ID: 1018287808

View in Genome Browser
Species Human (GRCh38)
Location 6:162259308-162259330
Sequence AGGATCCATAATTGTAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018287806_1018287808 -6 Left 1018287806 6:162259291-162259313 CCGTGAGAACAACAGGTAGGATC 0: 1
1: 0
2: 0
3: 17
4: 110
Right 1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
1018287799_1018287808 15 Left 1018287799 6:162259270-162259292 CCCACCCAGCGTCCGATTGTTCC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
1018287802_1018287808 10 Left 1018287802 6:162259275-162259297 CCAGCGTCCGATTGTTCCGTGAG 0: 1
1: 0
2: 0
3: 0
4: 20
Right 1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
1018287798_1018287808 25 Left 1018287798 6:162259260-162259282 CCTCTGTTCTCCCACCCAGCGTC 0: 1
1: 0
2: 2
3: 34
4: 241
Right 1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
1018287797_1018287808 29 Left 1018287797 6:162259256-162259278 CCTGCCTCTGTTCTCCCACCCAG 0: 1
1: 0
2: 2
3: 70
4: 581
Right 1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
1018287801_1018287808 11 Left 1018287801 6:162259274-162259296 CCCAGCGTCCGATTGTTCCGTGA 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
1018287800_1018287808 14 Left 1018287800 6:162259271-162259293 CCACCCAGCGTCCGATTGTTCCG 0: 1
1: 0
2: 0
3: 3
4: 26
Right 1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 73
1018287803_1018287808 3 Left 1018287803 6:162259282-162259304 CCGATTGTTCCGTGAGAACAACA 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG 0: 1
1: 0
2: 1
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018287808 Original CRISPR AGGATCCATAATTGTAAGGC TGG Intronic
915477648 1:156162422-156162444 AGGATCCAGAATTGAGAGCCTGG + Intronic
916163829 1:161946379-161946401 AGGATCCATAGTTGTATCGCTGG - Intronic
917004622 1:170399487-170399509 ATAATCTATAATTGTAAAGCTGG - Intergenic
917470835 1:175324605-175324627 AGGTTCCATAAGTGGAAGCCAGG - Intronic
920973976 1:210768433-210768455 AGGAGCCATAATAGTTTGGCTGG - Intronic
923088903 1:230723173-230723195 AGGCACCATCTTTGTAAGGCTGG - Intergenic
1064908423 10:20372706-20372728 TGGCTACATAATTGAAAGGCAGG + Intergenic
1067537208 10:47121845-47121867 AGGAGCCAAAACTGAAAGGCAGG - Intergenic
1067674475 10:48359830-48359852 ATTATCCATGATTTTAAGGCTGG + Intronic
1073902620 10:108241334-108241356 AGGATTCTTCATTGTCAGGCAGG - Intergenic
1075923642 10:126233529-126233551 AGGAGGCATAGTTTTAAGGCTGG + Intronic
1078922236 11:15841529-15841551 AGGATCCAGAATTCAAACGCAGG + Intergenic
1080784709 11:35463943-35463965 AGGATCCATCCTTGTCAAGCTGG - Intronic
1089164856 11:116468006-116468028 TGGAGCCACAATTCTAAGGCAGG - Intergenic
1091370083 11:135050400-135050422 AGAATCCATAATTATGAGGGGGG - Intergenic
1097221370 12:57453116-57453138 AGGGTTCCTAATTGGAAGGCTGG - Intronic
1098692137 12:73502488-73502510 AAGATACATAATTGTCAGACTGG - Intergenic
1100815970 12:98387595-98387617 AGAACCCATAATTTTAAAGCAGG + Intergenic
1102614831 12:114144574-114144596 AGAAGCCAGAATTTTAAGGCTGG - Intergenic
1103103348 12:118200397-118200419 GAGATCCATAAATATAAGGCAGG - Intronic
1105462464 13:20605474-20605496 CTGATCCTTAATTGTGAGGCAGG - Intronic
1110767363 13:79296245-79296267 TGGATGCAGAATTCTAAGGCAGG - Intergenic
1111855566 13:93632765-93632787 AGGATCCATACCTGTGAGGGAGG - Intronic
1114603079 14:23971801-23971823 AGGAGCTCTTATTGTAAGGCAGG - Intronic
1114607441 14:24008925-24008947 AGGAGCTCTTATTGTAAGGCAGG - Intergenic
1117242616 14:53850143-53850165 AGTCCCCAAAATTGTAAGGCAGG + Intergenic
1124995248 15:34717293-34717315 AGGAACTATATTTTTAAGGCTGG - Intergenic
1128958552 15:71975256-71975278 AGGATCCATGTTTGAAAGCCAGG + Intronic
1137346416 16:47666088-47666110 AGGACCCTTAATTTTAAGTCTGG + Intronic
1153108171 18:1551760-1551782 AGGACCCAATATTCTAAGGCTGG + Intergenic
1157010882 18:43647182-43647204 AGGATACAAAATTTTATGGCTGG + Intergenic
1162392913 19:10400235-10400257 AGTTTCCCTAACTGTAAGGCAGG - Intronic
1162629153 19:11912903-11912925 AGAAGCTATAATAGTAAGGCCGG + Intronic
1167832103 19:52032328-52032350 TGATTCCATAATTGTAAAGCGGG - Exonic
927763189 2:25779425-25779447 AGGAACCAGAAATGTTAGGCGGG - Intronic
930607514 2:53508009-53508031 AGCATCCCTAATTATAAAGCAGG + Intergenic
933943028 2:87260904-87260926 AGGATCCAGAATTCCAGGGCAGG + Intergenic
934648818 2:96075685-96075707 AGGATCAATAACTCAAAGGCAGG - Intergenic
936337185 2:111600658-111600680 AGGATCCAGAATTCCAGGGCAGG - Intergenic
937703562 2:124891922-124891944 AGGGCCCATAATTGTGAAGCCGG - Intronic
943468847 2:188266586-188266608 AGGTTCTATAATTGCAATGCAGG - Intergenic
944495495 2:200303638-200303660 AGGGTGCTTAATTGTAAGCCTGG - Intergenic
1169679977 20:8201038-8201060 TGCATCTATATTTGTAAGGCAGG + Intronic
1172405824 20:34688123-34688145 AAGAACCATAATTCTGAGGCCGG + Intergenic
1175451634 20:59073689-59073711 AGGAAACATAATTCTTAGGCTGG + Intergenic
1178175614 21:30094503-30094525 AGCATCCTTAATTGTAAGACAGG + Intergenic
1180241882 21:46513915-46513937 AGATTCCATAATTGTAATACAGG - Intronic
1181955998 22:26588703-26588725 AGTTTCCATAACTGTAAAGCTGG - Intronic
955832567 3:63019573-63019595 AGGGTGCCTCATTGTAAGGCAGG + Intergenic
962024540 3:131533692-131533714 AGGATCTATAATTGTAACTGTGG + Exonic
971150711 4:24028617-24028639 AGGAGCCAGTATTGCAAGGCAGG - Intergenic
971614688 4:28773037-28773059 ATGAGCCAAAAGTGTAAGGCTGG + Intergenic
975274865 4:72484888-72484910 AGGATACATGATTGAAAGGGAGG - Intronic
977952283 4:102986227-102986249 AGGATACAGAATTCTAAGGCTGG + Intronic
980027767 4:127786292-127786314 AGTATCCATTGTTGTAAGGATGG + Intronic
980843388 4:138294445-138294467 AGACTCCATAATTTAAAGGCAGG + Intergenic
981319872 4:143379368-143379390 AGGATGCAGGATTGGAAGGCAGG - Intronic
987311218 5:16682875-16682897 AGGATGCAAAATTCTAAGGATGG + Intronic
989561139 5:42852870-42852892 AGGAACCAAAATGGTGAGGCAGG - Intronic
993646437 5:90469307-90469329 TGCATCCATTATTCTAAGGCTGG + Intronic
999747899 5:154606132-154606154 AGGATCCATAATTGCATGGCTGG + Intergenic
1000631239 5:163593168-163593190 AGGATCCATCTTGGTAAGTCAGG + Intergenic
1002493704 5:179597860-179597882 AGGATCCTTCATTGTCAGTCTGG + Intronic
1008489042 6:52066274-52066296 AGGATCAATATTTGAAAGGAAGG + Intronic
1012227633 6:96723152-96723174 AGGCTCCATCATTGTCAGGCAGG + Intergenic
1015927958 6:138329145-138329167 AGGAACCATATTTTTAAGGGAGG - Intronic
1018287808 6:162259308-162259330 AGGATCCATAATTGTAAGGCTGG + Intronic
1021230013 7:18074817-18074839 TGCATCTATAACTGTAAGGCAGG - Intergenic
1026554377 7:71393308-71393330 AGAAAACAAAATTGTAAGGCTGG - Intronic
1028700443 7:93772703-93772725 AGGAAACATAAATGTAAGACTGG + Intronic
1030498652 7:110331806-110331828 AGTATCCTTAATTGTAAGATGGG + Intergenic
1031083307 7:117278695-117278717 AGGATCCTTAAATTCAAGGCTGG - Intronic
1035139527 7:156744227-156744249 AGTACCCATAGTTGTAAGGGAGG - Intronic
1036556577 8:9865184-9865206 AAGTTCCATGATGGTAAGGCAGG - Intergenic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1060108374 9:120889047-120889069 AGGAACCAGAATTTTAAGGTGGG + Intronic
1062442595 9:136577660-136577682 AAGACCCATAAGTGTAAGGCCGG + Intergenic
1185932731 X:4220870-4220892 AGGAATCATATTTGGAAGGCTGG - Intergenic
1188554593 X:31397724-31397746 ATAATGCAAAATTGTAAGGCTGG + Intronic
1193497689 X:82234772-82234794 AGCATCCAGATTTGTAAAGCAGG - Intergenic