ID: 1018265421

View in Genome Browser
Species Human (GRCh38)
Location 6:162019419-162019441
Sequence TGCACCCTCAAGCTCAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018265419_1018265421 -3 Left 1018265419 6:162019399-162019421 CCAACTCTGGCATGCCTCGGTGC 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1018265421 6:162019419-162019441 TGCACCCTCAAGCTCAGAGATGG 0: 1
1: 0
2: 0
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018265421 Original CRISPR TGCACCCTCAAGCTCAGAGA TGG Intronic
900571377 1:3360337-3360359 AGCACCCTCATGCTCTGTGATGG + Intronic
901530570 1:9849987-9850009 TGGACCCTCAGGCCCAGAGCCGG + Exonic
901762838 1:11481640-11481662 GGAAACCTGAAGCTCAGAGAAGG - Intronic
903295102 1:22338731-22338753 GGGACCCTGAAGCTCAGTGAGGG - Intergenic
903859694 1:26357244-26357266 TGCACCTCCAAGTCCAGAGAGGG + Intergenic
904907802 1:33911053-33911075 TGGACCCTGAAGCTCACAGTCGG - Intronic
906526547 1:46496575-46496597 TGGACCCAAAAGCTCAGAGTTGG + Intergenic
907319145 1:53592014-53592036 GGGACACTCATGCTCAGAGATGG - Intronic
908132952 1:61094550-61094572 TGCACACTTAAGCTCAGAAAAGG + Intronic
908416007 1:63913946-63913968 TGCAGCCTCAAATTCAGGGAAGG + Intronic
908826652 1:68139580-68139602 TGGACCCTTCAGCTCAGGGAAGG + Intronic
910218699 1:84867329-84867351 TGCAGCCTCATTCTCAGTGAGGG - Intronic
912253812 1:108038746-108038768 TGCAGACTGAAGGTCAGAGACGG + Intergenic
913176246 1:116275722-116275744 TGCAGCTGCAAGCTCAGAAACGG - Intergenic
913237415 1:116796889-116796911 TGCAACCTGGAGCTCTGAGAAGG + Intergenic
915561283 1:156689710-156689732 TTGACCCCCAAGCTCAGAAATGG - Intergenic
915974061 1:160373431-160373453 GGGACACTAAAGCTCAGAGAAGG + Intergenic
916966171 1:169945090-169945112 GGCACCTACAAGCTCAGGGAGGG - Intronic
920807658 1:209250308-209250330 TGCAGTCTCAGGCTCTGAGAGGG - Intergenic
923201462 1:231716719-231716741 TTCACCCTCATGGGCAGAGAAGG + Intronic
923561823 1:235047462-235047484 TGCCCCCGCAAGCTCTGGGAGGG - Intergenic
924477697 1:244395915-244395937 TGCAGCCTCAGGCTCAGGGTGGG + Intergenic
1063374971 10:5548825-5548847 TGGACCCTGCAGCTCAGAGCCGG - Intergenic
1064146018 10:12826951-12826973 TGCACCAACAAGCTCAGTGGCGG + Intronic
1067056982 10:43058169-43058191 TGCACCCTCCACCTCAAGGATGG + Intergenic
1067290073 10:44933895-44933917 TCCACCCTCTAGGTCAGAGAGGG - Intronic
1070814355 10:79313507-79313529 TCCACCTCCAAGCTCAGACAGGG + Exonic
1077554527 11:3219485-3219507 TGAAGCCTCAAGCCAAGAGAGGG + Intergenic
1077564892 11:3291484-3291506 TGAAGCCTCAAGCCAAGAGAGGG + Intergenic
1078442725 11:11380657-11380679 TGCACCCGCATCCACAGAGATGG - Intronic
1078776785 11:14401179-14401201 TTCACCCTCAAGCTGCAAGATGG + Intergenic
1079513876 11:21243868-21243890 TGCACCCTTAAGCACACAAAGGG + Intronic
1081799126 11:45845666-45845688 TTCTCCCTTAACCTCAGAGATGG - Intergenic
1082266553 11:50124849-50124871 TGCACACTCAACATTAGAGATGG - Intergenic
1082289536 11:50353719-50353741 TGCACACTCAACATTAGAGATGG + Intergenic
1083307213 11:61767417-61767439 GGCACACTGAGGCTCAGAGAGGG + Intronic
1083335584 11:61919882-61919904 TGGAGACTGAAGCTCAGAGAGGG - Intronic
1085026209 11:73238064-73238086 TGCAGACTCAAGGCCAGAGATGG + Intergenic
1085473101 11:76770726-76770748 TACAGACTGAAGCTCAGAGAGGG - Intergenic
1085735022 11:79031478-79031500 TTCAACCTCAGGATCAGAGAAGG + Intronic
1088369570 11:109074486-109074508 TGCAGCCATAATCTCAGAGAAGG + Intergenic
1090450055 11:126798211-126798233 TGCACCCGGGATCTCAGAGAGGG - Intronic
1090629496 11:128633714-128633736 TTCTCCCACAAGCTCAGTGAAGG + Intergenic
1091626982 12:2128877-2128899 AGCACACACAAGCTCAGAGAAGG + Intronic
1091681914 12:2533434-2533456 TTCTCCTTCACGCTCAGAGAGGG - Intronic
1091989340 12:4942061-4942083 TGAAAACTGAAGCTCAGAGATGG + Intergenic
1092202346 12:6593692-6593714 TGCCCCCTCAAGCTGAGCCAAGG + Intronic
1093250289 12:16794407-16794429 TGTACCCTTAAGCTGGGAGAAGG - Intergenic
1099114807 12:78610690-78610712 TGCAGCATCAAGCTGAGTGATGG - Intergenic
1102719756 12:115005872-115005894 TGCAACCTCAAGGTCAGACAAGG + Intergenic
1103943159 12:124511768-124511790 TGCACCCTCAGGCTTGGAGTGGG + Intronic
1111597251 13:90427791-90427813 GGCACCCACAAGCTCAGGGAGGG + Intergenic
1112049308 13:95630019-95630041 TGCAGCCTCTAGCTCAGACCTGG + Exonic
1113595907 13:111532182-111532204 TGGACCCTCACGCACACAGAGGG + Intergenic
1114030420 14:18573763-18573785 TGCATCCCCATGCTCATAGATGG - Intergenic
1115706454 14:36003896-36003918 AGGACACTAAAGCTCAGAGATGG - Intergenic
1118774793 14:68967042-68967064 TGGACGCACCAGCTCAGAGAGGG + Intronic
1121685861 14:95834583-95834605 AGCACCAGCCAGCTCAGAGATGG + Intergenic
1122133870 14:99621411-99621433 AGCTGCCTCAAGATCAGAGAGGG - Intergenic
1202903685 14_GL000194v1_random:56747-56769 AGGACCCTGAAGCTCAGAGCCGG - Intergenic
1124189613 15:27563437-27563459 TTCACCCTCCAGGCCAGAGAGGG + Intergenic
1124400285 15:29342006-29342028 TGGACCCTCAAGCCCATAGAGGG + Intronic
1127485884 15:59417236-59417258 AGCATCCTCAGGCTCCGAGAGGG - Intronic
1128664036 15:69525305-69525327 TGGAAACTGAAGCTCAGAGAAGG + Intergenic
1130383426 15:83391535-83391557 TGCACCCTCAAGGACAGAGTAGG - Intergenic
1130975261 15:88769011-88769033 TGCACCGTGAATCTCCGAGAGGG + Intergenic
1132718977 16:1306658-1306680 TGCAGCCTCAGGCACAGAGAGGG - Intergenic
1133926558 16:10197639-10197661 GGGACTCTCAAGCCCAGAGAGGG + Intergenic
1135283522 16:21173366-21173388 CTTACCCTCAAGGTCAGAGATGG - Intronic
1139356291 16:66368792-66368814 TCCACAGTGAAGCTCAGAGAGGG + Intronic
1139926470 16:70490474-70490496 TGCTCCATGAAGCTCAGAGAAGG + Intronic
1140608243 16:76566803-76566825 AGTATCCTCAAGCTCACAGATGG - Intronic
1142965576 17:3578976-3578998 GGCACCCACAAGCACAAAGACGG + Intronic
1151777306 17:76214162-76214184 TGCACCCTCAACCTGTGGGATGG + Intronic
1152896419 17:82913948-82913970 TGCAGCCTCACGCCCAGGGAGGG - Intronic
1154355111 18:13619087-13619109 AGCACCCCCAGGCTGAGAGAAGG - Intronic
1155353895 18:24932413-24932435 TAGACTGTCAAGCTCAGAGATGG - Intergenic
1155654717 18:28178604-28178626 TGCACTCTCAAACTCCCAGAGGG - Intergenic
1155890774 18:31265551-31265573 TGCACACTTGGGCTCAGAGAAGG + Intergenic
1157734390 18:50033791-50033813 TTCACCCTCAAGCCCAGACTTGG + Intronic
1160033598 18:75282231-75282253 TGCACCCTCATGCTCCCAGCAGG - Intronic
1160183516 18:76656416-76656438 TGCACCCTCTTGCTCGGAGGAGG + Intergenic
1160240611 18:77119859-77119881 TTCAGCCTCAAGCTCAGGGAAGG - Intronic
1160656621 19:275410-275432 TGCACCTTTAACCCCAGAGAAGG - Intergenic
1161258052 19:3320604-3320626 GTCACCCTCAACCCCAGAGAGGG + Intergenic
1161347877 19:3777175-3777197 TGGACGCTGAAGCCCAGAGAGGG - Intergenic
1162239397 19:9336884-9336906 ACCACCCTCACGCTCAGTGATGG + Intronic
1163228016 19:15978841-15978863 AGGACGCTGAAGCTCAGAGAGGG + Intergenic
1163300089 19:16439728-16439750 TGCACCATGAACCTCAAAGAAGG + Intronic
1163405466 19:17119335-17119357 TGCACCCTGAGGCTCTGAGCAGG + Intronic
1163725121 19:18918856-18918878 AGAACCCTAAAGTTCAGAGAAGG - Intronic
1165002479 19:32776390-32776412 TGCAGCCCCAAGATCAGAGCTGG + Intronic
1166545794 19:43634467-43634489 TGCACCCTCAAGCAGAGAGCAGG - Intronic
1166996647 19:46722681-46722703 TGCACCCTCAGGCCCTGAGCAGG - Intronic
925636233 2:5943387-5943409 TGCACCCATAAGCTCAGATTTGG + Intergenic
925666837 2:6266039-6266061 TGCACCTTGCAGCTCTGAGATGG - Intergenic
927017363 2:18979150-18979172 TCCTCCCTCAACCTCAAAGAAGG - Intergenic
929133136 2:38598163-38598185 TGCCTCCTCAACCTCAGAGGTGG + Intronic
930014130 2:46958871-46958893 ACCACCCTCATGCTCACAGACGG - Intronic
930382522 2:50649576-50649598 TCCACCCTCAAGCAAAGAGGGGG - Intronic
932795532 2:74692173-74692195 TGCACCCTGAAGTTGTGAGAAGG - Intergenic
936766152 2:115850992-115851014 TGTAACCTCAAGGGCAGAGAAGG + Intergenic
938970380 2:136425864-136425886 ACCACCCTCAAGCCCATAGAAGG - Intergenic
942831771 2:180244920-180244942 TGCACAGTTCAGCTCAGAGAAGG + Intergenic
948692296 2:239714266-239714288 TGCTCCCTTGAGCTCAGAGTAGG + Intergenic
1168954221 20:1823564-1823586 AGGACCCTGAGGCTCAGAGAGGG + Intergenic
1172654283 20:36527553-36527575 TGGGCCCTCAACCGCAGAGAGGG - Exonic
1175665873 20:60859497-60859519 TTCTCCCTAAAGCTCAGAGAAGG + Intergenic
1176297008 21:5079157-5079179 AGCACCCACAAGCACAGAGCCGG + Intergenic
1176623048 21:9071516-9071538 AGAACCCTGAAGCTCAGAGCCGG - Intergenic
1177260126 21:18719289-18719311 CACCCCCTCAACCTCAGAGAAGG + Intergenic
1179555524 21:42173133-42173155 TGCACCCGCATTCTCGGAGAGGG + Intergenic
1179860020 21:44182790-44182812 AGCACCCACAAGCACAGAGCCGG - Intergenic
1180454533 22:15500819-15500841 TGCATCCCCATGCTCATAGATGG - Intergenic
1180951525 22:19722674-19722696 TGATCCCCCAAGGTCAGAGAGGG - Exonic
1182551354 22:31102499-31102521 TGCACACACACACTCAGAGAAGG + Intronic
1184359221 22:44004113-44004135 TTCTCACTCAAGCTCAGAAAAGG - Intronic
1184574849 22:45355241-45355263 TGCACCTCCAGGCTCAGAGAGGG - Intronic
1184780386 22:46646129-46646151 AGCACCCTCCAGCTCAGCCAGGG - Intronic
1185062259 22:48613154-48613176 TGCTCCCTAGAGCTCAGTGAAGG - Intronic
950194669 3:11000684-11000706 TGCAAACTGAGGCTCAGAGAGGG - Intronic
952165390 3:30743238-30743260 TTCATCTTCAAGCTCACAGAAGG + Intronic
953478853 3:43231566-43231588 AGCACCCGAAAGCTCTGAGAGGG - Intergenic
954749353 3:52804890-52804912 GGGATCCTCAGGCTCAGAGAGGG - Intronic
955370874 3:58350636-58350658 AAAACCCTGAAGCTCAGAGAGGG - Intronic
955437959 3:58923937-58923959 TGCAAACTAAAGCACAGAGAGGG - Intronic
956163957 3:66382460-66382482 TTCACTGTCAAGCTCAGAAAGGG + Intronic
957608222 3:82431854-82431876 TACAGGCACAAGCTCAGAGAAGG + Intergenic
959624786 3:108437688-108437710 GGCACCCTCAAGCTGACAAAAGG + Exonic
965261512 3:166491066-166491088 TGGAAACTCAAGCTCAGAGAAGG + Intergenic
969869471 4:10095742-10095764 TGCACCCTCAGCCACAGGGAGGG - Intronic
971375190 4:26050481-26050503 AGCAGCCTCAAGCTCAGAAGCGG + Intergenic
973906355 4:55535820-55535842 TGCAACCTCCACCTCAGAGATGG + Intronic
981146175 4:141327455-141327477 TGCACCCTAAACCTCAGAATGGG - Intergenic
984686658 4:182676424-182676446 TGGACACTAAGGCTCAGAGAAGG - Intronic
989685083 5:44075824-44075846 TGCACACTTAATCTCAGAGTTGG - Intergenic
993167815 5:84381075-84381097 TGCAACTTCAAGATCAAAGAAGG + Intronic
993740497 5:91532442-91532464 TGCAACCTCAAGTTCAGTGATGG - Intergenic
994005167 5:94828794-94828816 GGGACCCTCAAGCTTAGTGATGG - Intronic
995009382 5:107240483-107240505 TGCACCCACAAGCTCATGGGAGG - Intergenic
997703028 5:135918156-135918178 TGCACACTCCAGGTGAGAGACGG + Intergenic
997709642 5:135993128-135993150 TGCACCCTTGGGCTCAGAGCAGG + Intergenic
997713923 5:136028610-136028632 TGTAGCCTCAAGATCAGTGAGGG + Intergenic
999275697 5:150328647-150328669 TGTAACATCAGGCTCAGAGAGGG - Intronic
999369879 5:151048221-151048243 TGCACCCTGAACCTCCGCGAGGG + Intronic
1001246236 5:170107439-170107461 ATCACCCTCAGGCTGAGAGACGG + Intronic
1001296898 5:170504659-170504681 AGCACCCCCAAGCCCAGACAGGG - Intronic
1003103605 6:3196184-3196206 TGCACCATCATGTCCAGAGACGG - Intergenic
1007260150 6:40557655-40557677 TGCATCCAAAAGCTCAGAGATGG + Intronic
1011625719 6:89281982-89282004 TGCCCCCACCAGGTCAGAGAGGG - Intronic
1011746254 6:90410511-90410533 GTCAACCTCTAGCTCAGAGATGG - Intergenic
1018240582 6:161770303-161770325 AGCACCCCCAAGTTCAGAAAAGG - Intronic
1018265421 6:162019419-162019441 TGCACCCTCAAGCTCAGAGATGG + Intronic
1019365648 7:631366-631388 GGCACCCTCAGGCCCAGACAGGG + Intronic
1019925913 7:4191691-4191713 TGCAGACTCAACCCCAGAGAAGG - Intronic
1020282779 7:6658641-6658663 TGCACACTCAAGTTCAATGACGG - Intergenic
1021364729 7:19763056-19763078 TGCACACCCAGGCACAGAGAAGG - Intronic
1023096278 7:36662799-36662821 TCTACTCTCCAGCTCAGAGATGG - Intronic
1023493746 7:40772068-40772090 TGCCCCCTCAAGCTCCCTGAAGG + Intronic
1027429323 7:78093963-78093985 TGCTCCCTCCAGCCCATAGAAGG - Intronic
1027977099 7:85172791-85172813 TGCAGTCTCATGCCCAGAGACGG - Intronic
1033121318 7:138669089-138669111 TTCGCCCTCAAGCACAGGGAAGG + Intronic
1037584966 8:20269954-20269976 GGCACCCTCAAGCAGAAAGAGGG + Intronic
1039827701 8:41189010-41189032 TGCACCCCCAAGGGGAGAGAAGG - Intergenic
1044697185 8:94935266-94935288 TGGACCCTCAACCTAAGAGAGGG + Intronic
1045863183 8:106836093-106836115 GACACCCTCATGCTCAGAGCAGG + Intergenic
1048232519 8:132658046-132658068 TACACCATGAAGCTCAAAGATGG + Intronic
1048900231 8:139030193-139030215 TGCACACACACACTCAGAGATGG + Intergenic
1049102700 8:140590674-140590696 TGCACCCTCCAGCCCTGAGCAGG + Intronic
1051715649 9:19980417-19980439 TGCACCATCAAGTGCAGGGAAGG + Intergenic
1052729182 9:32265238-32265260 TCTAATCTCAAGCTCAGAGATGG - Intergenic
1054814977 9:69466111-69466133 TTCTCCCCCAAGCTCAGAGCTGG - Intronic
1055988939 9:82084248-82084270 TGCACTCTCAAGGTCAGATGTGG - Intergenic
1057503447 9:95614052-95614074 TGCTCCCATCAGCTCAGAGAAGG - Intergenic
1059438825 9:114291350-114291372 TTAAACCTCGAGCTCAGAGAGGG - Intronic
1059653395 9:116335360-116335382 AGGACACTGAAGCTCAGAGAAGG - Intronic
1060767727 9:126307583-126307605 TACAGCCACATGCTCAGAGATGG - Intergenic
1061010197 9:127950207-127950229 TTCCCCATCAAGTTCAGAGAGGG - Intronic
1062259861 9:135656113-135656135 TGACCCCTCGAGCTTAGAGAGGG - Intergenic
1203746237 Un_GL000218v1:41943-41965 AGAACCCTGAAGCTCAGAGCCGG - Intergenic
1203563866 Un_KI270744v1:77538-77560 AGGACCCTGAAGCTCAGAGCCGG + Intergenic
1185690958 X:2154938-2154960 AGAACCCTAAACCTCAGAGAGGG + Intergenic
1186448054 X:9648735-9648757 AGAACTCTCAAGCACAGAGAAGG - Intronic
1189568492 X:42270194-42270216 TGCACCCACAAAATGAGAGAGGG - Intergenic
1189971796 X:46425523-46425545 TACCACCTCAAGCTAAGAGAGGG + Intergenic
1191860838 X:65665755-65665777 TGGAAACTCAAGCCCAGAGAGGG + Intronic
1192928149 X:75777953-75777975 TTCACTCTCCAGCTCTGAGAGGG - Intergenic
1194448391 X:94013750-94013772 TGCACCCACAAGCTGCCAGATGG + Intergenic
1195418393 X:104645222-104645244 TGTAGTCTTAAGCTCAGAGATGG - Intronic