ID: 1018255463

View in Genome Browser
Species Human (GRCh38)
Location 6:161913949-161913971
Sequence GCCGATTGGAAACCTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018255463_1018255468 -6 Left 1018255463 6:161913949-161913971 CCCTCACCAGGTTTCCAATCGGC 0: 1
1: 0
2: 0
3: 7
4: 85
Right 1018255468 6:161913966-161913988 ATCGGCTGGAGCCTTCGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018255463 Original CRISPR GCCGATTGGAAACCTGGTGA GGG (reversed) Intronic
903985257 1:27222832-27222854 GCAGATTTGAAGTCTGGTGAAGG + Intergenic
905336906 1:37250972-37250994 GCAGATTGGATGTCTGGTGAGGG - Intergenic
906328204 1:44862057-44862079 GCCAATTGGCAACCTAGAGAGGG - Intronic
910523900 1:88155656-88155678 GCAGATTGGAAACGTAGGGAGGG - Intergenic
918281441 1:183010253-183010275 GCCAATTGGATTCCTGGTGAGGG + Intergenic
922369722 1:224897144-224897166 GCAGATTGGCTATCTGGTGAGGG - Intronic
923544983 1:234917593-234917615 GCTGATTGGGGCCCTGGTGAGGG + Intergenic
1076735047 10:132455189-132455211 GCCCATGGGAAACCTGGTCAAGG - Intergenic
1077173244 11:1177663-1177685 GCCGGCTGGAAACCTGGAGGTGG + Intronic
1087097154 11:94330156-94330178 GCAGATTGGGCATCTGGTGATGG + Intergenic
1088112988 11:106283175-106283197 GCAGATTGGACGTCTGGTGAGGG - Intergenic
1090802268 11:130180289-130180311 GCCCCTTGGAATCCTGGGGAGGG - Intronic
1097195186 12:57239124-57239146 GCGGATTGGGATCCTGGTGCGGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1105031144 12:132884729-132884751 GCAGATTGGGTTCCTGGTGAGGG - Intronic
1105733809 13:23247034-23247056 GGCTTTTGGAAACCTAGTGAGGG - Intronic
1113035857 13:106047825-106047847 GCAGATTGGATGCCTGGTGAGGG - Intergenic
1116955313 14:50917200-50917222 GCCCATTGGACATCTGCTGAGGG + Intronic
1118493249 14:66282152-66282174 GCCGCTTGCCAGCCTGGTGATGG - Intergenic
1119128827 14:72153232-72153254 GCCCTTTGGAAACCTGGTATTGG + Intronic
1124042363 15:26117267-26117289 GCCTATGAGAAACCTGGGGAGGG - Intergenic
1125698573 15:41660291-41660313 GCCGTTTGGACTCCTGGTGTTGG + Intronic
1128221473 15:65971715-65971737 GCCAATTGGACACCTGGGGGTGG - Intronic
1134798626 16:17064684-17064706 ATCGAGTGGAACCCTGGTGAAGG + Intergenic
1135974287 16:27097202-27097224 GCAGATTTGATATCTGGTGAGGG + Intergenic
1136502346 16:30678509-30678531 GCAGATTGGAATCCAGGCGAGGG + Intergenic
1142068709 16:88077483-88077505 GCCGAGGGGAAACCTGGTTTAGG + Intronic
1150188664 17:63214560-63214582 GCAGATTTGATATCTGGTGAGGG + Intronic
1156120071 18:33832528-33832550 GCTGATTTGATTCCTGGTGATGG + Intergenic
1165246344 19:34500483-34500505 TCCAAGTGGAAAGCTGGTGATGG - Exonic
1167211991 19:48139268-48139290 GCAGCTTGGGACCCTGGTGAGGG - Intronic
925139879 2:1542865-1542887 GCCCTGTGGACACCTGGTGATGG - Intronic
925842133 2:8002233-8002255 GCCAATTTGACTCCTGGTGAGGG - Intergenic
929542232 2:42831267-42831289 GCCAATAGGGAACCTGGGGAAGG + Intergenic
934609796 2:95726648-95726670 GCAGATTGGATATCTGGTGAGGG + Intergenic
935873939 2:107485786-107485808 GAAGATTGGGCACCTGGTGAAGG - Intergenic
936543119 2:113368218-113368240 GCAGATTGGATATCTGGTGAGGG + Intergenic
937462519 2:122101737-122101759 GCTGATTTGGCACCTGGTGAAGG + Intergenic
938082343 2:128376853-128376875 GCAGGTTGGGAGCCTGGTGAGGG + Intergenic
939587860 2:144026833-144026855 GCCGCTTGGAAATTTGATGATGG - Intronic
944214740 2:197243660-197243682 GCAGATTTGATATCTGGTGAAGG + Intronic
945732861 2:213562563-213562585 GCAGATTTGATGCCTGGTGAGGG + Intronic
1172195193 20:33086722-33086744 GCCCAGTTCAAACCTGGTGAGGG + Intronic
1172877970 20:38177617-38177639 GGCGATTGGAAACCTGGACCTGG - Intergenic
1173379592 20:42527812-42527834 GCCTATTGGAAAGCTGGTCTTGG - Intronic
1173955368 20:47028197-47028219 GCTGGTTGGATTCCTGGTGAAGG - Intronic
1174716726 20:52766752-52766774 GCAGAATGGAAACCTGGAGCCGG + Intergenic
1174906854 20:54561048-54561070 GCTGCATGCAAACCTGGTGATGG - Intronic
1174932101 20:54827198-54827220 GCCAATTGGGTTCCTGGTGAGGG - Intergenic
1176150269 20:63587200-63587222 GCCGATTTGGTGCCTGGTGAGGG - Intergenic
1185152925 22:49176550-49176572 GCAGATTGGGTGCCTGGTGAGGG + Intergenic
949674888 3:6442347-6442369 GCCCATTCCAAAACTGGTGATGG + Intergenic
952961929 3:38597722-38597744 GCAGGTCGGAAACCTGGTAAGGG - Exonic
955065681 3:55531860-55531882 GCACATAGCAAACCTGGTGAAGG + Intronic
963834129 3:150039040-150039062 GCCAATGGGAAACCTGCAGAGGG + Intronic
977075802 4:92447683-92447705 GCAGATTCCAAATCTGGTGAGGG + Intronic
977141916 4:93384052-93384074 GCAGATTCAATACCTGGTGAAGG + Intronic
981676782 4:147351772-147351794 GCAGATTGGATGTCTGGTGAAGG + Intergenic
986249697 5:6044868-6044890 GCAGATTGGGTTCCTGGTGAGGG - Intergenic
986669247 5:10128148-10128170 GCCGCTTCGAATCCTGGCGAGGG - Intergenic
988621600 5:32829178-32829200 TCTGATGGGAAACCTGGTAAGGG + Intergenic
988792847 5:34624394-34624416 GCCAATTTGGATCCTGGTGAGGG - Intergenic
990593650 5:57291986-57292008 GCACTTTTGAAACCTGGTGAAGG - Intergenic
990801667 5:59611183-59611205 GCAGATTGGATATCTGGTGATGG + Intronic
993363260 5:87003797-87003819 GTAGATTAGAAACCTGGTGAAGG - Intergenic
1004300599 6:14454050-14454072 GCCAATTTGATTCCTGGTGAGGG + Intergenic
1013883754 6:114936213-114936235 GCCCATTGGAAAACAGATGAAGG - Intergenic
1016459055 6:144263022-144263044 GCCAATTTGGTACCTGGTGAAGG + Intergenic
1018255463 6:161913949-161913971 GCCGATTGGAAACCTGGTGAGGG - Intronic
1019736636 7:2653124-2653146 GCCGAGTGGGGACCTGGTGTTGG + Intronic
1024871926 7:53973549-53973571 GCAGATTTGATGCCTGGTGAGGG + Intergenic
1026244443 7:68606276-68606298 GCAGATTGGGTATCTGGTGAAGG - Intergenic
1032362511 7:131269321-131269343 GCAGATTTGACATCTGGTGAGGG + Intronic
1032549039 7:132767142-132767164 GCCGATTTGGCTCCTGGTGAGGG - Intergenic
1034642780 7:152618006-152618028 GCAGGTTGGATATCTGGTGAGGG - Intergenic
1035152939 7:156890547-156890569 GCCATTTGGAAATCTTGTGAAGG - Intronic
1038143970 8:24876728-24876750 GCAGATTCAATACCTGGTGAGGG + Intergenic
1040717247 8:50272026-50272048 GCAGATTCGATATCTGGTGAGGG - Intronic
1043503860 8:80883802-80883824 CCTAATTGGAAACCTGATGAAGG - Intergenic
1045420920 8:102014234-102014256 GCAGATTCGGAATCTGGTGAGGG + Intronic
1046593980 8:116238885-116238907 GCTGGTTGGAAGCCTGGTGTGGG - Intergenic
1049065596 8:140311250-140311272 GACGATGGGAAGCTTGGTGAAGG + Exonic
1051231671 9:14961698-14961720 GCCAATGGGAAACCTGTAGAGGG + Intergenic
1054972037 9:71099159-71099181 GCAGATTTGGAATCTGGTGATGG + Intronic
1057562342 9:96138443-96138465 GCTGATTTGGTACCTGGTGAGGG - Intergenic
1058670402 9:107356443-107356465 GCTGATTGGGTTCCTGGTGAGGG - Intergenic
1059182500 9:112230977-112230999 GCATAATGGAGACCTGGTGAAGG - Intronic
1059785430 9:117577628-117577650 GCGGCTTTGAAACATGGTGATGG + Intergenic
1188680840 X:33002409-33002431 GCCAATGGGAAACCTGTAGAGGG - Intronic
1193085651 X:77446487-77446509 GGCCATTGGAAGCCTGGTGGGGG - Intergenic
1196786364 X:119424781-119424803 GCAGATTTGATACCTGGCGAAGG + Intronic
1196906593 X:120443137-120443159 GCAGATTGCAAACAGGGTGAAGG - Intronic
1199417261 X:147599570-147599592 GCCAATTTGATTCCTGGTGAGGG - Intergenic