ID: 1018280971

View in Genome Browser
Species Human (GRCh38)
Location 6:162185053-162185075
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018280968_1018280971 3 Left 1018280968 6:162185027-162185049 CCTCATCTAATAAAGACAAAAGT 0: 1
1: 0
2: 2
3: 52
4: 824
Right 1018280971 6:162185053-162185075 ATCGTTATGAAACTTGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr