ID: 1018264874

View in Genome Browser
Species Human (GRCh38)
Location 6:162013586-162013608
Sequence CACAGTTATCACTATGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018264874 Original CRISPR CACAGTTATCACTATGCACT TGG (reversed) Intronic
905258171 1:36698949-36698971 CACCATTTTTACTATGCACTGGG + Intergenic
907116644 1:51974779-51974801 CACAATTAACACTATGAAGTAGG - Intronic
908094413 1:60721781-60721803 AACAGTTTGCACCATGCACTTGG + Intergenic
909322049 1:74301934-74301956 CACATTTACCAATAGGCACTTGG - Intronic
909599794 1:77449157-77449179 GACAGTTAGCACCATGCACCTGG + Intronic
910706864 1:90139587-90139609 GACAGTTTGCACCATGCACTTGG - Intergenic
911075619 1:93871226-93871248 TACAGTGATCACTATGCACCAGG + Intronic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911530332 1:99036542-99036564 GACAGTTTTCACCATGCACCTGG - Intergenic
916142213 1:161709887-161709909 CACAGTTACTAATATGGACTGGG + Intronic
917705778 1:177633225-177633247 CACATTTTCCATTATGCACTTGG + Intergenic
917892489 1:179453321-179453343 AACAGTTTTCACCATGCACCTGG + Intronic
919129202 1:193432739-193432761 CACAGCTAGCACCATGCACCTGG - Intergenic
921230593 1:213066328-213066350 CACAGTTTTCACTAAGCTTTAGG + Intronic
923876811 1:238058520-238058542 TACAGCTTGCACTATGCACTTGG - Intergenic
924072544 1:240296875-240296897 TACAGTTGTCACTATGCAAAGGG + Intronic
924364377 1:243275541-243275563 CACAGTTATTAATATACACGTGG + Intronic
1062799048 10:366191-366213 CACGTCTATCACTATGCACCTGG + Intronic
1068056179 10:52015006-52015028 AACAGCTTGCACTATGCACTTGG - Intronic
1068209015 10:53896203-53896225 CACAGTTATTATTATGAATTAGG + Intronic
1069643247 10:69970248-69970270 CACAGAGACCACTATGCTCTGGG - Intergenic
1069815005 10:71188234-71188256 CACAGCTACCACTCTGGACTTGG - Intergenic
1070473661 10:76811077-76811099 CACACTTCTTACCATGCACTAGG + Intergenic
1071768707 10:88700168-88700190 CACAGTAATGACTATGCAGCTGG + Intergenic
1073766336 10:106686731-106686753 CACAGTTGTCACTGTGCATCAGG - Intronic
1076211804 10:128653690-128653712 CATGGTTATCACTAGGCTCTGGG - Intergenic
1078327905 11:10395573-10395595 GATAGTTATTTCTATGCACTAGG - Intronic
1087031187 11:93706160-93706182 AACATTTAAGACTATGCACTTGG - Intronic
1088444679 11:109912916-109912938 AACACTTAACACTATGTACTTGG - Intergenic
1090435809 11:126685489-126685511 CACTGCTATTATTATGCACTGGG - Intronic
1090513817 11:127403234-127403256 CACAGTAATCACTAGACACATGG + Intergenic
1091007163 11:131963765-131963787 TATAGTGCTCACTATGCACTAGG + Intronic
1091019599 11:132087579-132087601 CACAGTTATACCTTAGCACTGGG - Intronic
1092243312 12:6848992-6849014 CACAGATATCACCAGGCCCTGGG + Exonic
1097950203 12:65419162-65419184 CACAGTGGTCACCATGCAGTTGG - Intronic
1100776414 12:97979564-97979586 CACAGTTATCCCCAGGCCCTAGG - Intergenic
1101198957 12:102414874-102414896 CACAATTATCAATTTGCCCTAGG + Intronic
1101693898 12:107106685-107106707 CAAACTTATCAATATGCACATGG + Intergenic
1103159373 12:118715333-118715355 CACATTTCTCTCTCTGCACTGGG - Intergenic
1106568134 13:30904806-30904828 CAGAGTCATCACTATGCACCAGG - Intergenic
1108834419 13:54523541-54523563 CACACATATCACTCTGCAATAGG - Intergenic
1111490765 13:88971769-88971791 CACAGTTTTTACTTTGTACTGGG - Intergenic
1115100894 14:29698058-29698080 CACTGTTATCAGTATTCACATGG + Intronic
1115195607 14:30795731-30795753 CACACTTATGACTTTTCACTTGG - Intergenic
1116055567 14:39860308-39860330 CAAAGTCAACACTAAGCACTAGG - Intergenic
1120969204 14:90193212-90193234 CACTGCTAGCACTATGCCCTGGG + Intergenic
1121500736 14:94435035-94435057 CACAGTCAGCACAAAGCACTGGG + Intergenic
1122003404 14:98683176-98683198 CACAGTTTTCACTATCTAGTTGG - Intergenic
1126670751 15:51113197-51113219 CACATTTCTCTCTCTGCACTTGG + Intergenic
1130270528 15:82444120-82444142 CACAGTTAGCTCTAGGCACATGG + Intergenic
1130462872 15:84171439-84171461 CACAGTTAGCTCTAGGCACATGG + Intergenic
1130489802 15:84423348-84423370 CACAGTTAGCTCTAGGCACATGG - Intergenic
1130501393 15:84502098-84502120 CACAGTTAGCTCTAGGCACATGG - Intergenic
1130832002 15:87610359-87610381 CATAGTTATTACTATTCACATGG - Intergenic
1133846380 16:9457787-9457809 CACATTTATTGCTATGGACTCGG + Intergenic
1136560261 16:31034752-31034774 CACAGTTATCGCTGCCCACTGGG + Intronic
1137801749 16:51267848-51267870 CACAGTCAGCACTGTGCAGTAGG - Intergenic
1138770351 16:59655420-59655442 CACAGTTATGTGTAAGCACTAGG - Intergenic
1139233557 16:65310700-65310722 CAGAGATATCACTAGGCATTTGG - Intergenic
1141994144 16:87626292-87626314 CACAGTTATCACCATGGAGCTGG + Intronic
1145347182 17:22048582-22048604 CACAGGTAACACCATGCCCTAGG - Intergenic
1148208575 17:45794657-45794679 CACACTCATCAATCTGCACTTGG + Intronic
1150530445 17:65976070-65976092 CACACTAATCACCATGGACTCGG + Intronic
1151999392 17:77636002-77636024 AACACTTACCACTCTGCACTCGG - Intergenic
1151999396 17:77636072-77636094 AACACTTACCACTCTGCACTCGG - Intergenic
1153992341 18:10411583-10411605 CACACTGATCACTGTGCAGTGGG + Intergenic
1154223200 18:12475348-12475370 CACTGTGCTCACTAAGCACTTGG + Intronic
1156976578 18:43228893-43228915 CAGAGTTTCCACTATGCTCTGGG + Intergenic
1158991965 18:62878194-62878216 TATACTTATTACTATGCACTAGG - Intronic
1159345435 18:67197016-67197038 CACAGTAAACCCCATGCACTTGG - Intergenic
1160400706 18:78609170-78609192 CACACACATCAATATGCACTTGG - Intergenic
1162315071 19:9934028-9934050 AACAGATATGATTATGCACTGGG - Intronic
1167422345 19:49411751-49411773 CACAATGATCATTCTGCACTGGG - Intronic
925121773 2:1423955-1423977 CACACTTCTTACTACGCACTTGG - Intronic
926632426 2:15148503-15148525 CACAGGTACCACTCTGCACGTGG - Intergenic
926835603 2:17016150-17016172 CACAGATCTCACTATGCATCTGG + Intergenic
927358080 2:22197425-22197447 CAAAGATATTACTATGCATTAGG + Intergenic
931545416 2:63379398-63379420 CAGAGTAATTACTATGGACTTGG + Intronic
937091616 2:119210051-119210073 CACAGTGACCACAATGTACTTGG + Intergenic
937827958 2:126388468-126388490 GACAGTTTGCACCATGCACTTGG + Intergenic
940436029 2:153656260-153656282 CAAAGCAATCACAATGCACTGGG - Intergenic
940899877 2:159116868-159116890 CAAAGTTATAACTAAGCTCTTGG - Intronic
941649136 2:168074369-168074391 TACAGTTATCATTAGGCATTAGG + Intronic
941674180 2:168326154-168326176 CACTGCTATCTCTATCCACTAGG - Intergenic
945087398 2:206146024-206146046 CCCAGCTATTACTTTGCACTGGG - Intronic
945416470 2:209578968-209578990 AACAGTTATAATTATGCACTTGG - Intronic
945606839 2:211943683-211943705 CACATTTCTCATTATGCACAGGG - Intronic
947139251 2:227006230-227006252 CAGAGCTATCATTATGCACTTGG - Exonic
1170142506 20:13138980-13139002 CACAGTAATCAGCAGGCACTGGG + Intronic
1175822303 20:61916929-61916951 CACAGTTGTGTCTATGCTCTGGG + Intronic
1177633911 21:23761900-23761922 AAAAGTTATCAGGATGCACTGGG - Intergenic
1179970503 21:44834619-44834641 CACAGTAATCCCTATGTCCTAGG - Intergenic
950635981 3:14314976-14314998 CACATTTATTAGCATGCACTGGG - Intergenic
952539564 3:34353390-34353412 CTCAGTAATTACTATGTACTTGG - Intergenic
956258211 3:67307372-67307394 CACATCTATCAGTATGAACTGGG + Intergenic
960494182 3:118355175-118355197 GACAGTTTGCACTGTGCACTTGG + Intergenic
961384031 3:126514429-126514451 CACAGCTCTCACCATGCACAGGG - Intronic
962679335 3:137782317-137782339 CACAGTTCTCAATATGCACCTGG - Intergenic
964523502 3:157592194-157592216 CACTGTTATCACTATAGACTGGG - Intronic
969093465 4:4714653-4714675 CACCTTTATCACTAATCACTTGG - Intergenic
970372595 4:15423276-15423298 CACAGTTCTTACACTGCACTGGG - Intronic
971499206 4:27300430-27300452 CCCAGTTTGCACCATGCACTTGG - Intergenic
971753361 4:30678597-30678619 GACAGTTTTCACTGTGCACCTGG + Intergenic
973658413 4:53076175-53076197 CACAGTTACAACTTTTCACTTGG + Intronic
976075843 4:81298279-81298301 AACAGCTTTCACTATGCACCTGG + Intergenic
977476096 4:97511866-97511888 CACAGGTATCTCTCTACACTAGG - Intronic
981194563 4:141903311-141903333 CACATTTATTAATATGCACATGG - Intergenic
981764358 4:148230730-148230752 CTCAGTTATAACCATGCAGTGGG + Intronic
983051137 4:163048971-163048993 CACAGTTATAGGTATCCACTGGG + Intergenic
985990584 5:3557204-3557226 CACTGTTATCCTTAAGCACTGGG - Intergenic
987680825 5:21133759-21133781 GACAGCTTGCACTATGCACTTGG + Intergenic
988091046 5:26542015-26542037 CACAGCTTTCACTGTGCACCTGG + Intergenic
988768050 5:34403276-34403298 CACAGCTAGCACTGTGCAGTTGG - Intergenic
996362027 5:122659320-122659342 CACAGTGAAGACTATACACTTGG - Intergenic
996671300 5:126121024-126121046 GACAATTGTTACTATGCACTAGG + Intergenic
1001220282 5:169894763-169894785 CATGGTTACCATTATGCACTGGG + Intronic
1001237614 5:170043348-170043370 ACCAGCTATTACTATGCACTAGG - Intronic
1002075655 5:176706841-176706863 CACACCTATCACTGTGCAATGGG + Intergenic
1003670452 6:8152920-8152942 CAGTCTTATCACTATGCAGTAGG - Intergenic
1007059002 6:38919441-38919463 CACATTTTTCATTTTGCACTGGG + Intronic
1007853869 6:44834143-44834165 CTCAGCTCTCACTATGCACCTGG - Intronic
1007954542 6:45904518-45904540 CCCTGTTTTCACTGTGCACTAGG + Intronic
1009244984 6:61226561-61226583 CACAGTTATTACCTTGCATTTGG + Intergenic
1009691715 6:67042991-67043013 CCCAGTTTTCACAATGCATTAGG - Intergenic
1009803767 6:68575637-68575659 CACAGTTAACAATATGACCTAGG + Intergenic
1009947232 6:70353864-70353886 TTCAGTTATCACTATGGCCTAGG + Intergenic
1010016370 6:71108963-71108985 CACAGTTTTCATTTTACACTGGG - Intergenic
1011728606 6:90236390-90236412 CACAATTAGCACAAAGCACTTGG + Intronic
1011882782 6:92051653-92051675 CTCAGTTCTCACTATGAACGAGG + Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1016017637 6:139202467-139202489 CACAGCTTTCACTATGCTGTAGG + Intergenic
1016294414 6:142559541-142559563 CAAAGTTATCATTATACTCTGGG - Intergenic
1018264874 6:162013586-162013608 CACAGTTATCACTATGCACTTGG - Intronic
1020735088 7:11938473-11938495 CACAGTTATCAATATGAAATAGG + Intergenic
1021658734 7:22897587-22897609 CACTGTTATTACTATGTGCTAGG - Intergenic
1021691272 7:23233020-23233042 CACAGTCATCATTATGTCCTGGG + Intergenic
1025280872 7:57625895-57625917 CACAGGTAACACCATGCCCTAGG + Intergenic
1025303858 7:57839612-57839634 CACAGGTAACACCATGCCCTAGG - Intergenic
1026423003 7:70259918-70259940 CACAGTTTTCATTATGCTCTTGG - Intronic
1027945540 7:84740701-84740723 CTCATTTATCTCTATGTACTTGG - Intergenic
1030938647 7:115617560-115617582 CACAGTTACCACAGTGCACAGGG + Intergenic
1032661100 7:133984652-133984674 CACAGATCTCACAATCCACTAGG + Intronic
1033153403 7:138936256-138936278 CACAGTTACAACTGTCCACTAGG + Intronic
1033716697 7:144009921-144009943 CACAGTTTGCACTGTGCACCTGG + Intergenic
1037510717 8:19579092-19579114 GAAAGTTATCACTCTGGACTGGG - Intronic
1046264524 8:111814022-111814044 AACAGCTTTCACCATGCACTTGG - Intergenic
1048350428 8:133611525-133611547 CACATTTATGACCATGGACTAGG + Intergenic
1051574886 9:18604017-18604039 CATATTTATCCCTATGCATTTGG + Intronic
1052168011 9:25357496-25357518 GACAGTTTGCACTGTGCACTTGG - Intergenic
1052202358 9:25798655-25798677 CAGAGTGATTACTATGCAATGGG - Intergenic
1052602936 9:30661629-30661651 CACATTTTTCATTTTGCACTGGG - Intergenic
1054842353 9:69756867-69756889 CACAGTAGTCACTAGGCACATGG + Intronic
1057241806 9:93417934-93417956 CCCACTTCTCAATATGCACTTGG + Intergenic
1057323894 9:94042099-94042121 CAGATTTCTCACTATGGACTGGG - Intronic
1058427605 9:104888897-104888919 TACAATTATCACCATTCACTAGG + Intronic
1189548149 X:42065076-42065098 AAAAGTCATCACTATGCACTAGG + Intergenic
1192689727 X:73349589-73349611 AACAGTTTTCACCATGCACTTGG + Intergenic
1193607006 X:83581325-83581347 CAAATTTATCCCTATACACTAGG - Intergenic
1202372316 Y:24207158-24207180 CACAGTTAGCTCTAGGCACATGG - Intergenic
1202498469 Y:25462962-25462984 CACAGTTAGCTCTAGGCACATGG + Intergenic