ID: 1018275489

View in Genome Browser
Species Human (GRCh38)
Location 6:162125856-162125878
Sequence TGTGACTCCGTTACAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018275489 Original CRISPR TGTGACTCCGTTACAGTTGG AGG Intronic
904707474 1:32402248-32402270 GGTGTCTCTGTTAAAGTTGGAGG + Intergenic
905515402 1:38558655-38558677 TCTGCCTCCCTTACAGCTGGGGG + Intergenic
913544900 1:119858652-119858674 TGTGATTCTGTTACAATTTGTGG + Intergenic
1066232882 10:33454924-33454946 AGTGACTCCATTCCAGTTTGGGG + Intergenic
1069105643 10:64380383-64380405 TGTTACTCTGTTTCAGTTGCAGG + Intergenic
1076230328 10:128815019-128815041 TTTCACTCAGTTACAGCTGGGGG + Intergenic
1079058545 11:17228276-17228298 CGTGACGCCGGTGCAGTTGGGGG + Intronic
1089237289 11:117041309-117041331 TGTGACTACCATACAGTTTGAGG - Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1100790715 12:98127058-98127080 TCTGGCTCCGTTAATGTTGGTGG - Intergenic
1105834256 13:24194548-24194570 TCTGAATCCGTAACAGTTTGAGG + Intronic
1107885569 13:44872026-44872048 TGTGAATCCCTTCCAGTTTGGGG + Intergenic
1114805385 14:25829647-25829669 TGTAACTCAGTTACAATTGAGGG + Intergenic
1126568862 15:50128536-50128558 TGTGACTCTGTGACAGTAGAGGG - Intronic
1128268698 15:66290259-66290281 TGTGACTGAGTTCTAGTTGGCGG - Intergenic
1128453015 15:67818002-67818024 TATGAATACGTTACAGTTGTGGG + Intergenic
1130447670 15:84018662-84018684 TGTGACTAGGGTACAGTTGAGGG + Intronic
1162969682 19:14172841-14172863 TGTGAAACCGTGACAGTTGATGG - Intronic
1163185665 19:15637648-15637670 TGAGACTCCTTGACAGCTGGTGG + Intronic
927307926 2:21595156-21595178 AGTGACACCGTCACAGTTGCTGG + Intergenic
927624420 2:24699362-24699384 TGTGACTAGGCTACAGTTGAAGG + Intronic
929260939 2:39865952-39865974 TGTGGCTTCCTTACATTTGGTGG + Intergenic
929549590 2:42880925-42880947 TGTGACTCCCATCCTGTTGGTGG + Intergenic
936597832 2:113866198-113866220 TGTGACTCTGAAACAGCTGGAGG + Intergenic
946753125 2:222913600-222913622 TGTGAGTGAATTACAGTTGGGGG - Intronic
948988197 2:241538891-241538913 TCTGACTCCTTTAAATTTGGTGG - Intergenic
1175832565 20:61974238-61974260 TGTGGGTCCGTCACAGTAGGTGG + Intronic
1177194051 21:17883492-17883514 TCTGGCTCCAATACAGTTGGCGG + Intergenic
1178639786 21:34336670-34336692 TGTGAACACGTTACAGTTGAAGG - Intergenic
1184835474 22:47018568-47018590 TGTGAGTCAGTCACTGTTGGTGG + Intronic
951612721 3:24509719-24509741 TGTGACTGCCTTAGAGTTTGTGG - Intergenic
957905231 3:86544779-86544801 TGTGAGGCCTCTACAGTTGGTGG + Intergenic
964820681 3:160765425-160765447 TGTGTCTCTGTGACAGGTGGTGG + Intronic
966368230 3:179214499-179214521 TGTTACTCTGATGCAGTTGGGGG - Intronic
968927178 4:3555685-3555707 TGTGCCTGGGTTACAGCTGGTGG + Intergenic
969580037 4:8059393-8059415 GGAGACACCGTTAGAGTTGGAGG - Intronic
975211968 4:71711549-71711571 TGTGTGCCTGTTACAGTTGGTGG - Intergenic
985554403 5:549934-549956 AGTGACTCCATCACAGCTGGAGG - Intergenic
986852068 5:11825015-11825037 TGTGAGTCTGTTAGTGTTGGAGG - Intronic
996994788 5:129682346-129682368 TGTGACCATGTTACAGTTGAGGG - Intronic
997443728 5:133926546-133926568 TGTGCCTCCGTTACAGTCTGTGG + Intergenic
998866950 5:146515107-146515129 TGAGACTCTGAGACAGTTGGAGG + Exonic
1006258340 6:32848717-32848739 GTTGACTCCCTTACACTTGGAGG - Exonic
1018275489 6:162125856-162125878 TGTGACTCCGTTACAGTTGGAGG + Intronic
1020826115 7:13031134-13031156 TGTGCCTGTGTTACAGATGGAGG - Intergenic
1027200546 7:76061387-76061409 TGGGACTCTGTTACAGGTGTGGG + Intronic
1029253091 7:99250866-99250888 TGTGGCTCCGTGACACTGGGAGG - Intergenic
1031632912 7:124065690-124065712 GGTGTCTCAGTTACAGTTTGGGG + Intergenic
1041139661 8:54803425-54803447 TTTGACTCTGTAACAGTTGATGG + Intergenic
1048434044 8:134399299-134399321 GTTGACTCCGTGGCAGTTGGTGG - Intergenic
1049578233 8:143399284-143399306 TGTGGCTCCGTGAGGGTTGGGGG + Intergenic
1050316953 9:4412263-4412285 TGTGACTTTGTTACATTTGGGGG + Intergenic
1054462876 9:65475075-65475097 TGTGCCTGGGTTACAGCTGGTGG - Intergenic
1060744305 9:126120204-126120226 TGGGAGTCCATTACAGTTGAAGG + Intergenic
1189198408 X:39170863-39170885 TGTGTCTCTGTTACAGTTAGAGG - Intergenic
1196574209 X:117299856-117299878 TGGGACTATGTTACTGTTGGGGG + Intergenic
1199035370 X:143043773-143043795 TGTGACTGAGTTCCAGTTAGTGG + Intergenic
1201942483 Y:19474733-19474755 TGTGTTTCCTTTCCAGTTGGAGG + Intergenic