ID: 1018276664

View in Genome Browser
Species Human (GRCh38)
Location 6:162139511-162139533
Sequence CAGGGTAAAGAGAATCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018276664 Original CRISPR CAGGGTAAAGAGAATCAGCA TGG Intronic
904759571 1:32792593-32792615 TAGGTTAAAGAAAATAAGCAGGG + Intronic
905697760 1:39988100-39988122 CAAAGTAAAGAGAACCAACAAGG + Intergenic
906650615 1:47509925-47509947 GACGGTAAAGAGAAGTAGCAAGG + Intergenic
906862499 1:49376573-49376595 CAGGTTTAAGAGAATCATCAGGG - Intronic
907369195 1:53988742-53988764 AAGGGGGAAGAGATTCAGCAAGG + Intergenic
907629762 1:56068604-56068626 CAGAGAATAGAGACTCAGCAAGG + Intergenic
907797790 1:57734640-57734662 TAGGGCCAAAAGAATCAGCAAGG - Intronic
907947034 1:59145262-59145284 TAGGGTAATGGGAATGAGCATGG + Intergenic
909477680 1:76099210-76099232 CACCTTAAAGAGAAACAGCAAGG - Intronic
909713641 1:78680603-78680625 CAGGCTACAGAGGATCAGAAAGG + Intergenic
912221211 1:107678012-107678034 CACGGAAAAGGGAATCAGAAAGG + Intronic
912527768 1:110297392-110297414 CAAGGTTAAGGGAATCAACAAGG + Intergenic
912705221 1:111906643-111906665 CAGGGTAGAGAGGAAAAGCAAGG - Intronic
913319402 1:117577824-117577846 CAGGGTAAATAGAATTTGTAGGG - Intergenic
914353254 1:146858436-146858458 CAGGGTAGGGAGAATAAGGAAGG + Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918649669 1:186945640-186945662 AAGGGAAAAGAGAACCATCAAGG + Intronic
918909524 1:190547781-190547803 GTGGGTAAAGAGACTCAGCCCGG + Intergenic
919117379 1:193297205-193297227 CAGTTTAAAGAGACTGAGCAAGG + Intergenic
919230940 1:194773358-194773380 AAGGGTAAATAGCATCAGGAGGG + Intergenic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
922744497 1:228036669-228036691 CAGGGGACAGAGAAGCTGCACGG - Intronic
923800543 1:237204955-237204977 CAGGGTAATGAGCCTCAGCAGGG + Intronic
924903724 1:248429982-248430004 CAAGGGAAAGAGAAGCACCAGGG - Intergenic
924924147 1:248662018-248662040 CAAGGGAAAGAGAAGCACCAGGG + Intergenic
1063276021 10:4568708-4568730 GGGGGTCAAGCGAATCAGCATGG - Intergenic
1064532134 10:16321448-16321470 CAGGGTGAAGAGTATTAGCTAGG - Intergenic
1068184729 10:53570338-53570360 CAGAGTGAAGAAAATAAGCAAGG - Intergenic
1068361584 10:55980642-55980664 CAGGGTAAAAATAAACAGCAAGG + Intergenic
1069583368 10:69579915-69579937 CTGCCTAAAGAGAATCACCATGG - Intergenic
1070602151 10:77873481-77873503 CGGGGTAAACAGAATTATCAGGG - Intronic
1072280885 10:93864133-93864155 CTGGGTTAAGAGAATCTGCAAGG - Intergenic
1072446229 10:95501099-95501121 CAGGGTAAAAGGAATCACCTGGG + Intronic
1072986062 10:100141718-100141740 CAAAGTAGAGAGAATCAGCTGGG + Intergenic
1073522820 10:104150473-104150495 CAGGGTTAAGGGAAACAGCAAGG - Intronic
1074198339 10:111208652-111208674 CAGGGTTATGAGGATCAACAAGG + Intergenic
1074405385 10:113176797-113176819 CAGGGGAAGGAGAAGCAGCCAGG - Intergenic
1075274144 10:121078350-121078372 CAGGGTAGAGAGAATCACAGGGG - Intergenic
1075563371 10:123484641-123484663 CAGAGTCAAGAGACACAGCAAGG - Intergenic
1076391089 10:130102812-130102834 CAGGGTAAAGAATATTACCATGG - Intergenic
1077261128 11:1621642-1621664 CAGCCTGAAGAGAAGCAGCAGGG + Exonic
1081225733 11:40519819-40519841 AAGGGCAAAGCGAAGCAGCAAGG + Intronic
1081714631 11:45240552-45240574 CTGGGCACAGAGAATCAGCTAGG - Exonic
1082868019 11:57917602-57917624 GATGGTAAAGAGGATGAGCAAGG + Intergenic
1082881407 11:58041529-58041551 CAGGGCAAGGAGAAAGAGCAGGG + Intronic
1083170581 11:60922005-60922027 CAGGGCGTAGAGGATCAGCAAGG - Exonic
1083424412 11:62575683-62575705 GAGGGGAAAGAGGAGCAGCAGGG - Exonic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1085766941 11:79291504-79291526 CAGGGAGAAGAGGATCTGCAGGG + Intronic
1086003704 11:82011154-82011176 AAGGGAAAAGGAAATCAGCAAGG + Intergenic
1086072701 11:82816880-82816902 CAGGGTCAAGACAAGCAACAAGG - Intergenic
1086909547 11:92456915-92456937 CTGGGTAAAGAGGATGATCATGG + Intronic
1087777801 11:102272613-102272635 AAGGGAAAAGAGGATCAACAAGG - Intergenic
1088214188 11:107490134-107490156 CAGTGTAGAGAAAATCAGAAAGG + Intergenic
1088548037 11:110981378-110981400 AAGGGTAAAGATAAAAAGCAAGG + Intergenic
1090398080 11:126432273-126432295 CAGGCCACAGAGACTCAGCAGGG - Intronic
1092936323 12:13367357-13367379 CAGGGTAATGAGCCTCAGCAGGG - Intergenic
1093784577 12:23177313-23177335 CAGGAGATACAGAATCAGCAGGG - Intergenic
1093935216 12:24993711-24993733 CAGGGTTAAGGGAAACAGCATGG + Exonic
1093997517 12:25657797-25657819 CAGAGTAAAGAGAATTAACGGGG + Intergenic
1095169105 12:39012439-39012461 CATGATACAGAGAATAAGCATGG - Intergenic
1095284543 12:40392610-40392632 CAGGGTAGAGAGGATTAACAAGG - Intergenic
1096474545 12:51900246-51900268 GAGGGTAAGGAGAAACAGCAAGG - Intergenic
1098840470 12:75471530-75471552 AAGGGCAAAGAGAAGCAGCATGG + Intergenic
1099085942 12:78246060-78246082 CAGGGTAAAGGAAGTCAGCAAGG - Intergenic
1100371722 12:93974906-93974928 CAGGGTATAGAGAAGCCACAAGG + Intergenic
1104834126 12:131776362-131776384 CAGTGTAAACGGAAACAGCAAGG + Intronic
1106061332 13:26295495-26295517 CTGGGTAATGACAATCAGCAAGG + Intronic
1107903168 13:45038408-45038430 CAGGGTACACAGAATCACCTGGG - Intergenic
1108167420 13:47708157-47708179 CAGGGTAAGGAGGATCTGGAAGG - Intergenic
1110520523 13:76470665-76470687 CAGGGCAAAGAGAAACATAATGG - Intergenic
1110697280 13:78505750-78505772 TGGGTTAAAGAGACTCAGCAGGG - Intergenic
1110703615 13:78578830-78578852 ATGGCTAAAGAGAATAAGCATGG + Intergenic
1110810090 13:79803090-79803112 GAGGGGAAAGAGAACCAGCAGGG + Intergenic
1112188377 13:97150156-97150178 CAGAATAAAAGGAATCAGCAAGG + Intergenic
1112386590 13:98945883-98945905 CAAGGTAGAGAGGACCAGCAAGG + Intronic
1112724086 13:102282037-102282059 CAGGGTTAGGAGAAGCGGCAAGG - Intronic
1112946817 13:104938417-104938439 AAGAGGAAATAGAATCAGCAAGG - Intergenic
1115798763 14:36968826-36968848 CAGGGAGAAGAGGCTCAGCAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117354142 14:54907149-54907171 CAGGGGGCAGAGAAACAGCATGG + Intergenic
1118132639 14:62984312-62984334 CAAGCTAAAGGCAATCAGCAGGG + Intronic
1119123144 14:72098332-72098354 CAGGGGACAGAGAAAAAGCAAGG - Intronic
1121777260 14:96598892-96598914 CAGGGGAAAGTGGAGCAGCAGGG - Intergenic
1122318439 14:100839341-100839363 CAGGGCTCAGAGAAACAGCAGGG - Intergenic
1124162088 15:27281084-27281106 CAGAGCAAAGAGAATTACCAAGG - Intronic
1124503069 15:30247505-30247527 CTGGGTAAAGAGAATTTGCCTGG - Intergenic
1124740487 15:32291141-32291163 CTGGGTAAAGAGAATTTGCCTGG + Intergenic
1124881510 15:33646988-33647010 CAGGGGAAAGAAAGACAGCAAGG - Intronic
1126425992 15:48527408-48527430 CAGGGCACAGGGAATCTGCATGG + Intronic
1127638434 15:60893086-60893108 CAGGCTGAAGAGAATCACCAGGG + Intronic
1128508762 15:68300591-68300613 CAGGGTAAATAGATTCAGAAAGG + Intronic
1129504756 15:76072009-76072031 CAGGGAAGAGAGAGCCAGCAGGG + Intronic
1129699154 15:77757682-77757704 CAGGGCAAAGAGAGCCAGCAGGG + Intronic
1130016787 15:80193566-80193588 TAAGGTAAAGAGAATCAGTAAGG - Intergenic
1131872008 15:96773187-96773209 CTAGGGAAAGAGAATCTGCAGGG - Intergenic
1131947077 15:97635278-97635300 CAGGGGAAAGAGCATCTGAAAGG - Intergenic
1132120354 15:99170349-99170371 CAGGCTACAGAGAATCCTCAAGG + Intronic
1133444703 16:5850063-5850085 CAGAGTAAACAGAATCACCTGGG - Intergenic
1133986358 16:10671786-10671808 CAGGCAAAAGAGAATGTGCAGGG + Intronic
1135798982 16:25474909-25474931 CAGGATAAGGGAAATCAGCATGG - Intergenic
1137764836 16:50970084-50970106 CAGGGTGAAAGGAGTCAGCAAGG + Intergenic
1138121475 16:54403940-54403962 CAGGGTGGAGAGGATCAGCCTGG - Intergenic
1139980770 16:70857082-70857104 CAGGGTAGGGAGAATAAGGAAGG - Intronic
1140035450 16:71368109-71368131 CAGGGGACAGATAATAAGCAAGG - Intronic
1141365129 16:83435504-83435526 CAGAGTGAAGAGAGGCAGCAGGG - Intronic
1141640564 16:85338618-85338640 CAGGGGAAATAAAATCAGCTAGG + Intergenic
1143738252 17:8930031-8930053 AACTGTAAAGAAAATCAGCAAGG + Intronic
1148202919 17:45761812-45761834 CTGGGAAGAAAGAATCAGCAAGG + Intergenic
1150194693 17:63284991-63285013 CAGAGCAAAGAGTATCATCAAGG - Intronic
1151929681 17:77224404-77224426 CAGTGCAAAGAGACTCAGTAAGG - Intergenic
1153479147 18:5529704-5529726 CAGAGTAAAGAGAATCTGCAAGG - Intronic
1153925432 18:9831563-9831585 CAGGGTAATGAGCCTCAGCAGGG + Intronic
1154477088 18:14771608-14771630 CAGGGTGAAGGGAAGCAACAGGG + Intronic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1156278631 18:35610281-35610303 CAGGGCAATGAGAAGCAGCCTGG - Intronic
1156504506 18:37580805-37580827 CAGTGTAAGGAGAATGAGAAAGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157080509 18:44519867-44519889 CTGGGCAAAGAAAATGAGCACGG + Intergenic
1157773969 18:50375576-50375598 CAGGGGAAAGAGGATAAGCCTGG - Intronic
1157959891 18:52141543-52141565 CTGGGTAAAGAGATTCAGAAGGG - Intergenic
1159166322 18:64705711-64705733 CAGGGTGACTAGAATCCGCAGGG + Intergenic
1161235760 19:3197239-3197261 CAGGGGAAAGGGAATCGACATGG - Intronic
1161897205 19:7091308-7091330 AAGGGTAAAGGGAATCTGGAAGG + Intergenic
1163776136 19:19219008-19219030 CAGGGTAAAGAGACAGGGCAGGG - Exonic
1164935633 19:32208230-32208252 CAGGGGGAAGGGAATCAGGAGGG + Intergenic
1166649470 19:44561201-44561223 CAGAGCAAAGATAATTAGCAGGG + Intergenic
1166979408 19:46623887-46623909 CATGGCAAAGAGGATGAGCATGG + Exonic
1167785172 19:51630114-51630136 CAGGGGTAAGAGAAGGAGCAGGG + Intronic
1167787271 19:51646538-51646560 CAGGGGTAAGAGAAGGAGCAGGG + Exonic
1168403789 19:56100487-56100509 CAGAGAAAAGGGAACCAGCAGGG - Intronic
925246075 2:2384311-2384333 CAGGGAAAGGAGCATCAGCAGGG - Intergenic
925298618 2:2794474-2794496 CAGGGCAGAGAGCATCTGCAGGG - Intergenic
926607643 2:14913691-14913713 CAGGGGAAACAGAACCAGCTTGG + Intergenic
927586845 2:24315762-24315784 CAGGAGAGAGAGAAGCAGCAAGG - Intronic
927951883 2:27175971-27175993 TAGTGTGAAGAAAATCAGCAAGG + Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
932458027 2:71862058-71862080 GAGGGGAACGTGAATCAGCATGG - Intergenic
933583260 2:84151420-84151442 CAGGGTTAAGAACATCTGCAGGG + Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
935355697 2:102197505-102197527 CAGGATAAAAAGACTCACCATGG - Intronic
936167856 2:110139603-110139625 CAGTGTAAAGCCAAACAGCAAGG + Intronic
937273361 2:120669385-120669407 CAAGGTAAAAAGAACCACCAGGG - Intergenic
938129974 2:128706886-128706908 CAGAGGTAAGAGAATGAGCAGGG + Intergenic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940896749 2:159088414-159088436 CATGATAAAGAGAATAAGCTCGG - Intronic
942164436 2:173228346-173228368 CCGGGTAAAGAGAAGCAACAAGG - Intronic
942436126 2:175978865-175978887 AAGGGTCAAGAGTGTCAGCAAGG + Intronic
942639480 2:178046710-178046732 AAGAGTAAAGAGAATCTACAAGG - Intronic
942677649 2:178445659-178445681 CAGGCTATACAGAAACAGCATGG + Intronic
943951734 2:194137680-194137702 CTTGATAAAGAGAATCAGAAAGG + Intergenic
944906152 2:204264221-204264243 CTGGGTAATTAGAGTCAGCAGGG - Intergenic
945639405 2:212404588-212404610 CAAGTAAAAGAAAATCAGCAGGG + Intronic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946076128 2:217075181-217075203 CAGGGTAGAGAAAAGCAGGAAGG - Intergenic
947843677 2:233226662-233226684 CAGAGTTAAGAGAAGTAGCAGGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948541510 2:238694267-238694289 GAGGGAAAAGAGAAACAGAAGGG + Intergenic
948600942 2:239107180-239107202 CAGGGTGAAGAGCACCAGCTGGG + Intronic
948732419 2:239975438-239975460 CAGGGAAATGGGAAGCAGCATGG + Intronic
1169122079 20:3102776-3102798 GAGGGGACAGGGAATCAGCATGG - Intergenic
1169745220 20:8936151-8936173 CAGGGTCATGAGCCTCAGCAGGG - Intronic
1169832727 20:9841749-9841771 GAAGGTAAAGAGAATGAGCTGGG - Intergenic
1169961976 20:11170512-11170534 CGGGGGAAAGAAAATGAGCAAGG - Intergenic
1170417805 20:16162941-16162963 CAGGCTCAAGAAAGTCAGCAGGG + Intergenic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1175716874 20:61260831-61260853 CAGGGTTAAGAGGTTCAGAAAGG + Intronic
1178007971 21:28244554-28244576 CAGAGAAAAGAGAATCAGATTGG + Intergenic
1178533695 21:33395560-33395582 CAAGGTAAAGAGTATCTGAAAGG + Intergenic
1179111234 21:38447197-38447219 CACGGCACTGAGAATCAGCAAGG + Intronic
1183447232 22:37865845-37865867 AGGGATAAAGAAAATCAGCACGG - Intronic
949147230 3:716900-716922 TAAGGTAAATAGAATGAGCAGGG + Intergenic
950366885 3:12492592-12492614 TAAATTAAAGAGAATCAGCAAGG - Intronic
950549596 3:13658120-13658142 CTGGGTACAAAGAAGCAGCAAGG - Intergenic
951450573 3:22833222-22833244 CAGGGAAATCAGAAACAGCATGG + Intergenic
951573014 3:24085142-24085164 CAGTGTCAAGAGAAGCACCATGG + Intergenic
951843954 3:27065396-27065418 CATGGGAAAGAGAAATAGCATGG - Intergenic
953584641 3:44188617-44188639 CAGGTTAAAATGAATCATCAGGG - Intergenic
954076186 3:48182970-48182992 CATGGTCAAGAGAATCAGAATGG + Exonic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955597027 3:60602300-60602322 TAGGGAAAAGAAAATCAGCCTGG + Intronic
956029371 3:65020768-65020790 CAGGCTAAAGAGAATCTTAAGGG - Intergenic
956168149 3:66412087-66412109 CACGGTAACGTGAAACAGCAGGG - Intronic
957012470 3:75023788-75023810 CAAGGTAAAGAGAAAGAACAGGG - Intergenic
957398389 3:79675557-79675579 GAGGGTAAAGAGAAATACCAAGG + Intronic
958993999 3:100880309-100880331 TAGGGAAAAGAGAGCCAGCAAGG - Intronic
959153452 3:102636554-102636576 CCGGGTCAAGAGAATAAGCGAGG - Intergenic
959442933 3:106401170-106401192 CAGGGTGAAGTGAATAAGAAAGG - Intergenic
959941333 3:112085026-112085048 AAGGGTTAAGGGAATCAACAAGG - Intergenic
961085736 3:124066027-124066049 CAGGGAAAAGGGTATCATCAGGG - Intergenic
963197296 3:142546354-142546376 CAAGGTTAAGGGAACCAGCAAGG - Intronic
963258935 3:143175091-143175113 CAGGATTAAGAGAACGAGCAGGG + Intergenic
966250800 3:177863325-177863347 CAGGGTTAAGTGAATCAGAATGG + Intergenic
966348831 3:179007862-179007884 CATGGTACAGAAAATCAACAAGG + Intergenic
967446306 3:189570626-189570648 AAGGATAATGAGAAACAGCAAGG + Intergenic
967693907 3:192509007-192509029 CAGGCAATAGAGACTCAGCAGGG - Intronic
970425826 4:15945425-15945447 CAGGGGAATGAGACTCTGCAAGG + Intergenic
970536781 4:17038139-17038161 CTGAGGAAAGAGAATGAGCATGG - Intergenic
970542841 4:17096478-17096500 AAGGGTAAAGAGGGTTAGCAAGG - Intergenic
974725380 4:65792362-65792384 CAAGGTAAAGACAATGACCAGGG + Intergenic
974920458 4:68232906-68232928 CAGAGTAAAGAGAATTATCATGG - Intronic
976215153 4:82709104-82709126 CAGGGCACAGGCAATCAGCAGGG - Intronic
976815053 4:89138504-89138526 CAGGGTAAAAAGACTGAGAAAGG + Intergenic
977893600 4:102340256-102340278 GAGGGTAGAGAGAGGCAGCAGGG + Intronic
978326625 4:107564631-107564653 CACGGAACAAAGAATCAGCAGGG + Intergenic
981201055 4:141979898-141979920 GAAGGAAAAGAGAATAAGCAAGG - Intergenic
981550142 4:145935836-145935858 CAGGGTCAAGGTCATCAGCAGGG + Intronic
982431357 4:155325271-155325293 CAGGGGAAAGTGCTTCAGCAAGG - Intergenic
984627918 4:182029183-182029205 CAGGATCAAGAGAACAAGCAGGG + Intergenic
985554191 5:548243-548265 CAGGGCAGTGGGAATCAGCACGG - Intergenic
986242886 5:5977306-5977328 CACGGTTCAGAGAACCAGCAAGG + Intergenic
986986488 5:13506325-13506347 CAGAGGAGAGAGAATCAGGAGGG + Intergenic
988981053 5:36569738-36569760 CAGTGTGAAGAGAAGCTGCAGGG - Intergenic
991654587 5:68891575-68891597 CAAGGTCAAGAGAACCAGAATGG + Intergenic
991917253 5:71617206-71617228 GAGGGGAAAGAGGACCAGCATGG - Intronic
993113797 5:83693706-83693728 CAGGATAAAAAATATCAGCAGGG + Intronic
994520968 5:100834745-100834767 CAGGGTCAAGAGAAAGAGCTGGG - Intronic
997523546 5:134538426-134538448 CAGTGGAATGAGAAGCAGCAGGG + Intronic
998682717 5:144487956-144487978 CATGGTAATAAGAATAAGCAAGG - Intergenic
999771918 5:154782491-154782513 CAGGCTAAAGATAGTCAGCTGGG + Intronic
1000675162 5:164112908-164112930 AAGAGAAAAGAAAATCAGCAAGG + Intergenic
1001110132 5:168888819-168888841 CAGGCCAAAGAGAATCAGAATGG - Intronic
1002110700 5:176908898-176908920 CAGGGTACAGAGAAACAGCCAGG - Intronic
1003199217 6:3943500-3943522 CAGGGTTGAGAGACACAGCAGGG + Intergenic
1003274394 6:4636978-4637000 CAGGGTAAATATAGTCAGGAAGG - Intergenic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1005767742 6:29030406-29030428 CAGAATAAAGAAAATCAGCCAGG - Intergenic
1006670262 6:35725969-35725991 CAGGGTACAGAGTGTGAGCAGGG - Intronic
1006906113 6:37534870-37534892 CAGGATAAGGAGAAGCAGAAAGG - Intergenic
1007187439 6:39984290-39984312 CAGGATTAAGAGAATCAACCAGG - Intergenic
1007273345 6:40655453-40655475 CAGGATTAAGAGAATTAGTAAGG + Intergenic
1011198666 6:84809773-84809795 CAGGGATAAGAGACACAGCAGGG + Intergenic
1011811755 6:91140190-91140212 AAGGGCCAAGAGAAACAGCAGGG - Intergenic
1011914609 6:92488216-92488238 CAGGGGATAGAGCATCAGCCAGG - Intergenic
1011984664 6:93428404-93428426 CAAGGAAAAAAGAGTCAGCAAGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013036757 6:106392483-106392505 AAGGCAAAAGAGAATCAGGAAGG + Intergenic
1013864505 6:114679078-114679100 GAGGGTAAAAAGCATCTGCATGG + Intergenic
1016877798 6:148881122-148881144 CAAGGTATAGAGCAGCAGCATGG + Intronic
1017656872 6:156638163-156638185 CTTGGTTTAGAGAATCAGCAAGG + Intergenic
1018276664 6:162139511-162139533 CAGGGTAAAGAGAATCAGCATGG + Intronic
1019506361 7:1393450-1393472 CAGGGTAAGGGGACACAGCATGG + Intergenic
1019630214 7:2045082-2045104 CAGGGTGAAGCCATTCAGCAAGG + Intronic
1021301777 7:18982007-18982029 CAGGGAGAAGAGAATCAGGGTGG + Intronic
1021530586 7:21640638-21640660 CTGGGCAAAGAGACTCGGCAGGG - Intronic
1022133458 7:27425323-27425345 CAGGGAAGGGAGTATCAGCAGGG + Intergenic
1023968671 7:44976671-44976693 CAGAGTTGAGAGAATCAGCCAGG + Intronic
1028309363 7:89311147-89311169 TAGAGTTAAGAGAATCAGTAAGG - Intronic
1030138996 7:106285594-106285616 CAGGGTCAGGAGGATCAGGAGGG - Intronic
1030754805 7:113274177-113274199 CAGGAAAGAGAGAATGAGCAAGG + Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1033168933 7:139066377-139066399 CAGGATAAAGAGACCCAGCTCGG - Intronic
1035834954 8:2740155-2740177 CAGGCAAGAGAGAATGAGCAGGG - Intergenic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1037564738 8:20108251-20108273 CCAGGAAAACAGAATCAGCAAGG - Intergenic
1037677708 8:21066116-21066138 CAGGAGAAAGAGATTCATCATGG + Intergenic
1038413339 8:27375255-27375277 CAGGGTAAGGGGACTCAGGAGGG - Intronic
1038941490 8:32310654-32310676 CAAAGAAAAGAGAATGAGCACGG + Intronic
1041305054 8:56449019-56449041 CAGGGGAGAGAGAAACAGAAAGG + Intergenic
1043784205 8:84376699-84376721 CAGGGTCAAGAGAATCTGCAGGG - Intronic
1044204604 8:89477886-89477908 CAGGGTAGAAAGACACAGCAGGG - Intergenic
1046670054 8:117047114-117047136 CAGGCTAAATAGCATTAGCAGGG + Intronic
1046990362 8:120445567-120445589 GAGGGTACTGAGAATCAGCCGGG + Exonic
1048068363 8:130995675-130995697 AAGGATAAGAAGAATCAGCAAGG - Intronic
1048158534 8:131988909-131988931 CAGGGTAAAAAGAAATAACAGGG - Intronic
1049156840 8:141072592-141072614 CTGGGTTAAGAGAACCAACAAGG - Intergenic
1049244657 8:141555839-141555861 CAGGCAAGAGAGAATCTGCAGGG - Intergenic
1049516997 8:143065205-143065227 CAGAGTACAGGGAAGCAGCAGGG - Intergenic
1050327231 9:4509362-4509384 CAGGGTAAAAGGAATCAGCAAGG + Intronic
1057227107 9:93298188-93298210 CAGGGAAAGGAGATTCAGTAAGG - Intronic
1057796289 9:98160432-98160454 CAAGGAAAAGAGAATCAGAAAGG + Intronic
1057882363 9:98802153-98802175 CAGGGTGAAGAGAAACAGCAGGG + Intergenic
1058914006 9:109547998-109548020 CAAGGTAAAAATTATCAGCAGGG - Intergenic
1062521364 9:136959295-136959317 CAGGGTAAAGAGATTCAATCTGG - Intergenic
1186098028 X:6123329-6123351 CAAGGGAAAGAAAATCAGCCTGG + Intronic
1187215305 X:17269967-17269989 CAGGCTGAAGACAACCAGCATGG + Intergenic
1187224964 X:17366977-17366999 CTGGGTGAAGAGAATCTGGAAGG + Intergenic
1189907258 X:45774053-45774075 CAGGGTAAAGACAAACAGCCTGG + Intergenic
1191223593 X:58016647-58016669 CAGGCTCAAGAGAGTCTGCAGGG + Intergenic
1191892980 X:65963747-65963769 CAGGCAAAAGAGAATATGCAGGG + Intergenic
1192698327 X:73442523-73442545 TAGGGTAAAAAGAATGAGAAAGG - Intergenic
1194235651 X:91380573-91380595 CAGGATAAAGACAATCAGGCAGG - Intergenic
1194593197 X:95826441-95826463 GAGGGTATGGAGAATCAGAAAGG - Intergenic
1195468047 X:105202729-105202751 AAGGGTTAAGAGAATCAAGAGGG - Intronic
1195682000 X:107554227-107554249 GAGGGTAATTAGAATCAGCCAGG + Intronic
1195803124 X:108734900-108734922 CAGGGCAAAGAAGATCAGGAAGG - Exonic
1197279444 X:124518038-124518060 CAGAGTTAAGAGAATTATCAAGG + Intronic
1197887684 X:131235417-131235439 TAGGGTAAAAGGAATAAGCATGG + Intergenic
1198076093 X:133194624-133194646 CAGGGTTAAGGGAACCAACAAGG + Intergenic
1199395995 X:147338858-147338880 TGGGGTACAGAGAATAAGCATGG - Intergenic
1199882518 X:151985953-151985975 CAGGGTCAAGAGACTAGGCAAGG - Intergenic
1200038120 X:153346314-153346336 TAGGGTTGAGAGGATCAGCAGGG + Intronic
1200940373 Y:8774252-8774274 CAGGGTAAAGAGAGGCAGTGAGG - Intergenic