ID: 1018262535

View in Genome Browser
Species Human (GRCh38)
Location 6:161984780-161984802
Sequence TGCTGTTAGCATTTCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018262533_1018262535 19 Left 1018262533 6:161984738-161984760 CCACTATGTTTGTTGCTATTTCT 0: 1
1: 0
2: 2
3: 42
4: 608
Right 1018262535 6:161984780-161984802 TGCTGTTAGCATTTCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018262535 Original CRISPR TGCTGTTAGCATTTCATGAA GGG Intronic
No off target data available for this crispr