ID: 1018266440

View in Genome Browser
Species Human (GRCh38)
Location 6:162029436-162029458
Sequence CACATCCTTGTATTTCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018266439_1018266440 1 Left 1018266439 6:162029412-162029434 CCTGAAGTTAAGGGATGTGGCTT 0: 1
1: 0
2: 1
3: 15
4: 136
Right 1018266440 6:162029436-162029458 CACATCCTTGTATTTCCCACAGG 0: 1
1: 0
2: 0
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018266440 Original CRISPR CACATCCTTGTATTTCCCAC AGG Intronic
901008460 1:6183534-6183556 CACATTCTTTTTTTTCCCCCAGG - Intronic
901063564 1:6484870-6484892 CACATGCGTGTATTCCCCAAAGG - Intronic
901567240 1:10128075-10128097 CACTTCCTTTTATCTGCCACAGG - Intronic
903778025 1:25805673-25805695 CACATCCATCTCTTCCCCACGGG + Intronic
905450040 1:38050395-38050417 CACATGCCTGTATTTACCACTGG - Intergenic
907190845 1:52647308-52647330 CATAACCTTGTATTTCCCCTAGG + Intronic
907517864 1:55004695-55004717 CACATCTTTTCATTTCCCAGGGG - Intronic
907865804 1:58397991-58398013 CACACCCTTGGATTTCCTTCAGG + Intronic
908323513 1:63001040-63001062 AACTTCCATGTACTTCCCACTGG + Intergenic
908788180 1:67755453-67755475 TAGATCCTTGTATCTCCCAGAGG + Intronic
915277074 1:154796429-154796451 CACGTCTCTGTATTTCCCATTGG + Intronic
916604411 1:166326667-166326689 CATGTCCCTGTCTTTCCCACAGG - Intergenic
917083556 1:171282117-171282139 GACATCATTGTCTTTGCCACTGG + Exonic
917514813 1:175698533-175698555 CACCACCTCTTATTTCCCACTGG - Intronic
917649367 1:177061597-177061619 AACAACCTTGTATTTACCTCGGG - Intronic
917866976 1:179205433-179205455 CACTTCCTTTTATATCTCACTGG - Intronic
1063215030 10:3916780-3916802 AACATCTTCGTATTTCCAACAGG - Intergenic
1063233937 10:4092964-4092986 TACATCCTTATAATTTCCACTGG - Intergenic
1070504104 10:77097985-77098007 GACATCCCGGTATTCCCCACTGG - Intronic
1070848710 10:79545229-79545251 CACATCTTTGTTTTACCCACTGG + Intergenic
1070925076 10:80214962-80214984 CACATCTTTGTTTTACCCACTGG - Intergenic
1073596640 10:104807069-104807091 CACATCCTAGATTTTCCCAGAGG - Intronic
1078872465 11:15361677-15361699 CAAATCCTTAACTTTCCCACTGG + Intergenic
1079878939 11:25899158-25899180 CACATAATTGGATCTCCCACAGG + Intergenic
1083851632 11:65371052-65371074 CACATCCTTAGATGTCCCAAAGG - Intergenic
1083911854 11:65714462-65714484 TACAACCTGGTATTTTCCACTGG + Intronic
1085838030 11:79977215-79977237 CACTTCCTGGTATATCCCCCAGG + Intergenic
1087248114 11:95864114-95864136 CACATCCTTGAATATCCCATAGG - Intronic
1088225844 11:107619004-107619026 CACATTCTTGTCTTTCACTCGGG + Intronic
1089554146 11:119306057-119306079 GAAATACTGGTATTTCCCACTGG - Exonic
1091113995 11:132996808-132996830 GACATCCTTGTCTTCCCTACTGG - Intronic
1092139418 12:6172479-6172501 CACTTCCTTGTCATTCACACAGG - Intergenic
1098808687 12:75055254-75055276 CATATCATTTTAATTCCCACTGG - Intronic
1100141512 12:91624515-91624537 CTCTTGGTTGTATTTCCCACTGG + Intergenic
1102257040 12:111421879-111421901 CACATCCTTTCATTTCTCTCAGG + Intronic
1102621750 12:114201745-114201767 CCCACCCTTGTATTTCCTAGGGG - Intergenic
1105580448 13:21691072-21691094 CCCAACCCTGTATTTCCCCCGGG + Intronic
1105882653 13:24617573-24617595 CACATGTTAGTATTTCCCAGAGG + Intergenic
1107579351 13:41765631-41765653 CACATGCTTATTTTTCCCACTGG + Intronic
1108437766 13:50417422-50417444 CCCATCTTTGTATTTGCCAGAGG - Intronic
1111178621 13:84632814-84632836 CCTAACCCTGTATTTCCCACAGG + Intergenic
1112598152 13:100828947-100828969 CATAACCTTGTATTTCCCCTAGG - Intergenic
1114406646 14:22463085-22463107 GACAGCATTGTACTTCCCACTGG - Intergenic
1114572559 14:23683519-23683541 CACAACATTTTATTTACCACAGG - Intergenic
1115451227 14:33550010-33550032 CAAATTCTGGTATTTTCCACTGG - Intronic
1116222334 14:42104334-42104356 CCCAACCTTGTGTTCCCCACTGG + Intergenic
1117546749 14:56799032-56799054 CAAATCTTTATCTTTCCCACAGG - Intergenic
1120785887 14:88535334-88535356 CACATGGCTGTATTTCCCCCGGG + Intronic
1121579593 14:95017788-95017810 TAAATCCTTGTATTTCCCAGAGG - Intergenic
1125392929 15:39214503-39214525 CACATCATTATATCTCCCAGAGG + Intergenic
1127809633 15:62552836-62552858 CATAACCTTGTATTTCCCCTAGG + Intronic
1132336549 15:101051804-101051826 CACATCCTCTGATTTCTCACTGG - Exonic
1134873844 16:17677775-17677797 CACATAAATGTATTTCCCAGAGG - Intergenic
1135428839 16:22364462-22364484 CACACTCTTGAACTTCCCACCGG - Intronic
1135946770 16:26871999-26872021 AACATCCTTGTATTTGCCAAAGG - Intergenic
1138191512 16:55017524-55017546 CACATCCTCGTTTTTACCAGGGG - Intergenic
1138664314 16:58551427-58551449 CCCATCCTTATATTTCCCAGAGG - Intronic
1143358515 17:6348992-6349014 CATATCTTTGAATTTCACACGGG - Intergenic
1143853552 17:9831606-9831628 CTCATCCTTGCACTTCCCATTGG - Intronic
1146891859 17:36511455-36511477 CCCATCCTTTTCTTTCCCCCAGG - Exonic
1152905790 17:82970242-82970264 CACATCCGTGAATACCCCACGGG + Intronic
1153920233 18:9782360-9782382 CCCACCCTTGTTCTTCCCACTGG + Intronic
1155424178 18:25688993-25689015 CACATTCTTCTCCTTCCCACTGG + Intergenic
1156172483 18:34503204-34503226 TCCATCCTTGTACTTTCCACTGG + Intronic
1158012713 18:52747856-52747878 AACTTCCTTGTATTGCACACAGG - Intronic
1159018706 18:63125124-63125146 CACTTCCTAATTTTTCCCACTGG + Exonic
1159477688 18:68944233-68944255 CCCAGCCTTGTTTTTCCCATAGG - Intronic
1161701400 19:5797912-5797934 CACATGCCCGTCTTTCCCACTGG + Intergenic
928292755 2:30054062-30054084 TACATCCCTGTTTTTCACACAGG + Intergenic
930015577 2:46968287-46968309 CACTGCCTTGTGATTCCCACCGG - Intronic
935039941 2:99416567-99416589 CACAGCCTTGAATTTCCTAAGGG - Intronic
935666130 2:105514552-105514574 CACAGTCTTGTTTTCCCCACAGG - Intergenic
936954499 2:118010995-118011017 CACATGCTTGTCTTTGCAACTGG + Intronic
937329156 2:121014297-121014319 CATAACCTTGGATTTGCCACTGG + Intergenic
941356979 2:164505517-164505539 CAGATACCTGTATTTTCCACAGG - Intronic
942408442 2:175681086-175681108 CAAATCCTTGTAATTCCTAATGG + Intergenic
942641602 2:178066702-178066724 CACATCCTTGCACTTCCCTGAGG - Intronic
945371819 2:209027944-209027966 CATAACCTTGTATTTTCCATAGG - Intergenic
946112890 2:217435822-217435844 CACATACTTTCATCTCCCACAGG - Intronic
946507689 2:220318967-220318989 CACATCCCTGTACCTCCTACAGG + Intergenic
947653839 2:231809633-231809655 TTCATTCTTGTTTTTCCCACTGG + Intergenic
1171120121 20:22561148-22561170 TAAAACTTTGTATTTCCCACAGG + Intergenic
1171366875 20:24631030-24631052 GACACCCTTGGATTGCCCACAGG + Intronic
1173288239 20:41692116-41692138 CAAAGCCTTGTATTTCCACCAGG + Intergenic
1174536341 20:51254317-51254339 CACAGCCTTCCACTTCCCACAGG - Intergenic
1175963972 20:62651022-62651044 CACATTCATGCATTTCCCAAAGG - Intronic
1177433711 21:21023989-21024011 TACATCTTTTTATTACCCACAGG - Intronic
1179214225 21:39352145-39352167 CACTCCTTTGTATTTCCTACTGG + Intergenic
1182617149 22:31594901-31594923 TACATCTTTTTAGTTCCCACAGG + Intronic
1184446041 22:44547527-44547549 CCCATCCTTGTACCTCCCGCAGG + Intergenic
1184699914 22:46163804-46163826 CACATCCTTGTCACTCCCATGGG - Intronic
952772594 3:37016076-37016098 CAAATCTTTTTATTTCCAACAGG - Intronic
953004332 3:38964075-38964097 CACATGTTTTAATTTCCCACAGG - Intergenic
953004773 3:38968102-38968124 GACCTCCCTGTATTTCCTACAGG - Intergenic
953498458 3:43409244-43409266 CACTTCCTTTTATTTCCTAACGG - Intronic
955323793 3:57994215-57994237 CACATGCTTTTATTTCCCTTGGG + Intergenic
964119429 3:153166887-153166909 CATATTCTAGTATTTCTCACAGG + Exonic
965733416 3:171796211-171796233 CACAACTCTGTCTTTCCCACTGG - Intronic
967844946 3:194035821-194035843 CACATCCCTGTTCCTCCCACAGG - Intergenic
968447965 4:661973-661995 CCCATCCCTGCGTTTCCCACTGG - Intronic
969206268 4:5648892-5648914 CTCATCCTTTAATTTCCCAAAGG + Intronic
970545886 4:17129612-17129634 CCCATCCAGGTATTTCCCAATGG + Intergenic
971602360 4:28609837-28609859 CACATGCTTATAATTCCAACAGG - Intergenic
972381371 4:38523285-38523307 CACATCCTTGTTCTCACCACTGG + Intergenic
973598827 4:52520847-52520869 CAAATCCTTCGATTTCCCATAGG - Intergenic
974031452 4:56780373-56780395 CATCTCCTGGGATTTCCCACGGG - Intergenic
974387261 4:61217880-61217902 CACAGCCTTGTCTTTAGCACTGG - Intronic
974398095 4:61366411-61366433 AACATCTTGTTATTTCCCACTGG - Intronic
975877320 4:78856955-78856977 CAAATCACTGTCTTTCCCACTGG + Intronic
977447545 4:97149903-97149925 AACATTTTTGTATCTCCCACAGG + Intergenic
980591640 4:134897189-134897211 CACACACTGGTATTTCTCACAGG + Intergenic
983896760 4:173089296-173089318 CAAAGCCTTGTATTTCCCTCAGG - Intergenic
984035176 4:174658523-174658545 CACTTTATTGTGTTTCCCACAGG + Intronic
984303385 4:177953853-177953875 CACAGACATTTATTTCCCACTGG + Intronic
985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG + Intronic
986133459 5:4952163-4952185 CACCTCTTTCTATTTCCCTCTGG - Intergenic
989462916 5:41722127-41722149 CACATCCTTACATTTGCCACAGG - Intergenic
990447946 5:55910288-55910310 CACAACCTTGAATTTCACAATGG - Intronic
992707621 5:79413144-79413166 GACTTTCTAGTATTTCCCACAGG - Intronic
992762644 5:79964670-79964692 CTCTTCCTTGTATTTCCAATGGG + Intergenic
993068049 5:83125724-83125746 CACATGCCTGTAATTCCAACAGG + Intronic
994146400 5:96400754-96400776 CACATCCTTGAATATCCCCATGG - Intronic
996299413 5:121963165-121963187 CTTATCCCTGTATTACCCACGGG - Intronic
996361600 5:122653871-122653893 CTCATTCTTGTATTTCCCAGTGG - Intergenic
997386169 5:133474468-133474490 CAAATCCTGGCATTTTCCACTGG - Intronic
998766061 5:145488405-145488427 CACTCCCGTGTTTTTCCCACCGG + Intronic
999288772 5:150409850-150409872 CTCATCCTTGCAGTTCCCAATGG - Intronic
1000321679 5:160139338-160139360 CACTTCCTCCTCTTTCCCACAGG + Intergenic
1000814715 5:165906518-165906540 CACATCTCTGTATGTCACACGGG - Intergenic
1002644927 5:180648441-180648463 TACATGCTTGTAATTCTCACAGG - Intronic
1002982062 6:2147686-2147708 AACAAGCTTGTATTTCTCACAGG + Intronic
1004747997 6:18531736-18531758 TAAATCTTTTTATTTCCCACTGG + Intergenic
1004790642 6:19022434-19022456 CACATGCTTGTATTCTCCTCGGG + Intergenic
1007497522 6:42270442-42270464 AACTTCTTTATATTTCCCACAGG - Intronic
1007937165 6:45742735-45742757 AACATTCTTGTGTTGCCCACTGG + Intergenic
1008334084 6:50279285-50279307 CTTAACCCTGTATTTCCCACAGG - Intergenic
1008410717 6:51175417-51175439 TACATACTTGTTTTTCCCATAGG - Intergenic
1008581465 6:52911795-52911817 TACATACATATATTTCCCACTGG - Intergenic
1010736188 6:79446163-79446185 AACATAATTGTATTGCCCACTGG + Intergenic
1010763895 6:79756517-79756539 CACTTCTCTGTATTTCCCAAAGG - Intergenic
1012492066 6:99793158-99793180 CAAATGCCTGTCTTTCCCACTGG - Intergenic
1017156526 6:151327202-151327224 CACATTCTTGTAAATTCCACTGG - Intronic
1017967022 6:159275812-159275834 CACCTCCCTGTAGTTTCCACAGG + Intergenic
1018266440 6:162029436-162029458 CACATCCTTGTATTTCCCACAGG + Intronic
1021157583 7:17230796-17230818 CATATCCTTGTTTGTCCCAGGGG + Intergenic
1022326977 7:29341287-29341309 CACATCCTTGTTTGTCTTACAGG - Intronic
1022402572 7:30053827-30053849 CCTAACCTTGTATTTCCCCCAGG - Intronic
1023161058 7:37296263-37296285 CTCTTCCCTCTATTTCCCACTGG + Intronic
1023967231 7:44969371-44969393 CACATCCCTGGCTTTCCCACAGG - Intronic
1024522903 7:50322725-50322747 CACATCCTTCACTTTCCCACCGG - Intronic
1025006336 7:55358205-55358227 CAAACCCTTGTATGTCCCATAGG + Intergenic
1026326794 7:69317563-69317585 TCCATCCCTTTATTTCCCACAGG - Intergenic
1026326909 7:69318300-69318322 CCCATTCCTTTATTTCCCACAGG + Intergenic
1026536504 7:71242826-71242848 CACATCCTTTTATGTCTCCCAGG + Intronic
1026567354 7:71500608-71500630 CACTTCCTTGCTTGTCCCACTGG + Intronic
1027847201 7:83395943-83395965 CATAACCCTGTATTTCCCATGGG + Intronic
1027914274 7:84295131-84295153 CAAATCCTTTTATATCCCACAGG - Intronic
1030231972 7:107217559-107217581 CACATCCTTGCATTTCTCCCAGG - Intronic
1030647639 7:112081201-112081223 TACTTCCTTGAATTGCCCACAGG - Intronic
1031066833 7:117114605-117114627 GACATCTTTCTATTTCCCATGGG + Intronic
1036418879 8:8577422-8577444 CACCTCTGTGTATTTCCCACTGG - Intergenic
1037668735 8:20996497-20996519 CTCATTGTTGCATTTCCCACAGG + Intergenic
1038749091 8:30279766-30279788 CCCCTCCTAGTTTTTCCCACTGG - Intergenic
1038943373 8:32330462-32330484 CACATCCTTCACTTCCCCACAGG - Intronic
1039037564 8:33376317-33376339 CACATTTTTATATTTCCAACTGG - Intronic
1039933338 8:42015464-42015486 TACATCTTTGTATTGCCCACAGG - Intronic
1040761131 8:50845536-50845558 CTTATACTTGTATTTCCCCCAGG + Intergenic
1044261796 8:90133586-90133608 CACATCCTTGAAATTCACCCTGG - Intergenic
1045093209 8:98768764-98768786 CACATACGTGTTTTTCTCACTGG - Intronic
1045341672 8:101260502-101260524 CACATCCTGCTTTGTCCCACAGG - Intergenic
1046598866 8:116294479-116294501 TACATTCTTGTCTTTACCACTGG - Intergenic
1047414616 8:124653807-124653829 CACATGCTTGTATATCCTAGGGG - Intronic
1048253950 8:132891006-132891028 AACATCCTTGGTTTCCCCACTGG - Intronic
1051096970 9:13477402-13477424 CACATCCTTGGATGTCCACCAGG - Intergenic
1051782089 9:20700179-20700201 CACCTCTGTGTATTTCCCATTGG - Intronic
1055089325 9:72346861-72346883 CACATTCCTGTATTTGACACTGG - Intergenic
1056068142 9:82958323-82958345 AACCTCCTTGTATGTCCCCCTGG + Intergenic
1059928181 9:119233714-119233736 CACATCCATGTATTACCAACCGG + Intronic
1060363910 9:122989450-122989472 CAGCTTCTTGTATTTCACACCGG - Exonic
1062112062 9:134787402-134787424 CCAAACCTTGTATTTCTCACAGG - Intronic
1188729595 X:33630648-33630670 CACATCCCTCTACTTCCAACTGG + Intergenic
1192306659 X:69967460-69967482 CTCCTCCTTGAATTTCCCACTGG - Intronic
1196150843 X:112371834-112371856 CATATTATTGTTTTTCCCACAGG - Intergenic
1198033232 X:132775652-132775674 CACATCATTGTATTACCAAATGG + Intronic
1198039393 X:132835146-132835168 CACAGCCTGGTATTTTCCAAAGG - Intronic
1198485846 X:137086899-137086921 CACATCCCTGGCTTTCCCAGAGG - Intergenic
1200167228 X:154045188-154045210 CAGGTCCTTCTATTTGCCACCGG - Intronic