ID: 1018258174

View in Genome Browser
Species Human (GRCh38)
Location 6:161942923-161942945
Sequence AAGATGATGATTAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 437}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018258171_1018258174 24 Left 1018258171 6:161942876-161942898 CCAACAGGAGATATTTTGAGGCA 0: 1
1: 0
2: 1
3: 16
4: 442
Right 1018258174 6:161942923-161942945 AAGATGATGATTAGGGAAGATGG 0: 1
1: 0
2: 4
3: 40
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018258174 Original CRISPR AAGATGATGATTAGGGAAGA TGG Intronic
902155966 1:14486621-14486643 AAGATAATGCGTAGTGAAGATGG + Intergenic
902550332 1:17215372-17215394 ATGATGATGATGATGAAAGAAGG - Intronic
903408847 1:23122798-23122820 AGGATGAAGAGTTGGGAAGATGG - Intronic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
906730279 1:48074929-48074951 AATAGGATAGTTAGGGAAGAGGG + Intergenic
907038793 1:51239281-51239303 TAGGTGATGATGAGGGATGAGGG + Intronic
907080691 1:51618521-51618543 AAAAACATGATTATGGAAGAAGG + Intronic
907151461 1:52292331-52292353 AAGATGAGGATTTATGAAGATGG - Intronic
907887616 1:58607653-58607675 AAGATGATGAATAGGAGACAGGG - Intergenic
908933642 1:69346813-69346835 ATGAAGAGGATTAGGGAACAGGG + Intergenic
909609067 1:77534128-77534150 AAGAGGATGTTTAGGCAACACGG - Intronic
910405924 1:86890110-86890132 AAGATGATGATTAGGTAAGCAGG - Intronic
910437562 1:87220550-87220572 AGGATGCTGGTTAGGAAAGATGG + Intergenic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911759518 1:101599810-101599832 AAGGTGAGGAACAGGGAAGAAGG + Intergenic
912512216 1:110197364-110197386 GAGATGGTGATGGGGGAAGAGGG + Intronic
912645719 1:111389963-111389985 AAGAAAATGATTTGGGCAGAGGG - Intergenic
912691927 1:111811088-111811110 AAACTGATGATCAGGGGAGAGGG + Intronic
913116206 1:115699653-115699675 GAGAAGATGTTTAGGGGAGAAGG + Intergenic
913955082 1:143282471-143282493 AAGGTGATGATTTAGGAAGTTGG + Intergenic
913982356 1:143532970-143532992 AAGGTGATGATTTAGGAAGTTGG - Intergenic
915599393 1:156913064-156913086 AAGATGAGGAGTGGGGAGGAGGG + Intronic
915603207 1:156935427-156935449 AAGGAGCTGCTTAGGGAAGAGGG - Exonic
915616393 1:157042854-157042876 AAGAGGATGAAAAGGGAAGAAGG + Intronic
915919346 1:159962489-159962511 AAGGTGATGATAATGGAACAAGG + Intergenic
915991371 1:160520471-160520493 AAAATGCTGATTGGGGAATAGGG - Intronic
916210422 1:162355624-162355646 GAGATGCTGTTAAGGGAAGAGGG - Intronic
916345288 1:163783122-163783144 AAAATGATGAAAAGGGAATAGGG + Intergenic
916480123 1:165207363-165207385 GATATGAGGATTAGGGAGGAGGG - Intronic
916819374 1:168383373-168383395 AATTTGATGATTAAGGCAGATGG + Intergenic
917006638 1:170422676-170422698 GAGTTGATGATTAGTGAAGCTGG + Intergenic
917145797 1:171889745-171889767 AAGCCATTGATTAGGGAAGATGG + Intronic
917910873 1:179644207-179644229 AGAATGATGATTATGGAAAATGG + Intronic
919804261 1:201371658-201371680 AAGATGATGATTGTTGAAGCTGG + Intronic
921666366 1:217877028-217877050 AAGATGATGATGAGTGTAAAAGG - Intergenic
921879049 1:220232823-220232845 AAGATGATGGTTGGGGAGCATGG - Exonic
922229263 1:223671593-223671615 AGGATGATGATTTTGAAAGAAGG + Intergenic
922627274 1:227061290-227061312 ATTATGATTATTAAGGAAGAAGG - Intronic
923936449 1:238765587-238765609 ATGATGAAGCTTAGTGAAGAAGG - Intergenic
924016518 1:239731096-239731118 AAGAAGACAATTGGGGAAGAAGG + Intronic
1062931043 10:1352884-1352906 AAGGTGAGGAACAGGGAAGAAGG - Intronic
1063027434 10:2194133-2194155 AAGCTCATGGTGAGGGAAGATGG - Intergenic
1064566139 10:16640955-16640977 AGCATTATTATTAGGGAAGAAGG + Intronic
1064845516 10:19648003-19648025 AGTATGATGACTAGGGAAGCTGG + Intronic
1065311108 10:24416727-24416749 AGGATGAAGAGGAGGGAAGATGG - Intronic
1066393410 10:34997008-34997030 AACAGGAGGATTAGGCAAGAAGG + Intergenic
1066517032 10:36173987-36174009 AAGGTTATAATTTGGGAAGAAGG - Intergenic
1066951575 10:42123381-42123403 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1067267369 10:44757414-44757436 AAGATGGAGCTTAGGGGAGATGG - Intergenic
1067558152 10:47286562-47286584 GAGATGAAGATGAGAGAAGAGGG - Intergenic
1068409424 10:56635624-56635646 ATGATGATGACCAGGGAAAAGGG + Intergenic
1069398160 10:68012345-68012367 AGGATTATGCTTAGTGAAGAAGG - Intronic
1069915570 10:71784684-71784706 AAGAGGATGATGAGGGAAGCAGG - Intronic
1070848406 10:79542655-79542677 AAGATGAGGATTAATGAAGTTGG + Intergenic
1072783240 10:98264341-98264363 GAGAAGAGGATTAGGAAAGAGGG + Intronic
1072890021 10:99315795-99315817 AAGATGCTGTTTGGGGAAGAGGG - Intergenic
1073826199 10:107325016-107325038 AAGATGATATATAGGGAGGAAGG - Intergenic
1074794036 10:116923145-116923167 AAGATAGTAATTAGGGAGGAAGG + Intronic
1075291747 10:121236809-121236831 AAGGGGGTGATTAGGGAACAGGG + Intergenic
1075309648 10:121402966-121402988 AAGATGGTTATTTAGGAAGAGGG - Intergenic
1075628743 10:123986329-123986351 AAAATGAAAATTAGGGAAGAAGG - Intergenic
1077662287 11:4080417-4080439 AAAATAAGGAATAGGGAAGATGG - Intronic
1078737460 11:14033499-14033521 AAGATTAGATTTAGGGAAGAAGG + Intronic
1079822619 11:25149852-25149874 AACAGGAAGATTAGGGAAGAAGG - Intergenic
1080593180 11:33741962-33741984 AAGATGATGAAGAGGAGAGACGG - Exonic
1081158526 11:39724844-39724866 AAGGAGTTGATTAGGGAAGGAGG - Intergenic
1081365505 11:42230189-42230211 AAGAGATTGAGTAGGGAAGATGG + Intergenic
1083487129 11:62990277-62990299 AAGAGAATGAGAAGGGAAGAAGG - Intronic
1083701140 11:64478383-64478405 AAGATGATGATTTTGGAGCAAGG + Intergenic
1085695335 11:78699668-78699690 TAGTTGATGTTTAGTGAAGAAGG - Intronic
1086098109 11:83070843-83070865 AAGAGATCGATTAGGGAAGAGGG - Intronic
1086979823 11:93182666-93182688 AAGGTAATGAATATGGAAGAAGG - Intronic
1088789382 11:113211046-113211068 AGGAGGATGAGAAGGGAAGATGG - Intronic
1090354243 11:126129179-126129201 AAGATGAAGATAAGGTAAGGGGG - Intergenic
1090428742 11:126628733-126628755 AATCTGATGAATAGGAAAGATGG - Intronic
1091572922 12:1706080-1706102 AACATCATGATGTGGGAAGAAGG + Intronic
1091757208 12:3061827-3061849 GAGGTGATCTTTAGGGAAGAGGG - Intergenic
1092005323 12:5064483-5064505 AAGATGACAGTGAGGGAAGAGGG + Intergenic
1092464978 12:8723147-8723169 AAGATTAAGCTTAGTGAAGAAGG - Intronic
1093151306 12:15625074-15625096 AAGGTGAGGATTGGGGAATAGGG - Intronic
1093398875 12:18718303-18718325 TAGAAGATGATTTGGGAAGATGG - Intronic
1093410350 12:18857978-18858000 AAGATGATGGTTGGAGCAGATGG - Intergenic
1093893957 12:24556171-24556193 AAGAAGTTTATTAGGGGAGAGGG - Intergenic
1094312997 12:29106421-29106443 AAAATGATGATTATGTAAGAAGG + Intergenic
1096107435 12:49004721-49004743 AAACTGATGGTTAGGGAAGGGGG + Intronic
1096256791 12:50067259-50067281 ATGGTGATGATGGGGGAAGAAGG - Intronic
1097059630 12:56272892-56272914 AGGGAGCTGATTAGGGAAGAAGG + Exonic
1097573364 12:61359486-61359508 AAGATGTAGATTAGGGAAGAAGG - Intergenic
1097826121 12:64176319-64176341 ATGATGATGATTGAGGATGATGG + Intergenic
1098302233 12:69066389-69066411 CATAGGAAGATTAGGGAAGAGGG + Intergenic
1098429412 12:70403160-70403182 AAGACGATGACTATGGAATATGG - Intronic
1099337895 12:81387777-81387799 AAGATCTGGATTAGGGAAGATGG - Intronic
1099388161 12:82044300-82044322 AAGATCATGATATGGGAAAATGG + Intergenic
1099901755 12:88719260-88719282 AAGATGATTATTAGGCTGGAAGG - Intergenic
1100169942 12:91963057-91963079 AAGAAGAGGATGAAGGAAGAAGG - Intergenic
1100204640 12:92334942-92334964 ATGAGGAAGATTAGGGAAGATGG + Intergenic
1100713290 12:97280089-97280111 AAGGTGATGTTTAGGCTAGAGGG - Intergenic
1101773671 12:107774924-107774946 AAGAAGATCAGTGGGGAAGACGG + Exonic
1102461230 12:113100786-113100808 ATGATGATGATGATGGTAGATGG - Intronic
1102579097 12:113874693-113874715 ATGATGATGGATAGGGAAGGCGG + Intronic
1105233715 13:18525677-18525699 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1105389495 13:19960638-19960660 AAGATGATCAACATGGAAGATGG - Intronic
1106678629 13:31987380-31987402 AAGGTGATGGTTTGGGTAGAGGG + Intergenic
1106763999 13:32895534-32895556 AAGAGGCTGATGCGGGAAGATGG - Intergenic
1107195565 13:37647356-37647378 AAGTTGAGGATAAGGGCAGAAGG + Intronic
1107281128 13:38736624-38736646 AACATGAGGATTATGGAAGAAGG + Intronic
1107344839 13:39447992-39448014 GAGATTAGGATTTGGGAAGAGGG - Intronic
1108136738 13:47371776-47371798 AAAAGGAAGATTAGGGAGGAGGG + Intergenic
1108364295 13:49694466-49694488 AAGATCATCATTAAGCAAGAGGG - Intergenic
1108766720 13:53640002-53640024 AAGATTATGCTTAGGGTACATGG + Intergenic
1108782102 13:53848928-53848950 ATGTTGATGAAAAGGGAAGATGG + Intergenic
1111191379 13:84811752-84811774 AAGGTGATGACTAGTGATGAAGG + Intergenic
1111307196 13:86430187-86430209 AAGATAAAGATTATAGAAGAAGG + Intergenic
1111470453 13:88674277-88674299 AATATGCTGATTAGAGAATATGG - Intergenic
1111957667 13:94776119-94776141 TAGATGCTGCTGAGGGAAGAAGG + Intergenic
1112980382 13:105377369-105377391 AAGATGAGGATTTTGGAACAGGG - Intergenic
1113816221 13:113172966-113172988 AAGATGATGATATGGGGAGGTGG + Intergenic
1114914260 14:27242337-27242359 TAGATAATGATTAAGGAATATGG + Intergenic
1114933892 14:27508809-27508831 AGTATGATGAGTAGGGCAGAGGG - Intergenic
1115334349 14:32230228-32230250 AATGTGATGATTAGTGAAAATGG + Intergenic
1116135101 14:40913156-40913178 CAGATGATGTTTGGGGAAGGAGG + Intergenic
1116457123 14:45133082-45133104 AGGATAATAATTAAGGAAGAAGG + Intronic
1117967484 14:61220771-61220793 AACATGATGATAAGAGAAAAGGG + Intronic
1118427638 14:65684379-65684401 AAGATGACGAAAAGGGAAGAAGG + Intronic
1118839975 14:69502631-69502653 AGGATGATGATGGGGGAAGGAGG + Intronic
1118970816 14:70636026-70636048 AAGGTGAAGATTAGGAAAGAAGG + Intergenic
1119382057 14:74235496-74235518 AAGAGGGTGATTAGGGAAGAGGG - Intergenic
1119919431 14:78432672-78432694 AAGAGGAAGGTGAGGGAAGAAGG - Intronic
1120159442 14:81129876-81129898 ATACAGATGATTAGGGAAGAAGG - Intronic
1120697289 14:87658771-87658793 AAGATGACGAAGAGGCAAGATGG + Intergenic
1121409351 14:93738434-93738456 AAGGGGATGATGAGGGAGGAAGG + Intronic
1122105303 14:99448648-99448670 AAGATGATGGTGAGGGTACAAGG - Intronic
1122107147 14:99466799-99466821 AAGATCATGACCAAGGAAGATGG + Intronic
1202937615 14_KI270725v1_random:105998-106020 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1123395600 15:19931889-19931911 AAGGTGATGATTTAGGAAGCTGG - Intergenic
1124785965 15:32680744-32680766 AAGAAGCTGGTTAAGGAAGAAGG + Intronic
1126240363 15:46435189-46435211 ACGATGAAGCTTAGTGAAGAAGG + Intergenic
1126644144 15:50858438-50858460 AAGAAGGTGATGTGGGAAGATGG + Intergenic
1126826957 15:52561024-52561046 AATATGATTTTTAGGGAATAAGG - Intronic
1126892716 15:53223344-53223366 AAGGTTAGGATTTGGGAAGAAGG - Intergenic
1127306769 15:57713759-57713781 ATGATTGTAATTAGGGAAGAAGG + Intronic
1127394536 15:58533650-58533672 ATGATAATGATAAGTGAAGAAGG + Intronic
1127407244 15:58663498-58663520 AAGACGATGAACAGGAAAGAGGG - Intronic
1127870011 15:63064215-63064237 AAGATGGAGATTAGGGAGCAAGG - Intronic
1127902066 15:63348324-63348346 AAGATGGTGACTAGGGAAGAGGG + Intronic
1128037574 15:64540150-64540172 AAGATGAAGATGCGGGAAGATGG - Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129955732 15:79635148-79635170 AAGATGCTGCTTAGTGAACAGGG - Intergenic
1130455643 15:84104172-84104194 AGGATTAGGATTTGGGAAGAGGG + Intergenic
1131880355 15:96855985-96856007 AATATGATTAGTAGTGAAGAGGG + Intergenic
1131926274 15:97387262-97387284 AAGAGGATGATTAAAGAAGGAGG + Intergenic
1134410342 16:13998684-13998706 AAGAAGAGGAAGAGGGAAGAAGG + Intergenic
1136602071 16:31298969-31298991 AAGAATATGAACAGGGAAGATGG - Intronic
1136769552 16:32823797-32823819 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1136935771 16:34462732-34462754 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1136945940 16:34651215-34651237 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1136956262 16:34790243-34790265 AAGGTGATGATTTAGGAAGTGGG - Intergenic
1136964047 16:34885838-34885860 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1136968184 16:34940426-34940448 AAGGTGATGATTTAGGAAGTGGG - Intergenic
1137088676 16:36161077-36161099 AAGGTGATGATTTAGGAAGCTGG - Intergenic
1137219949 16:46438931-46438953 AAGATGATGATTTAGGAAGTTGG + Intergenic
1137557137 16:49477610-49477632 AAGAGGAGGAGGAGGGAAGAAGG + Intergenic
1138217148 16:55214448-55214470 AAGAAGACGATGAGGGAAGGAGG + Intergenic
1138789544 16:59887145-59887167 AAGAGCATGACTATGGAAGAGGG - Intergenic
1139489023 16:67276690-67276712 AGGATTTTGATTAGGGGAGATGG + Intergenic
1139574154 16:67830847-67830869 AAGAAGAGGGTTTGGGAAGACGG - Intronic
1140062891 16:71586943-71586965 AAGATGAGGTTTTGGGCAGAAGG + Intergenic
1203071969 16_KI270728v1_random:1085902-1085924 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1144118422 17:12125017-12125039 AAGCTGAAGCTGAGGGAAGAGGG - Intronic
1144506655 17:15837246-15837268 AAGATGCGGATTAGGGAATAGGG - Intergenic
1145170834 17:20655179-20655201 AAGATGCGGATTAGGGAATAGGG - Intergenic
1145692221 17:26754307-26754329 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1145708957 17:26950926-26950948 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1146057876 17:29589940-29589962 AGGGTGGGGATTAGGGAAGAAGG + Intronic
1146785859 17:35720775-35720797 AGGATGAAGAATAGGAAAGAGGG - Intronic
1146798719 17:35801542-35801564 ATGATGAGAGTTAGGGAAGATGG - Intronic
1146998782 17:37345042-37345064 AAGGTGACGATTAGGGAAAGAGG - Intronic
1148890070 17:50800804-50800826 CGGAGGATGGTTAGGGAAGATGG + Intergenic
1150596247 17:66608241-66608263 AAAGTGATGATTAGGTAAGTGGG - Intronic
1152845501 17:82597241-82597263 AAGATGCTGAATAAGGCAGAAGG - Intronic
1153071414 18:1109792-1109814 TAAATGACAATTAGGGAAGAGGG + Intergenic
1153663812 18:7350291-7350313 AAGATGATAAATAGAGTAGAAGG + Intergenic
1153784334 18:8521140-8521162 AGGATCAGGATTATGGAAGATGG + Intergenic
1155881909 18:31159913-31159935 AAAATGATGATTAGAGAATTAGG - Intronic
1157203784 18:45681387-45681409 AAGATGATGTTTTGGCAAGAGGG + Intronic
1157461444 18:47899451-47899473 AAGTGGATGATTAGGGAGAAAGG + Intronic
1157545533 18:48543905-48543927 AAGATGAAGATAAGGCAGGAAGG - Intronic
1157753493 18:50197971-50197993 AAAGTGAGGCTTAGGGAAGAAGG + Intergenic
1158185440 18:54766162-54766184 AAGATGATGAAGTGGTAAGATGG - Intronic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1159062110 18:63526467-63526489 AAGATGAAAGCTAGGGAAGATGG - Intergenic
1159466927 18:68795733-68795755 AAGATGATTATTTGGAAATACGG - Intronic
1160237692 18:77099010-77099032 AAGATGAGGAGGAGGGAAGGAGG - Intronic
1160525709 18:79534334-79534356 AAGAGAAGGATTTGGGAAGAAGG - Intergenic
1161143403 19:2662612-2662634 AGGATGAGGTATAGGGAAGAAGG + Intronic
1161679811 19:5674181-5674203 AAGATGATGATTAGTAAGCATGG - Intergenic
1162147293 19:8620637-8620659 AAGATGAGGATGAGGCAGGAGGG + Intergenic
1162767670 19:12929903-12929925 AAGATGAAGACTAGGGGCGATGG + Intronic
1162789816 19:13057019-13057041 GAGATGTTGCTTAGGGAGGAGGG + Intronic
1163563044 19:18032199-18032221 AAGGAGCTGATTAGGGAAGAAGG - Intergenic
1164559667 19:29281411-29281433 CAGATGATCAATAGAGAAGATGG - Intergenic
1165277320 19:34766134-34766156 AAGATGTGGAATAGGGGAGAGGG + Intronic
1168538377 19:57191062-57191084 AAGATGATGATCCGGGGAGGAGG + Intergenic
1168573765 19:57491364-57491386 GAGATGGGGATTAAGGAAGAGGG + Intronic
1168575373 19:57504553-57504575 GAGATGGGGATTAAGGAAGAGGG + Intronic
1202638100 1_KI270706v1_random:59216-59238 AAGATGGAGATTGGGGAGGATGG - Intergenic
925702235 2:6650409-6650431 AAGAGGCTGAGAAGGGAAGATGG + Intergenic
926460684 2:13126109-13126131 AAGTTGCTTATTGGGGAAGAAGG + Intergenic
927957981 2:27221537-27221559 AAGCTGATGATTATGGAAGGTGG - Intronic
928029020 2:27763145-27763167 AAAATAATTATTAGGAAAGAGGG + Intergenic
928039565 2:27861333-27861355 GAGGTGTTGATTAGGGAAGCAGG + Intronic
928852088 2:35760402-35760424 ATGATTATGCTTAGTGAAGAAGG + Intergenic
929753386 2:44740826-44740848 AAGATAAATATTAGGGAAGTGGG + Intronic
930207313 2:48601215-48601237 AAGATGATTATTTGGAACGAAGG - Intronic
931141077 2:59458944-59458966 AAGATGAGGATTAGGTCACAGGG - Intergenic
932116376 2:69053353-69053375 AAGATGAAGCTAAAGGAAGATGG + Intronic
933145123 2:78842476-78842498 AAGAGGCTGAGTAGGGAGGATGG + Intergenic
934249561 2:90337919-90337941 AAGGTGATGATTTAGGAAGTTGG + Intergenic
934260016 2:91465533-91465555 AAGGTGATGATTTAGGAAGTTGG - Intergenic
934303319 2:91797452-91797474 AAGGTGATGATTTAGGAAGTTGG - Intergenic
934329941 2:92055303-92055325 AAGGTGATGATTTAGGAAGTTGG + Intergenic
934468164 2:94285217-94285239 AAGGTGATGATTTAGGAAGTTGG + Intergenic
935626370 2:105175267-105175289 AGGATGATGTTGAGGGGAGAAGG + Intergenic
936021170 2:108996138-108996160 AAGATTCTGATTTGGGAAGAGGG + Intergenic
936088656 2:109487173-109487195 AAGATTATGTTAAGGAAAGATGG - Intronic
936126090 2:109790008-109790030 AAGATGGGGAGTAGGGAAGTGGG + Intergenic
936218603 2:110581460-110581482 AAGATGGGGAGTAGGGAAGTGGG - Intergenic
936301201 2:111306297-111306319 AACATGATGCTAAGTGAAGAAGG + Intergenic
936698237 2:114976921-114976943 AAGATGATAGATATGGAAGATGG - Intronic
938519291 2:132050412-132050434 AAGGTGATGATTTAGGAAGTTGG + Intergenic
938804233 2:134791329-134791351 AAGATGACCATTGGGGAAGGTGG + Intergenic
938986528 2:136581678-136581700 CAGATGATGATTCAAGAAGATGG - Intergenic
940976849 2:159955752-159955774 AAAATGATGATTATGAAACATGG - Exonic
941433899 2:165444542-165444564 AAGATGAAGCTTAGTGAAGATGG + Intergenic
942199223 2:173554096-173554118 AACATCCTGTTTAGGGAAGATGG + Intergenic
942837995 2:180323946-180323968 AAAATGATAATTAGTGAGGAGGG - Intergenic
943009091 2:182424744-182424766 ATGATTGTGATTAGGGAAAAGGG - Intronic
943012657 2:182469699-182469721 ATGATGAAGTTTAGTGAAGAAGG - Intronic
943830698 2:192458134-192458156 AAGATGAGGATGATTGAAGATGG + Intergenic
944720015 2:202414474-202414496 ATGATTAGGCTTAGGGAAGAAGG + Intronic
945200009 2:207272029-207272051 GACATGATGAAGAGGGAAGAGGG + Intergenic
946789119 2:223282494-223282516 CAGATGATGATTTTGGCAGAGGG + Intergenic
948408278 2:237739356-237739378 AAGAGGAGGATAAGGGAAGGGGG - Intronic
949045912 2:241872579-241872601 AAGATGCTGGTGAGGGAGGAGGG - Exonic
1168967683 20:1909089-1909111 ACAATAATGATGAGGGAAGAAGG + Intronic
1169306210 20:4492656-4492678 ATGATGATGACTAGCGAACAGGG + Intergenic
1169877364 20:10312658-10312680 AAGATGATGATTAAGGTGAAAGG + Intergenic
1170187016 20:13602490-13602512 AAGATGCTAATTAGGGAAACTGG + Intronic
1171562691 20:26139882-26139904 AAGCTGATGCTCAGAGAAGAGGG - Intergenic
1173524178 20:43719459-43719481 AAGATGAGGCTTAGTTAAGATGG + Intergenic
1174692522 20:52521750-52521772 ATGATGATGCTTAGTGAGGAAGG - Intergenic
1174823657 20:53749302-53749324 ATGGTGATGATTAAGTAAGAAGG + Intergenic
1175435327 20:58943387-58943409 TAGATGATGATAAGGGAAAAAGG - Intergenic
1175533866 20:59693796-59693818 AAGATGAAGAGTACAGAAGAGGG - Intronic
1175861979 20:62155439-62155461 AAGATGAAGGTTATGCAAGACGG - Intronic
1176585710 21:8583132-8583154 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1176777699 21:13153952-13153974 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1176912287 21:14580566-14580588 AAGATGAAGATTAAAGAAGAAGG + Intronic
1177451432 21:21272779-21272801 AAGATGAGGATTAAGGAATAAGG + Intronic
1180130722 21:45825341-45825363 GAGATGACGATCAGGGAGGAGGG - Intronic
1180268519 22:10560031-10560053 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1180525293 22:16253306-16253328 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1181876833 22:25946082-25946104 AAGAAAATGAGAAGGGAAGAGGG - Intronic
1182478655 22:30591793-30591815 AAGAAGGTGATTGGGAAAGACGG - Exonic
1184829683 22:46976671-46976693 AAGAGGGTGCTTAAGGAAGATGG - Intronic
1203237577 22_KI270732v1_random:20473-20495 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1203290223 22_KI270735v1_random:29605-29627 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1203323072 22_KI270737v1_random:87612-87634 AAGGTGATGATTTAGGAAGTTGG + Intergenic
949813972 3:8038957-8038979 AAGATGACGATCATGGCAGAAGG + Intergenic
949910965 3:8907706-8907728 AAGGGGATGATGCGGGAAGAAGG - Intronic
950780933 3:15390992-15391014 AAGGGGATGATGCGGGAAGAAGG + Intronic
951599903 3:24362254-24362276 GAGATAATGAGTAGGGAAGGGGG - Intronic
951839867 3:27022831-27022853 AAGAAGATGATTAGGGGTGTGGG + Intergenic
951953451 3:28227487-28227509 AAGAAGAGCATTAGGGAAAAGGG + Intergenic
952448108 3:33403354-33403376 AGGCTGCTCATTAGGGAAGAGGG - Intronic
953228404 3:41042183-41042205 AACATGATGATTAGCTAATAAGG + Intergenic
953365481 3:42340806-42340828 AGGATGGTGATTTGGGAAGATGG - Intergenic
953722946 3:45372237-45372259 AAAGTGATGATTAGGAAAGAGGG + Intergenic
953789768 3:45938302-45938324 AAGGTGACAATTAGGGCAGAGGG + Intronic
955092487 3:55766584-55766606 AAAATAATGATGGGGGAAGAGGG + Intronic
956390297 3:68764924-68764946 AGGGGGATGATTAGGGTAGAGGG - Intronic
956403914 3:68908266-68908288 AAGCTGATAAGTAGGGAAGCTGG + Intronic
956704884 3:71991150-71991172 AAGATCATGTGTAAGGAAGATGG + Intergenic
957110879 3:75955479-75955501 AAGATAATGTTTAGGGGGGAGGG + Intronic
959587675 3:108040219-108040241 AAGTTGATGATGATAGAAGATGG - Intergenic
960316712 3:116187342-116187364 AAGATGATGAAAAATGAAGATGG + Intronic
962178859 3:133183978-133184000 CACATGATGATAAGGGAACAAGG + Intronic
963109709 3:141677628-141677650 AAAATTATGTTTAGGGAGGAAGG + Intergenic
963964146 3:151346724-151346746 CACATTATGTTTAGGGAAGAAGG - Intronic
964146614 3:153471704-153471726 ATGATGAAGATTAGTGAGGAAGG - Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965816667 3:172643648-172643670 CAGATGCTGATAAGGGGAGAAGG + Intronic
966118117 3:176489349-176489371 AAGAGGAAGATAAGGGGAGAGGG + Intergenic
966771070 3:183503815-183503837 AAGATGATGATAGGACAAGAGGG + Intronic
966855737 3:184192922-184192944 AAGAGTTTGAGTAGGGAAGAGGG + Intronic
968475219 4:802515-802537 TAGATTATGATCAGGGAAAATGG - Intronic
970578815 4:17454338-17454360 ATGATTAAGCTTAGGGAAGAAGG + Intergenic
971878316 4:32333668-32333690 ATGAAGATGAGTTGGGAAGAGGG - Intergenic
971908700 4:32764606-32764628 AAAATGATGATTAGAAAATATGG - Intergenic
972408457 4:38768009-38768031 AGGATTATGGTTAGGGAAGCTGG - Intergenic
974512974 4:62868963-62868985 AACATGATGATCAGGAAAAAAGG - Intergenic
974645305 4:64682747-64682769 AAGATTGTGATTAAGGAAAATGG - Intergenic
975090504 4:70397047-70397069 AAGAAGCTTATTTGGGAAGAAGG - Intergenic
975213806 4:71731118-71731140 AAGAAGATGGTGCGGGAAGAAGG - Intergenic
975452531 4:74546073-74546095 AAGATAATGATCAGGGATGGGGG - Intergenic
975545537 4:75556888-75556910 TAGATGCTGTTTACGGAAGATGG + Intronic
977003044 4:91527145-91527167 AAAATGATATTTTGGGAAGATGG + Intronic
977684102 4:99827870-99827892 AAGATGATGGAAAGAGAAGAAGG + Intronic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
978204160 4:106059749-106059771 AAGATTAAGATTAGTGAGGAAGG + Intronic
978398323 4:108306043-108306065 ATGTTGATGATTAGGGGAGTGGG - Intergenic
979153911 4:117357917-117357939 ATGATCATATTTAGGGAAGAAGG + Intergenic
979517317 4:121624304-121624326 AAGATGTTGAGTAGGGAAAAGGG + Intergenic
979806110 4:124973357-124973379 TTGATCATGATTAGGCAAGAAGG + Intergenic
980119855 4:128716453-128716475 AAGATGTTCACAAGGGAAGAGGG + Intergenic
980569180 4:134588506-134588528 AAGAAGATGATTAAGGATCAAGG + Intergenic
981164171 4:141537353-141537375 ATGATTATGTTTAGTGAAGAAGG - Intergenic
981636052 4:146880556-146880578 AAGATGTTGTGCAGGGAAGAGGG - Intronic
983270345 4:165553777-165553799 AAAATGATGATGAAGTAAGAAGG - Intergenic
983319501 4:166177952-166177974 AAAATGATGATATGGGAAAAAGG - Intergenic
984165094 4:176296617-176296639 AGGGTGAGGAATAGGGAAGAAGG + Intergenic
984813257 4:183814314-183814336 AACCAGATGCTTAGGGAAGATGG + Intergenic
984830188 4:183965851-183965873 AAGGGGGTGGTTAGGGAAGAAGG + Intronic
986117448 5:4791672-4791694 GAAATAATAATTAGGGAAGATGG + Intergenic
987239609 5:15981637-15981659 AAGATGATGACTCCGGAAGAGGG + Intergenic
987564150 5:19563639-19563661 AAGGTGATGATTGGAGAAGAAGG + Intronic
987877941 5:23704873-23704895 AAGCTGAAGATTAGGAATGATGG + Intergenic
988151456 5:27387288-27387310 GAGATAATGATTGGGGGAGAGGG + Intergenic
988787221 5:34576402-34576424 AAGATGAGGATGACAGAAGAAGG - Intergenic
989130579 5:38103086-38103108 AGGATGATGCTTAGAGAAAAGGG - Intergenic
989764884 5:45070770-45070792 AAGTTGATAATTATGGAAAATGG + Intergenic
993459625 5:88167213-88167235 AAAATGAAGACTAGAGAAGATGG - Intergenic
993962984 5:94323777-94323799 AAGATGGAGATTAGGGGATAGGG + Intronic
994382643 5:99089407-99089429 AAGATGAGGGGTAGGGAAGAAGG + Intergenic
994386968 5:99143935-99143957 AACATGATTTTTAGGGAACAAGG - Intergenic
994454804 5:99992039-99992061 ACCATGATGATAAAGGAAGATGG + Intergenic
995638763 5:114228020-114228042 ATGATGATGATGAAAGAAGAAGG + Intergenic
995678298 5:114688235-114688257 ATGATGATGATGGGGGAGGACGG - Intergenic
996417822 5:123229178-123229200 ATGTTGAAGGTTAGGGAAGATGG - Intergenic
996703515 5:126473551-126473573 AAAATAATGTTTAGGGAAAAAGG - Intronic
997011000 5:129877197-129877219 AAGATGATGCTTATGGAAGTAGG + Intergenic
997378519 5:133417437-133417459 GAGATAATGAATAGGGCAGAAGG + Intronic
998725721 5:145011619-145011641 ATGATGATGACCAAGGAAGAAGG - Intergenic
999006083 5:147981091-147981113 GAGATGAGAACTAGGGAAGAAGG + Intergenic
999265284 5:150263019-150263041 AAGGTGTTGGTTGGGGAAGAGGG + Intronic
999601195 5:153267193-153267215 AAGAGAAAGAATAGGGAAGAAGG - Intergenic
1000108709 5:158086318-158086340 AATTAGATGATTAGAGAAGAGGG - Intergenic
1001311126 5:170611745-170611767 AATATGATGATTAGGAAACCAGG - Intronic
1001668079 5:173449990-173450012 AAGATGATGATGAAGGTAGCTGG + Intergenic
1002473915 5:179453300-179453322 AAGATGATGTGTGGGGAGGATGG - Intergenic
1003099232 6:3164409-3164431 AAGAAGGAGATTAAGGAAGATGG + Intergenic
1003294436 6:4811896-4811918 GAGCTGATGAATGGGGAAGAGGG - Intronic
1006380687 6:33695410-33695432 AAGAGGATGTCTAGGCAAGAGGG - Intronic
1008915862 6:56785866-56785888 AAGATCAAGAATAAGGAAGAGGG - Intronic
1008971048 6:57368567-57368589 AAGATGATCATTTGGGAATGTGG + Intronic
1009263631 6:61527162-61527184 AAGATGATGATATAAGAAGAGGG - Intergenic
1009550309 6:65083614-65083636 AAGATAATGATTAGGAAAACAGG - Intronic
1010232370 6:73546269-73546291 AATAAAATGATTTGGGAAGAGGG - Intergenic
1011113144 6:83860184-83860206 AAGATGAGGTTGAGGGAAGGCGG - Intronic
1011219789 6:85042169-85042191 AAGATGGTGAGTAGGGAATTTGG - Intergenic
1012702556 6:102479116-102479138 ATGATTAAGATTAGTGAAGAAGG - Intergenic
1013924926 6:115460585-115460607 AGGATGATGATTGGTGATGATGG - Intergenic
1014319619 6:119910689-119910711 ATGATTAAGATTAGTGAAGAAGG + Intergenic
1014586237 6:123201758-123201780 AAGATGAAGATTATAGAAAATGG - Intergenic
1015018487 6:128443310-128443332 AAGAAGGAGATGAGGGAAGAGGG + Intronic
1015701526 6:136040444-136040466 AATAGGATGAGTAAGGAAGAAGG - Intronic
1017560605 6:155624476-155624498 AAGATTATGATGAGAAAAGATGG - Intergenic
1017886273 6:158602051-158602073 AAGAAGATGTTTAGGGGTGATGG - Intronic
1018258174 6:161942923-161942945 AAGATGATGATTAGGGAAGATGG + Intronic
1018451325 6:163910867-163910889 AAGATGAAGATGAAGAAAGAAGG - Intergenic
1019866582 7:3716863-3716885 AAGAAAATGATCAGAGAAGAAGG + Intronic
1020216020 7:6191139-6191161 AAAATGATGACTATGAAAGAAGG + Intronic
1020661050 7:10982972-10982994 ATGATGAAGATGAGGGAAGCGGG + Exonic
1020712326 7:11623449-11623471 TAGATGATGAATAAGGAAGGAGG - Intronic
1021694816 7:23266625-23266647 AAGATGATGACCAGTGAGGAAGG + Intronic
1022362278 7:29673022-29673044 AAGATGATGATGAACAAAGAGGG + Intergenic
1022482517 7:30753181-30753203 AAGGAGATGATCTGGGAAGATGG - Intronic
1022699117 7:32740723-32740745 AAGATGATGATGAACAAAGAGGG - Intergenic
1023484587 7:40671890-40671912 AAAATGAAGATTAGGAAAGTAGG + Intronic
1023988759 7:45115098-45115120 AAGATGATTATTCAGCAAGAGGG + Intergenic
1024805406 7:53133509-53133531 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1025321488 7:58098930-58098952 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1025480783 7:60980245-60980267 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1025488257 7:61078787-61078809 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1025565712 7:62431664-62431686 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1025837777 7:65111588-65111610 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1025885292 7:65584408-65584430 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1026222845 7:68415414-68415436 AAGACGATGGAGAGGGAAGAGGG + Intergenic
1027543390 7:79496770-79496792 AAGATGATGTTAAGAGAATAGGG - Intergenic
1027897146 7:84060019-84060041 AAGATGATGGTTACAGAAAAAGG + Intronic
1028321866 7:89469013-89469035 AAGATGATGGCTAAGGATGAAGG - Intergenic
1030410936 7:109179440-109179462 CAGATAATGCTTAGGGAAGAGGG + Intergenic
1030992982 7:116323691-116323713 ATGATGAAGCTTAGTGAAGAAGG + Intronic
1032524843 7:132572358-132572380 AAGATGATAATTAATGATGATGG - Intronic
1032691276 7:134289609-134289631 AAGATGATGATTTTAGAAGTAGG - Exonic
1034080624 7:148274645-148274667 AAGCTTATGATTATGGCAGAAGG - Intronic
1034865811 7:154640856-154640878 AAGATGAGAATTAGTGAAAAAGG - Intronic
1035832111 8:2707634-2707656 CAGATAATGATTAACGAAGAGGG + Intergenic
1036171595 8:6491402-6491424 AAGATTATTATTAGGACAGAAGG + Intronic
1037011985 8:13855130-13855152 AAGATGATGACAAGAGATGAGGG - Intergenic
1037475432 8:19252454-19252476 CAGATGATTAGCAGGGAAGATGG - Intergenic
1038249781 8:25892490-25892512 AAGATGACTTTTTGGGAAGATGG - Intronic
1038878074 8:31574208-31574230 AAGATGATGAGTTCTGAAGATGG + Intergenic
1040704564 8:50110147-50110169 TGCATGATGATAAGGGAAGAGGG - Intronic
1041540686 8:58981672-58981694 AAGGTGATCATTAGAGAAGGTGG - Intronic
1042057552 8:64782037-64782059 GAGAGGATGGTAAGGGAAGATGG - Intronic
1042190410 8:66180114-66180136 AAGATCATGATTATGGAAAATGG + Intergenic
1043549645 8:81356130-81356152 AAGAAGATGCTTACGTAAGAGGG - Intergenic
1043583955 8:81746006-81746028 AAGTTGTTTATTAGGGAACAAGG + Intronic
1044252714 8:90022829-90022851 AAGACAATAATGAGGGAAGAAGG - Intronic
1044275161 8:90290763-90290785 AAGAAGATGATTAAAGGAGATGG - Intergenic
1044647617 8:94460850-94460872 GAGATGGTGATTAGGGAAGCAGG - Intronic
1044647976 8:94464838-94464860 AAGCTTATAATTAGGGCAGAAGG + Intronic
1044779846 8:95733062-95733084 AAGAATATGCTTAGGGCAGAGGG + Intergenic
1044987385 8:97767495-97767517 AAGAAGATGATGAGGGAGGCTGG + Intergenic
1045795139 8:106034453-106034475 AAGATGATCATTGGTGTAGAGGG + Intergenic
1046831956 8:118756073-118756095 AAGATGAGGATGTGGGCAGAAGG + Intergenic
1047050848 8:121111172-121111194 AAGATGATGTTATGGGAAAAGGG + Intergenic
1047074672 8:121387400-121387422 AAGAAGAGGATATGGGAAGACGG + Intergenic
1047126907 8:121972861-121972883 AAGATGAAAATTAGACAAGAAGG - Intergenic
1048554619 8:135462507-135462529 AAGATGTTCCTTAGGAAAGAGGG - Intronic
1048945608 8:139444339-139444361 AAGATGAAGAGTTTGGAAGACGG - Intergenic
1049273966 8:141710581-141710603 AAGAGCATGGTAAGGGAAGAGGG + Intergenic
1049677776 8:143900126-143900148 AAGGTGATGATTTGGAATGAGGG - Intergenic
1049702275 8:144020687-144020709 AAGAGGATCCTGAGGGAAGAGGG - Intronic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050712563 9:8482334-8482356 AAGATGATGATGATGGAAGTAGG - Intronic
1052585201 9:30419039-30419061 AAGATGATGATGAGGGTGCATGG + Intergenic
1052876126 9:33565878-33565900 GGAATGATGATGAGGGAAGAGGG + Intronic
1053408352 9:37897895-37897917 TAGATGATAAATAGGGAGGAGGG - Intronic
1053499888 9:38578467-38578489 GGAATGATGATGAGGGAAGAGGG - Intergenic
1053698575 9:40663241-40663263 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1053944577 9:43293477-43293499 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1054309864 9:63462642-63462664 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1054441808 9:65270608-65270630 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1054488476 9:65750889-65750911 AAGGTGATGATTTAGGAAGCTGG - Intergenic
1055211914 9:73805585-73805607 AAGATCAGGATTGGGGAAGAGGG + Intergenic
1055685024 9:78763588-78763610 AGGCTGATGAGAAGGGAAGATGG + Intergenic
1056141097 9:83680658-83680680 AAGATAATTATTAGGGCACAAGG - Intronic
1057679312 9:97163165-97163187 GGAATGATGATGAGGGAAGAGGG - Intergenic
1058855841 9:109061475-109061497 AAGATGAAGGTTAGTGATGAAGG - Intronic
1059732661 9:117072380-117072402 AAGATGATGGTTTGGGCAGAAGG - Intronic
1059811410 9:117859523-117859545 AAGATGAAGATTGAGGAGGATGG + Intergenic
1059821953 9:117983390-117983412 CAGATGGTGATGAGGGCAGAGGG + Intergenic
1059827498 9:118047762-118047784 AAGATAATAATAAGGGAAGCAGG - Intergenic
1060343755 9:122799513-122799535 AAGATGTAGATCAGGGAAGGAGG - Intronic
1061511751 9:131065838-131065860 AAGATGATGATGATGGAGGAAGG + Intronic
1062051747 9:134450908-134450930 AAGATGATGATGTTGGGAGATGG - Intergenic
1202780939 9_KI270717v1_random:36448-36470 AAGGTGATGATTTAGGAAGCTGG + Intergenic
1203581596 Un_KI270746v1:11636-11658 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1203587712 Un_KI270747v1:22055-22077 AAGGTGATGATTTAGGAAGTTGG + Intergenic
1203615612 Un_KI270749v1:60654-60676 AAGGTGATGATTTAGGAAGTTGG - Intergenic
1185613247 X:1404514-1404536 TAGATGATGGTTAGGTAAGTAGG + Intronic
1186135574 X:6516766-6516788 AAGACTATGATTAGGGCACATGG + Intergenic
1186342317 X:8657820-8657842 AAGATGGAGAATAAGGAAGAAGG + Intronic
1186380175 X:9049508-9049530 AAGGTGATGAAGAGGGAAGATGG - Intronic
1186619535 X:11224304-11224326 AAGATGAAGAAGAGAGAAGAAGG + Intronic
1187859893 X:23671201-23671223 AAGATAATGATGAGTGAAAATGG - Intronic
1187989873 X:24858795-24858817 AAAATGGTGTTTAGGGAGGAGGG - Intronic
1188267012 X:28089398-28089420 AAGATGATGCAGAGAGAAGATGG - Intergenic
1189238437 X:39506991-39507013 GAGCTGATAATGAGGGAAGAGGG + Intergenic
1189968791 X:46397103-46397125 ATGATGATGATTTTGGAAGAGGG - Intergenic
1191135689 X:57062270-57062292 AATAGGATGCTTAGGGAAAAAGG - Intergenic
1191904688 X:66076071-66076093 AGGGTGGTGATTTGGGAAGACGG + Intergenic
1192584853 X:72311450-72311472 AAGATGATAATTGTTGAAGATGG + Intergenic
1192744165 X:73922166-73922188 AAGCTTATGATTATGGCAGAAGG + Intergenic
1192907783 X:75569744-75569766 AAAATGATGGTTAAGGAGGAGGG + Intergenic
1194667096 X:96687189-96687211 AAGTTACTGAGTAGGGAAGAAGG + Intronic
1195720801 X:107865973-107865995 ACGAGGAGGATTAGAGAAGAGGG + Intronic
1197592853 X:128429937-128429959 AAGATGGTGAACAGAGAAGAGGG - Intergenic
1197761167 X:130029419-130029441 GAGATGTTGATTTGGGATGAGGG - Intronic
1197839347 X:130728725-130728747 AAGGTGATGACTAGGGCAAAGGG + Intronic
1198317656 X:135485340-135485362 AAGACGAGGATTAGGGGAGGAGG + Intergenic
1198883743 X:141310384-141310406 ATGATTAAGCTTAGGGAAGAAGG - Intergenic
1199100613 X:143795485-143795507 AAGAAGATGATGAGAGGAGATGG + Intergenic
1199445244 X:147912583-147912605 GAGATGATGTTTAGGAAAGGGGG - Intronic
1199680936 X:150224163-150224185 AAGAGGAAGATGAAGGAAGAAGG - Intergenic
1200733462 Y:6768319-6768341 GAGAGGAGAATTAGGGAAGATGG + Intergenic
1201859985 Y:18586296-18586318 CAGCTGATCATTAGGGAAGGTGG - Intronic
1201873336 Y:18734085-18734107 CAGCTGATCATTAGGGAAGGTGG + Intronic
1202372727 Y:24209485-24209507 AAGATGGTGACCAGAGAAGACGG + Intergenic
1202498055 Y:25460635-25460657 AAGATGGTGACCAGAGAAGACGG - Intergenic