ID: 1018258276

View in Genome Browser
Species Human (GRCh38)
Location 6:161943972-161943994
Sequence CTGAGGAAGCAGCCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018258273_1018258276 -8 Left 1018258273 6:161943957-161943979 CCTTGAGGAAGCAGCCTGAGGAA 0: 3
1: 0
2: 1
3: 41
4: 321
Right 1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG No data
1018258271_1018258276 5 Left 1018258271 6:161943944-161943966 CCTGAGGGATCAGCCTTGAGGAA 0: 4
1: 0
2: 0
3: 11
4: 180
Right 1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG No data
1018258269_1018258276 18 Left 1018258269 6:161943931-161943953 CCTGAGGAAGCAGCCTGAGGGAT 0: 4
1: 1
2: 10
3: 28
4: 248
Right 1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018258276 Original CRISPR CTGAGGAAGCAGCCTGAGGA AGG Intronic
No off target data available for this crispr