 ACAGAGAAATTATCCAAGAGAGG + Intergenic
1194050719 X:89064650-89064672 ACATATACATTATGCAGGGCTGG + Intergenic
1194067425 X:89278452-89278474 ACAGAGAAATGATTCAGGATAGG + Intergenic
1195475197 X:105277461-105277483 ACAAAGATGTCATCCAGGGTGGG - Intronic
1196813152 X:119644531-119644553 AAAGAGACATCATGCAGTGTTGG - Intronic
1198597443 X:138251988-138252010 AAAGAGAAATTATTCTGGGTGGG - Intergenic
1199545834 X:149006658-149006680 ACACAGAGATTATTCTGGGTGGG - Intergenic
1199725664 X:150578088-150578110 AAAGAGAAGTTATCCTGGGTAGG + Intronic