ID: 1018276028

View in Genome Browser
Species Human (GRCh38)
Location 6:162132653-162132675
Sequence CACCTGAAGTGGAAATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018276022_1018276028 -5 Left 1018276022 6:162132635-162132657 CCAATAAGAGGTGGTGACCACCT 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1018276028 6:162132653-162132675 CACCTGAAGTGGAAATGGGGAGG No data
1018276019_1018276028 19 Left 1018276019 6:162132611-162132633 CCAGTATGACATCTATTAATTAT 0: 1
1: 1
2: 1
3: 14
4: 211
Right 1018276028 6:162132653-162132675 CACCTGAAGTGGAAATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018276028 Original CRISPR CACCTGAAGTGGAAATGGGG AGG Intronic
No off target data available for this crispr