ID: 1018282334

View in Genome Browser
Species Human (GRCh38)
Location 6:162200200-162200222
Sequence GTTCTCTCCACCGCGGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018282325_1018282334 10 Left 1018282325 6:162200167-162200189 CCAGCACTGTGTCCTTGACACCC 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1018282321_1018282334 21 Left 1018282321 6:162200156-162200178 CCTGACTGCCCCCAGCACTGTGT 0: 1
1: 0
2: 6
3: 37
4: 345
Right 1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1018282323_1018282334 12 Left 1018282323 6:162200165-162200187 CCCCAGCACTGTGTCCTTGACAC 0: 1
1: 0
2: 2
3: 29
4: 274
Right 1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1018282324_1018282334 11 Left 1018282324 6:162200166-162200188 CCCAGCACTGTGTCCTTGACACC 0: 1
1: 0
2: 1
3: 18
4: 198
Right 1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1018282327_1018282334 -10 Left 1018282327 6:162200187-162200209 CCCCCGTGTCTGTGTTCTCTCCA 0: 1
1: 0
2: 0
3: 23
4: 278
Right 1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1018282322_1018282334 13 Left 1018282322 6:162200164-162200186 CCCCCAGCACTGTGTCCTTGACA 0: 1
1: 0
2: 4
3: 28
4: 277
Right 1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 58
1018282326_1018282334 -2 Left 1018282326 6:162200179-162200201 CCTTGACACCCCCGTGTCTGTGT 0: 1
1: 0
2: 0
3: 17
4: 166
Right 1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018282334 Original CRISPR GTTCTCTCCACCGCGGGGAC TGG Intronic
900585045 1:3428617-3428639 GTTCCCGCCACCCCAGGGACTGG - Intronic
901399256 1:9004855-9004877 GTCCTCACCACCGAGGGGACAGG + Exonic
902933825 1:19749908-19749930 GTTCTGTCCACTGTGGGGATAGG - Intronic
904265322 1:29315361-29315383 TCTCTCTCCAGCGCGGGCACCGG + Exonic
906611657 1:47208196-47208218 CTTCCCTCCACCCCGGGAACTGG - Intergenic
907572123 1:55492967-55492989 GTTCTAGCCACCGTGGGGAGAGG - Intergenic
907909602 1:58814792-58814814 TTTCACGCCACCGCGGGGCCCGG - Intergenic
921946160 1:220887404-220887426 GCTCTCTCGACCCCGGGTACTGG + Intergenic
924743348 1:246810766-246810788 GTTCACTGCACCGGGGGGGCCGG + Intergenic
1069942083 10:71963458-71963480 GTTCTCGCCTTCTCGGGGACAGG + Intergenic
1071328815 10:84541186-84541208 GTGCCCTGCACCGCGTGGACAGG - Intergenic
1083186679 11:61021828-61021850 TTTCTCTCCACCTCTGGGACAGG - Intergenic
1084184337 11:67463902-67463924 GTTCTCCCAACCTCTGGGACTGG + Exonic
1096485342 12:51976548-51976570 GATCTCTCCACCTCAGGGTCTGG + Exonic
1098109091 12:67102674-67102696 CTTCTCTCCACCCCGAGGCCAGG + Intergenic
1102434302 12:112908765-112908787 GTTCGCTCCAGCTCGGGGAGGGG + Exonic
1103595679 12:122023017-122023039 GTTCTCTGCACCGGGGAGAGGGG + Intronic
1103851767 12:123937986-123938008 GATCTCCCCACCTCGGGGAGGGG - Intronic
1104835311 12:131786472-131786494 GGGCTCTCCTCCGAGGGGACCGG - Exonic
1114306454 14:21428033-21428055 GTTCTGCTCACCGCGGGCACGGG + Exonic
1129182006 15:73883498-73883520 GGTCTCACCACCATGGGGACAGG - Intronic
1129682876 15:77667913-77667935 GTTCTCTCCACTGAGGGCCCAGG + Intronic
1129801772 15:78420368-78420390 GGTCTCTCCACCGCATGGACTGG + Intergenic
1131456858 15:92588402-92588424 GCTCTCTGCACCGTGGAGACTGG + Intergenic
1133775854 16:8894521-8894543 GTTCTCCCCCCCCCGGGGGCTGG - Intronic
1134256325 16:12614754-12614776 GTTCTGACCACCTCGGGCACAGG + Intergenic
1138635958 16:58338617-58338639 TTTCTTTCCACCGTGGGGAGTGG - Intronic
1142216934 16:88834528-88834550 GCTCTCCCCACCGCGTGGTCTGG + Intronic
1151378674 17:73709798-73709820 GTTCTCTCCCCCGGGAGGCCAGG - Intergenic
1151420646 17:73994962-73994984 GTTCTCTCCATCGCTGGGTGGGG - Intergenic
1160581979 18:79888210-79888232 GTGGTCCCCACCGCGTGGACGGG - Intronic
1161152173 19:2715374-2715396 GGTCTCTCCACAGCGGGGCTCGG - Exonic
1161383984 19:3981303-3981325 GTTCCCTCCACCCCGAGGGCTGG + Intronic
1163664425 19:18596614-18596636 GTGCTCACCACTGCGGGGAGTGG + Exonic
1167505562 19:49869368-49869390 GTTCTTTACACTACGGGGACTGG - Exonic
933948556 2:87308924-87308946 GCTCTCCCCAGGGCGGGGACAGG + Intergenic
936331643 2:111552671-111552693 GCTCTCCCCAGGGCGGGGACAGG - Intergenic
1179537952 21:42064300-42064322 GTTCTCTCCTCCTCGGGGGAAGG - Intronic
1181761628 22:25062703-25062725 GTTCTCTCCACCATGCGGAGGGG - Intronic
1183055211 22:35300712-35300734 GTTCTCTGCACCCTGGTGACAGG + Intronic
1185222405 22:49635790-49635812 CTTCTGTCCACCGCGGGGCTGGG + Intronic
949462891 3:4313004-4313026 GTTCTCTCCATGGCGGAGACAGG - Exonic
950046609 3:9952049-9952071 GATCTCTCTGCCGCAGGGACTGG + Intronic
954405142 3:50341290-50341312 CTGCTCTCCACTGCGGAGACTGG + Exonic
968471554 4:784866-784888 GTTCTCTCCACGGCGGCTGCAGG - Intergenic
968689558 4:1983689-1983711 GCTCTCTCTACAGCGGGGAGAGG + Exonic
975392527 4:73836447-73836469 GCTCCCTCCACCGCGGGGCGGGG + Intergenic
985888318 5:2697193-2697215 GTTCTGTCCCCCGCGGGTGCTGG - Intergenic
986721524 5:10564133-10564155 GCTCTCTCGAGCGCGGGGACTGG - Intergenic
1007100754 6:39244759-39244781 GTTCTCCACACAGCTGGGACAGG - Intergenic
1015642755 6:135354166-135354188 GTTCTCTCTACCGGGGTTACAGG + Intronic
1018282334 6:162200200-162200222 GTTCTCTCCACCGCGGGGACTGG + Intronic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019984906 7:4648482-4648504 GGGCTCTCCACTGTGGGGACGGG + Intergenic
1023012923 7:35939517-35939539 GTGCCCTCCACGGTGGGGACTGG + Intergenic
1037769254 8:21789305-21789327 GCTCTCCCCACCCTGGGGACCGG + Intronic
1046622977 8:116547354-116547376 GCTCTCTCCTCAGTGGGGACTGG - Intergenic
1049017842 8:139933588-139933610 GATCTCTGCACCGCGTGGCCCGG + Exonic
1051209555 9:14727287-14727309 GTTCTCTCCATGGCAAGGACAGG - Intergenic
1055495218 9:76847590-76847612 TTTCTCTACACCACGGTGACTGG - Intronic
1056623224 9:88232814-88232836 GTCCTCTCCAACGTGGGGCCAGG - Intergenic
1062430817 9:136526189-136526211 GGCCGCTCCACCTCGGGGACCGG - Intronic
1192044332 X:67656103-67656125 GTTCTCTCTAGCTAGGGGACAGG - Intronic
1200161409 X:154011729-154011751 CTTCTCTCCCCCGCGGGCATGGG + Exonic