ID: 1018288233

View in Genome Browser
Species Human (GRCh38)
Location 6:162263945-162263967
Sequence GTCCTTGCTGTGTCTTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 483}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018288233_1018288238 16 Left 1018288233 6:162263945-162263967 CCCTCTTAAGACACAGCAAGGAC 0: 1
1: 0
2: 0
3: 25
4: 483
Right 1018288238 6:162263984-162264006 ATCGATGTGGCCGGCCGCAGTGG No data
1018288233_1018288236 3 Left 1018288233 6:162263945-162263967 CCCTCTTAAGACACAGCAAGGAC 0: 1
1: 0
2: 0
3: 25
4: 483
Right 1018288236 6:162263971-162263993 ACTCTCTCAGTAAATCGATGTGG 0: 1
1: 0
2: 0
3: 7
4: 121
1018288233_1018288237 7 Left 1018288233 6:162263945-162263967 CCCTCTTAAGACACAGCAAGGAC 0: 1
1: 0
2: 0
3: 25
4: 483
Right 1018288237 6:162263975-162263997 TCTCAGTAAATCGATGTGGCCGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018288233 Original CRISPR GTCCTTGCTGTGTCTTAAGA GGG (reversed) Intronic
902417577 1:16250394-16250416 GTTGTTGCTGTGTTTTAACAGGG - Exonic
902660889 1:17902755-17902777 CTTCTTGCTGTGTCTTCACATGG - Intergenic
903643776 1:24878247-24878269 CTTCTTGCTGTGTCATAACACGG + Intergenic
904861996 1:33545512-33545534 CTTCTTGCTGTGTCTTCACATGG + Intronic
905295666 1:36952983-36953005 GTCCATGCTGTGTCCTCCGAAGG + Intronic
906350006 1:45050561-45050583 GTACTGGATGTGTCTTAAAATGG + Intronic
906872831 1:49503176-49503198 GTCCAGGCTGTATCTTCAGAGGG + Intronic
907026993 1:51129753-51129775 TTTCTTGCTGTGTTTTCAGATGG + Intronic
907052638 1:51340030-51340052 CTTCTTGCTGTGTCTTCACATGG - Intronic
907626909 1:56039561-56039583 CTCCTTGCTGTGTCTTCACAAGG + Intergenic
908053880 1:60261851-60261873 CTTCTTGCTGTGTCTTCACAAGG + Intergenic
908113077 1:60916236-60916258 CTCCTTGCTGTGTCTTCACATGG + Intronic
908331724 1:63077393-63077415 CTTCTTGCTGTGTCTTCACATGG - Intergenic
909325492 1:74346848-74346870 CTTCTTGCTGTGTCTTCACATGG + Intronic
911244452 1:95501237-95501259 ATCCATGCTGTGTTTTAGGAAGG - Intergenic
911730230 1:101284757-101284779 CTCCTTGCTGTGTCTTCACGTGG - Intergenic
912131544 1:106608294-106608316 CTTCTTGCTGTGTCTTCACATGG + Intergenic
912479166 1:109966039-109966061 CTTCTTGCTGTGTCTTCACATGG - Intergenic
916157618 1:161870423-161870445 GTCTTTGCTTTGTCTTAAAAAGG + Intronic
917527467 1:175801773-175801795 GTCCTCCCTGTGTCTTCACACGG + Intergenic
918712377 1:187747635-187747657 TTTCTTGCTGTGTCATAACATGG - Intergenic
919046352 1:192457523-192457545 CTTCTTGCTGTGTCCTCAGATGG + Intergenic
919777150 1:201201735-201201757 GACCCTGATGTGTCTTAAGCTGG - Exonic
920431506 1:205921898-205921920 GACCTTGCTGTGACTGAAGCAGG + Intronic
920918365 1:210276948-210276970 CTTCTTGCTGTGTCTTCATATGG - Intergenic
921076966 1:211707546-211707568 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
921123289 1:212155235-212155257 CTTCTTGCTGTGTCTTCACATGG - Intergenic
922094743 1:222433737-222433759 GTTCTTGCTGTGTCCTCAGATGG + Intergenic
923762441 1:236859180-236859202 CTTCTTGCTGTGTCATAACATGG + Intronic
924310991 1:242743097-242743119 GGCCTTGCAGTCTGTTAAGATGG + Intergenic
924522390 1:244816414-244816436 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
1065150448 10:22817318-22817340 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1065172943 10:23050001-23050023 GTCTTTGCAGTGTTTTAAGGAGG - Intergenic
1066174572 10:32890643-32890665 TTCCTTGCTGTGTCCTCAGATGG + Intergenic
1066262594 10:33743811-33743833 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1067500835 10:46803926-46803948 CTCCTTGCTGTGTCTTCGCATGG + Intergenic
1067518140 10:46972959-46972981 CTTCTTGCTGTGTCTTCACATGG - Intronic
1067644109 10:48078869-48078891 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1068025212 10:51634305-51634327 GGCTTTGCTAAGTCTTAAGATGG + Intronic
1068390687 10:56392371-56392393 CTTCTTGCTGTGTCTTCACACGG - Intergenic
1068639155 10:59382495-59382517 TTTCTTGCTGTGTCCTCAGATGG - Intergenic
1068659662 10:59611122-59611144 CTTCTTGCTGTGTCCTCAGATGG - Intergenic
1068695919 10:59968126-59968148 GTCCTTTCTGTCTTTTATGATGG + Intergenic
1069247337 10:66222494-66222516 GTACTTACTGTGTATTAAGTTGG + Intronic
1070137822 10:73710148-73710170 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1071029961 10:81165626-81165648 TTCCTTGCTGTGTCATAACACGG - Intergenic
1071549152 10:86552868-86552890 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1072538765 10:96382700-96382722 CTTCTTGCTGTGTCATAACAAGG - Intronic
1073640720 10:105250108-105250130 CTTCTTGCTGTGTCTTCACATGG + Intronic
1074706320 10:116135495-116135517 TGCCTTTCTGTGTATTAAGATGG + Intronic
1075825370 10:125352772-125352794 CTTCTTGCTGTGTCATAACATGG + Intergenic
1075832958 10:125427152-125427174 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1077430297 11:2512877-2512899 ATCCTTGCTGTGTCAGCAGAGGG + Intronic
1077764778 11:5145922-5145944 TTGCTTCCTGTGTCGTAAGAAGG + Intergenic
1078997708 11:16721129-16721151 GTCCTTGCCTTTTATTAAGAGGG - Intronic
1079592832 11:22201655-22201677 CTTCTTGCTGTGTCATAACATGG + Intronic
1079877791 11:25881536-25881558 CTTCTTGCTGTGTCCTAACATGG - Intergenic
1080137297 11:28870739-28870761 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1082280166 11:50262900-50262922 GTTCTTGTTGTGTTTTGAGACGG - Intergenic
1083689534 11:64398740-64398762 CTTCTTGCTGTGTCATAACATGG - Intergenic
1084878850 11:72155203-72155225 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
1085411976 11:76296809-76296831 GTCCTTGCTGACTGTTCAGAGGG + Intergenic
1086493840 11:87382738-87382760 TTTCTTGCTGTGTCATAACATGG - Intergenic
1086590858 11:88511909-88511931 GTCCATGCTTTGTATTAAAAGGG - Intronic
1087096770 11:94326628-94326650 CTTCTTGCTGTGTCATATGATGG + Intergenic
1087240086 11:95764859-95764881 CTTCTTGCTGTGTCTTTACACGG - Intergenic
1088460018 11:110073089-110073111 GTGCTTCCTGTTTCTTAATAAGG + Intergenic
1089173550 11:116532755-116532777 CTGCTTTCTGTGTCTTCAGATGG - Intergenic
1089276140 11:117337222-117337244 CTTCTTGCTGTGTCCTCAGATGG + Intronic
1089711961 11:120321923-120321945 GTTCTTACTTTGTCTTAGGAGGG - Intergenic
1090057723 11:123437987-123438009 TTCTTTGCTTTGTGTTAAGAAGG - Intergenic
1090213884 11:124943244-124943266 GTCCTTGCTGCATCTTAAATAGG - Intergenic
1090250295 11:125246227-125246249 CTTCTTGCTGTGTCATAACATGG + Intronic
1090413805 11:126527097-126527119 GTGGTGGCTGTGTGTTAAGAAGG + Intronic
1090444336 11:126750437-126750459 GTCCCTTCTGTTTCTAAAGAGGG - Intronic
1091604361 12:1937395-1937417 GTCCTTTCTGGGTCTGAAAAGGG + Intergenic
1092669986 12:10852007-10852029 GTTCTTGCTGTATCTTCACATGG + Intronic
1093200057 12:16175819-16175841 GCCCCTGCTGTCTCTTAAGCAGG - Intergenic
1094470948 12:30800518-30800540 CTCCTTGCTGTGTCACAACATGG - Intergenic
1095661270 12:44739883-44739905 GTTGTTGTTGTGTTTTAAGATGG - Intronic
1096337340 12:50766257-50766279 GTCCTTGCCTTTTATTAAGAGGG - Intronic
1096960258 12:55570118-55570140 GCCCAGGCTGTGGCTTAAGAAGG - Intergenic
1097757310 12:63420901-63420923 CTCGTTGCTGTGTCATAACATGG + Intergenic
1098389183 12:69951348-69951370 CAACTTGCTGTGTCTTCAGATGG + Intronic
1098494193 12:71115849-71115871 CTTCTTGCTGTGTCTTCACAAGG - Exonic
1098608455 12:72423886-72423908 GTCCTTGCTGACTTTGAAGATGG + Intronic
1098849756 12:75581782-75581804 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1099840938 12:87966248-87966270 AGCCTTCCTGTGTCTGAAGATGG + Intergenic
1100818687 12:98410518-98410540 CTTCTTGCTGTGTCATAACATGG - Intergenic
1101012526 12:100465920-100465942 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1103366135 12:120384801-120384823 GTCCCAGCTGTGCCTTTAGAGGG + Intergenic
1103387784 12:120547308-120547330 GGTCTTGCTCTGTTTTAAGATGG + Intronic
1103895907 12:124272992-124273014 CTTCTTGCTGTGTCATAACATGG - Intronic
1104143552 12:126010595-126010617 GTCCTTGCAGGGTTTTAGGATGG + Intergenic
1104561902 12:129853366-129853388 GTCCTTCCTGTGTTTTCAAACGG - Intronic
1104574407 12:129953765-129953787 CTTCTTGCTGTGTCTTCACACGG - Intergenic
1104810194 12:131615889-131615911 TTCCTTGCTGTGCCTCAGGATGG + Intergenic
1106003800 13:25750136-25750158 CTCCTTACTGTGGCTTTAGAGGG - Intronic
1106581216 13:31020018-31020040 GGCCTAGCTGTGTCCTCAGAGGG + Intergenic
1107027487 13:35817713-35817735 GTCCTTGGTGTGGCTTACCATGG - Intronic
1108166535 13:47699202-47699224 TTGCTTGCTGGGTCTTATGAGGG - Intergenic
1108783225 13:53862837-53862859 CTTCTTGCTGTGTCTTTACATGG + Intergenic
1109306198 13:60644955-60644977 CTTCTTGCTGTGTCGTAACATGG + Intergenic
1109383041 13:61590188-61590210 CTTCTTGCTGTCTCTTCAGATGG + Intergenic
1109443012 13:62399102-62399124 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
1109732657 13:66436310-66436332 TTTCTTGCTGTGTCTTCACAAGG - Intronic
1109742146 13:66568194-66568216 GTTCTTGCTGTGTCCTCACATGG - Intronic
1109980103 13:69896161-69896183 GCCATTGCTGTGTGTAAAGATGG - Intronic
1110794736 13:79623222-79623244 GTCCCTGCTCTGTCTCAACAGGG - Intergenic
1111178191 13:84625961-84625983 TTCTTTGCTGTGTCTTCACATGG + Intergenic
1112195264 13:97219554-97219576 TTTCTTGCTGTGTCTTCACATGG + Intergenic
1112600154 13:100847354-100847376 CCCCTTGATGTGTCTTCAGATGG + Intergenic
1114570412 14:23663335-23663357 CTCCTTGTTGTGTCTTCACAAGG - Intergenic
1114584155 14:23794669-23794691 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
1115481867 14:33868540-33868562 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
1116329422 14:43577300-43577322 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
1116427177 14:44805568-44805590 GTCATTGGTGTGTTTTAAGCAGG + Intergenic
1117851946 14:59982473-59982495 GGCCTTGCAGTGTCATAAAATGG + Intronic
1117964655 14:61194462-61194484 CTTCTTGCTGTGTCTTCACATGG - Intronic
1118628631 14:67682029-67682051 CTTCTTGCTGTGTCATAATATGG - Intronic
1118832342 14:69446296-69446318 GTCCTAGCTCTGTCTGAAGATGG + Intronic
1119532036 14:75368990-75369012 CTTCTTGCTGTGTCATAACATGG + Intergenic
1119538908 14:75426339-75426361 GTACTTGATGTGTCTTCAGCTGG - Intergenic
1120013825 14:79447806-79447828 GTCCTTTATGTGTTTTGAGATGG + Intronic
1120267565 14:82270627-82270649 GTTCATGCTGTTTCTGAAGAGGG - Intergenic
1120498906 14:85269680-85269702 TTTCTTGCTGTGTCTTCACATGG + Intergenic
1120688752 14:87568891-87568913 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1120806363 14:88755445-88755467 GACCTTTCTGTTTCTTAAAATGG - Intronic
1121006438 14:90493552-90493574 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1121789978 14:96691808-96691830 GGCCTTGCTGTGTCCTCACATGG + Intergenic
1121853169 14:97242367-97242389 ATTCTTGCTGTGTCTTCACATGG + Intergenic
1122174302 14:99905828-99905850 GTCCTTGCCTTTTATTAAGAGGG + Intronic
1126973110 15:54140811-54140833 GTCATTGGTGGGTTTTAAGAAGG + Intronic
1127006947 15:54581496-54581518 CTACTTGCTGTGTCTTCACATGG + Intronic
1127187381 15:56493546-56493568 CTTCTTGCTGTGTCATAACATGG + Intergenic
1128230982 15:66034962-66034984 CTTCTTGCTGTGTCATAACATGG - Intronic
1130121240 15:81049359-81049381 CTTCTTGCTGTGTCTTTACATGG - Intronic
1130555484 15:84919559-84919581 CTTCTTGCTGTGTCATAACATGG + Intronic
1130864831 15:87923901-87923923 CTTCTTGCTGTGTCATAACATGG - Intronic
1130981106 15:88812300-88812322 GTACTTGCAGTGACTTAGGAGGG - Intronic
1131093469 15:89641240-89641262 TTCCTGGCTGTGTCTTGACACGG - Intronic
1131518830 15:93098326-93098348 CTTCTTGCTGTGTCATAATATGG + Intergenic
1131824103 15:96303591-96303613 GACCTGGCTGTGTGTTAAAAAGG - Intergenic
1132006071 15:98228338-98228360 GTTGTTGCTGTTTCTTCAGATGG + Intergenic
1133112912 16:3559969-3559991 GTCATTTCTGTGCCTTAAGAGGG - Intronic
1134229093 16:12415430-12415452 GTCCTTGCTGTGTAATTACAAGG - Intronic
1134527665 16:14956854-14956876 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1134640694 16:15827360-15827382 GTCCCTGCTTTGTCTTGAGCTGG - Intronic
1135059523 16:19259085-19259107 GTCCATGCATTGTCTGAAGAAGG + Intronic
1135396909 16:22138568-22138590 GTCTTTCCTGGGTCTTAAAATGG + Intronic
1137567671 16:49543541-49543563 GTGCGGGCTGGGTCTTAAGAGGG + Intronic
1140966690 16:79973222-79973244 CTTCTTGCTGTGTCCTAACAGGG - Intergenic
1141047917 16:80733901-80733923 GTCATTGCAGAGTTTTAAGAGGG - Intronic
1141179982 16:81745963-81745985 GTCCTTCCTTTTTCTTTAGAAGG + Intronic
1143083665 17:4399845-4399867 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1144862238 17:18312389-18312411 GCCTGTGCTGTGTCCTAAGATGG + Intronic
1145776105 17:27530159-27530181 GCCCCTGCTGGGTCTTTAGATGG - Intronic
1146175278 17:30662265-30662287 TTTCTTCCTGTGTATTAAGAGGG - Intergenic
1146348730 17:32078307-32078329 TTTCTTCCTGTGTATTAAGAGGG - Intergenic
1146530251 17:33602456-33602478 CTTCTTGCTGTGTCATAACATGG - Intronic
1147839314 17:43359679-43359701 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
1148227936 17:45912125-45912147 ATCCTTGCTGTCTCCTAATAAGG + Intronic
1149411912 17:56417433-56417455 GTCCCTGCTGTTTCTCAAGCAGG + Intronic
1149641703 17:58206948-58206970 TTCCTTCCTGTGGCTTAAGCTGG - Intronic
1150515903 17:65808986-65809008 ATTCTTGCTGTGTCATAACATGG - Intronic
1151307734 17:73274125-73274147 CTTCTTGCTGTGTCTTTACAAGG + Intergenic
1151485700 17:74398099-74398121 CTTCTTGCTGTGTCTTCACAGGG - Intergenic
1151870603 17:76833987-76834009 CTCCTTGCTGTGTCCTCACATGG - Intergenic
1152536936 17:80956303-80956325 TTCCTTTCTGTATCTTAAAATGG + Intronic
1153785668 18:8532471-8532493 TTCCTTGCTCAGTCTTGAGAGGG - Intergenic
1153980740 18:10307434-10307456 CTTCTTGCTGTGTCATAACATGG - Intergenic
1155198680 18:23498998-23499020 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1155564103 18:27113621-27113643 CTTCTTGCTGTGTCTTTACATGG - Intronic
1155778389 18:29797528-29797550 GTCCTTTCTGTGTTCTTAGAAGG + Intergenic
1157539348 18:48488609-48488631 GCCCTTTTTGTCTCTTAAGAAGG - Intergenic
1157884095 18:51349683-51349705 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1159408856 18:68043275-68043297 GTACTTTCTGTATTTTAAGATGG + Intergenic
1159592323 18:70348623-70348645 GCCATTGCTGAGGCTTAAGAAGG - Intronic
1159830162 18:73267365-73267387 GTGCTAGCTTTCTCTTAAGAGGG - Intergenic
1160869767 19:1271865-1271887 GTCCTTGTTGTGTCCCCAGAAGG + Intronic
1162090408 19:8276065-8276087 GACCCTGCTGTATCTTAAAAAGG - Intronic
1162092641 19:8290898-8290920 GACCCTGCTGTATCTTAAAAAGG - Intronic
1162878853 19:13642110-13642132 CTTCTTGCTGTGTCATAACATGG - Intergenic
1162983683 19:14255666-14255688 TTTCTTCCTGTGTATTAAGAGGG + Intergenic
1164452978 19:28382616-28382638 GTCCTTGCTCTGTCGAGAGATGG + Intergenic
1164467615 19:28501028-28501050 ATCCTTGCTGAGATTTAAGACGG + Intergenic
1164492715 19:28729296-28729318 GTCCTTACTGTGTTTAAACATGG + Intergenic
1164794613 19:31015682-31015704 GTCCTGGCTGTGTCCTTAGGAGG - Intergenic
1167702327 19:51056809-51056831 GTCCTTGCTGGGGCTAAACAAGG + Intronic
1168549012 19:57277998-57278020 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
925883262 2:8370332-8370354 TTCATTGATGTGTCTCAAGAAGG + Intergenic
927431853 2:23033254-23033276 CTCCTTGCTATGTCTTCACATGG + Intergenic
928411756 2:31059764-31059786 CTTCTTGCTGTGTCTTCACATGG - Intronic
928457069 2:31431969-31431991 GTCATTGCTGTGTCTCAATGTGG - Intergenic
929227438 2:39525254-39525276 TTCCTTGCTGTGACTTCACAAGG + Intergenic
930151150 2:48061293-48061315 GTCCTTGCTTTTTATTAAGAGGG + Intergenic
930626105 2:53699108-53699130 CTTCTTGCTGTGTCATAACATGG + Intronic
931047069 2:58366428-58366450 CTTCTTGCTGTGTCTTCATATGG - Intergenic
931223321 2:60307893-60307915 GCCCATGCTGTATCTTAAAAGGG + Intergenic
931967918 2:67553985-67554007 CTTCTTGCTGTGTCCTAACATGG + Intergenic
932032170 2:68200678-68200700 CTCCTTGCTGACTCTTCAGATGG - Intronic
932306004 2:70704708-70704730 GTCCTTTCTGTGTCTAAATGAGG + Intronic
932779571 2:74551648-74551670 GTAGATGCTGTGTTTTAAGAGGG - Intronic
932861544 2:75297899-75297921 CTTCTTGCTGTGTCATAACATGG - Intergenic
932963824 2:76447018-76447040 CTCCTTGCTGAGTCTTGAAAAGG + Intergenic
933223750 2:79721310-79721332 CTTCTTGCTGTGTCATAAAATGG + Intronic
933427428 2:82130292-82130314 GTCCTTGCATTTTATTAAGAGGG - Intergenic
934132914 2:88966733-88966755 GTCCATGCTGTGTCCTGAGTGGG + Intergenic
934140916 2:89046461-89046483 GTCCATGCTGTGTCCTGAGTGGG + Intergenic
934148292 2:89117812-89117834 GTCCATGCTGTGTCCTGAGTGGG + Intergenic
934161536 2:89254010-89254032 GTCCATGCTGTGTCTTGACTGGG + Intergenic
934205746 2:89928405-89928427 GTCCATGCTGTGTCTTGACTGGG - Intergenic
934220999 2:90082799-90082821 GTCCATGCTGTGTCCTGAGTGGG - Intergenic
934228316 2:90154081-90154103 GTCCATGCTGTGTCCTGAGTGGG - Intergenic
934228908 2:90159843-90159865 GTCCATGCTGTGTCCTGAGTGGG - Intergenic
934466238 2:94265532-94265554 GTCCTTGCTGTGTCCTGACTGGG + Intergenic
934521286 2:95021644-95021666 CTTCTTGCTGTGTCTTCACAGGG - Intergenic
934888689 2:98047116-98047138 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
935700709 2:105809453-105809475 CTTCTTGCTGTGTCTTCATAAGG + Intronic
935708335 2:105875632-105875654 CTCCTTGCTGTGTCCTCACATGG - Intronic
936406678 2:112210798-112210820 TCCCTAGTTGTGTCTTAAGAAGG + Intergenic
936600049 2:113887168-113887190 GTCCCTGCTGTGTCAAAACATGG + Intergenic
937362133 2:121236789-121236811 GTGCCGGCTGTGTCTTAAGTAGG - Intronic
937647638 2:124283806-124283828 CTCCTAGCTGTGTCTTCACATGG + Intronic
938104306 2:128519783-128519805 GTCCTTGCTGTTTCCTCAGCGGG + Intergenic
938610540 2:132943522-132943544 TTCCTTCCTGTGTGTAAAGAGGG - Intronic
939394114 2:141606680-141606702 CTACTTGCTGTGTCTTCACATGG - Intronic
939451044 2:142375512-142375534 CTTCTTGCTGTGTCCTAGGATGG - Intergenic
940130442 2:150375433-150375455 GTCTTTGCTGTGGCTGAAGTAGG + Intergenic
940131696 2:150389092-150389114 CTCCTTGCTGTGTCCTTACATGG - Intergenic
940515329 2:154677239-154677261 CTTCTTGCTGTGTCATAACATGG - Intergenic
941339467 2:164288699-164288721 TTTCTTGATGTTTCTTAAGAAGG - Intergenic
941449675 2:165644980-165645002 CTCCTTGCTGTGTCCTCATATGG + Intronic
941857722 2:170247704-170247726 CTTCTTGCTGTGTCTTCACATGG + Intronic
942166722 2:173247953-173247975 GGTCTTGCAGTGTTTTAAGAAGG + Intronic
942594840 2:177583158-177583180 TTTCTTGCTGTGTCTTCACATGG + Intergenic
942747503 2:179251779-179251801 CTTCTTGCTGTGTCTTCATATGG - Intronic
944467604 2:200018779-200018801 GTTCTTGCTGTGTCCTCACATGG + Intergenic
944891221 2:204119406-204119428 ATCCATGGTGTGGCTTAAGACGG + Intergenic
945126454 2:206516546-206516568 CTTCTTGCTGTGTCTTCATATGG + Intronic
945195487 2:207233533-207233555 CTTCTTGCTGTGTCTTCACATGG - Intergenic
945364762 2:208938485-208938507 CTTCTTGCTGTGTCTTCACATGG + Intergenic
945385639 2:209196699-209196721 GTTCTTGCTGTGTCATAACATGG - Intergenic
946700253 2:222405195-222405217 GCCTTTGCTGTGTCTGATGAAGG - Intergenic
946804252 2:223454271-223454293 CTTCTTGCTGTGTCTTCACATGG - Intergenic
946808581 2:223497627-223497649 CTTCTTGCTGTGTCTTCACATGG - Intergenic
946918624 2:224553716-224553738 CTCCTTGCTGTGTCTTCACAGGG - Intronic
948235058 2:236381152-236381174 CTCCTAGCTGTGTCTTCATATGG - Intronic
948281543 2:236751081-236751103 CTTCTTGCTGTGTCTTCAAATGG + Intergenic
1168979093 20:1989855-1989877 GTCCTTGCTGGCTGTTAGGATGG - Intronic
1169416670 20:5423157-5423179 CTTCTTGCTGTGTCTTCATATGG - Intergenic
1169494636 20:6102877-6102899 TTTCTTGCTCTTTCTTAAGAAGG + Intronic
1169631624 20:7638895-7638917 GTCTTTGCTGTTTCTCACGAAGG - Intergenic
1169782656 20:9325997-9326019 GTTCTTGCTGTGTCTTCACACGG + Intronic
1169944643 20:10975618-10975640 CTGCTTGCTGTGTCTTCACATGG + Intergenic
1171015169 20:21534182-21534204 CTTCTTGCTGTGTCATAATATGG - Intergenic
1171728240 20:28647820-28647842 GTTCTTGTTGTATCTTCAGATGG - Intergenic
1172305915 20:33880617-33880639 CTCCTTGCTGTGTCCTCACATGG - Intergenic
1172424623 20:34846856-34846878 CTCCTTGCTGTCCCTTTAGAAGG + Intronic
1173623721 20:44456126-44456148 TTCCTGGCTGTGCCTTAGGAAGG - Intronic
1174969290 20:55255558-55255580 GTCCTTGTCCTGACTTAAGATGG + Intergenic
1175287736 20:57849041-57849063 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1175701895 20:61145257-61145279 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1177720563 21:24901559-24901581 CTTCTTGCTGTGTCCTAACATGG - Intergenic
1177813422 21:25949640-25949662 GTCCTTGCTGGATCTTGAGGAGG + Intronic
1178201688 21:30414450-30414472 GTCCTTGCCTTTTATTAAGAGGG - Intronic
1178343938 21:31808990-31809012 CTTCTTGCTGTGTCATAACATGG - Intergenic
1178730261 21:35095510-35095532 CTTCTTGCTGTGTCTTCACATGG - Intronic
1179207100 21:39291847-39291869 TGCCTTGCCGTGTCTTAAGGAGG - Intronic
1179241397 21:39596288-39596310 ATTCTTGCTGTGTCTTCACATGG - Intronic
1179286640 21:39983464-39983486 TGCCTTGCGGTGTCTTAAGAAGG - Intergenic
1179425386 21:41274090-41274112 CTTCTTGCTGTGTCTTTACATGG - Intronic
1180131706 21:45830887-45830909 GTCCCTGCTGTCTATGAAGAAGG + Intronic
1180867861 22:19129780-19129802 GTCCCAGTTGTGTTTTAAGATGG - Intergenic
1181412947 22:22737775-22737797 CTCCTTGCTGTGTCATCACATGG - Intronic
1181420782 22:22796794-22796816 CTCCTTGCTGTGTCCTCACATGG + Intronic
1181887437 22:26032378-26032400 TTTCTTGCTGTGTCTTCACATGG + Intergenic
1182056245 22:27357485-27357507 GTTCTTGCTGTGTATTCACATGG - Intergenic
1182401846 22:30084251-30084273 CTTCTTGCTGTGTCATAACATGG + Intronic
1182704917 22:32271059-32271081 CTCCTTGCTGGGACTGAAGAGGG - Intergenic
1182867370 22:33615526-33615548 CTTCTTGCTGTGTCTTCACATGG - Intronic
1182951031 22:34376029-34376051 CTTCTTGCTGTGTCATAACATGG + Intergenic
1183110955 22:35648253-35648275 GTCCTGGCTGTGTTATAGGATGG - Intergenic
1183238895 22:36640943-36640965 GTCCTTGGTGTGCCCCAAGAAGG - Intronic
1184105237 22:42363593-42363615 GTCCTTGCTGTCTTTTGAGGAGG + Intergenic
1185080090 22:48704929-48704951 CTGCTTGCTGTGTCCTGAGATGG + Intronic
949798052 3:7872398-7872420 CTTCTTGCTGTGTCTTCACAAGG - Intergenic
950851602 3:16067442-16067464 CTTCTTGCTGTGTCATAACATGG - Intergenic
951179302 3:19640245-19640267 CTCCTTGCTGTGTAGTAACATGG - Intergenic
952328988 3:32346545-32346567 CTTCTTGCTGTGTCTTTACATGG + Intronic
953153240 3:40344288-40344310 ATCCTTGCTTTTTATTAAGAGGG - Intergenic
953322013 3:41981071-41981093 GTACTGTCTGTGTCTTAAAAAGG + Intergenic
953349697 3:42206141-42206163 GTCCTTCCTTTGACATAAGAAGG - Intronic
953361406 3:42300555-42300577 CTTCTTGCTGTGTCCTTAGATGG + Intergenic
953364836 3:42335311-42335333 TTCCTTGCTGTGCCCTGAGAAGG - Intergenic
953609714 3:44437580-44437602 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
954769443 3:52952926-52952948 CACCTTGCTGTGTCTTCACATGG - Intronic
954928634 3:54260406-54260428 CTTCTTGCTGTGTCATAACATGG + Intronic
955909392 3:63844735-63844757 CTTCTTGCTGTGTCATAACATGG - Intronic
957178735 3:76848674-76848696 CTCCTTGCTGTGTCTTCACATGG + Intronic
957871319 3:86093413-86093435 GTCATTGCTGTGGCTTGAGTAGG + Intergenic
959750744 3:109831656-109831678 GTCCTTGCTCTGTCAGATGAAGG + Intergenic
960629050 3:119710339-119710361 CTTCTTGCTGTGTCTTCACATGG + Intronic
962727255 3:138242852-138242874 ATCTTTACTCTGTCTTAAGAAGG + Intronic
962842089 3:139243291-139243313 CTTCTTGCTGTGTCTTCACATGG + Intronic
964656311 3:159069979-159070001 GTGCTTACTGAGTTTTAAGAAGG - Intronic
965046951 3:163590642-163590664 GTCCTTTCTCTGTCTTTATAGGG + Intergenic
965708943 3:171537136-171537158 CTCCTTGCTGTGTCCTCATATGG + Intergenic
965881089 3:173389068-173389090 TTCCTTTCTGTGACTGAAGATGG - Intergenic
966147018 3:176823680-176823702 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
966684629 3:182680574-182680596 CTTCTTGCTGTGTCCTCAGATGG - Intergenic
968769760 4:2497200-2497222 GTGCTTTCAGTGTCTTTAGAAGG + Intronic
969934049 4:10663903-10663925 CTGCTTGCTGTGTCTTCACATGG - Intronic
970039653 4:11781705-11781727 GTCCTTTCTGTATCCTCAGAAGG - Intergenic
970194090 4:13539419-13539441 CTTGTTGCTGCGTCTTAAGAGGG - Intergenic
970222998 4:13829646-13829668 CTTCTTGCTGTGTCATAACATGG - Intergenic
970374878 4:15446933-15446955 GTCATTGCTGTTTTTTAAGCCGG - Intergenic
970698307 4:18704447-18704469 CTTCTTGCTGTGTCCTAACAGGG + Intergenic
970920295 4:21386176-21386198 ATCCTTGCTCTTTCTTAAGGCGG + Intronic
971420775 4:26472174-26472196 CTTCTTGCTGTGTCTTCACATGG - Intergenic
972260387 4:37402141-37402163 CTTCTTGCTGTGTCATAACATGG - Intronic
974072902 4:57141304-57141326 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
974148947 4:57981002-57981024 ATCCTTGCTGTCTCTTGTGATGG + Intergenic
974684394 4:65206575-65206597 CTTCTTGCTGTGTCTTCAAATGG + Intergenic
974691617 4:65304598-65304620 GTCCCTTCTGTGTCTTCACATGG - Intergenic
974696498 4:65381836-65381858 CTTCTTGCTGTGTCTTTATATGG - Intronic
974821464 4:67071381-67071403 GTTCTTGCTGTGTCCTCACATGG - Intergenic
974868523 4:67609527-67609549 CTTCTTGCTGTGTCCTAATATGG + Intergenic
975168057 4:71200548-71200570 GTCATAGCTGTGTCTAAATAAGG - Intronic
975509376 4:75176429-75176451 TTTCTTGCTGTGTCATAACATGG - Intergenic
976007788 4:80451205-80451227 CTCCTTGCTGTGTCCTCAGGTGG + Intronic
976643350 4:87362151-87362173 GTCCTTGCCTTTTATTAAGAAGG - Intronic
976663843 4:87569060-87569082 CTTCTTGCTGTGTCTTCACATGG + Intergenic
976988305 4:91329639-91329661 GTTCTTGTTGTGTCTTCACATGG + Intronic
977423717 4:96837926-96837948 CTTCTTGCTGTATCTTAACATGG - Intergenic
977682363 4:99810681-99810703 CTTCTTGCTGTGTCTTCACATGG - Intergenic
977772272 4:100873683-100873705 ATTCTTGCTGTTTCTTAAGATGG - Intronic
978506037 4:109457440-109457462 CTTCTTGCTGTGTCATAACATGG + Intronic
978674010 4:111287819-111287841 ATCCCTGCTGAATCTTAAGAAGG + Intergenic
978852188 4:113352331-113352353 GTCCATTCTGTGTCTAAACAAGG + Intronic
980729522 4:136809200-136809222 CTTCTTGCTGTGCCTTAACATGG + Intergenic
982549309 4:156777521-156777543 TTTCTTCCTGTGTCTTCAGATGG - Intronic
983530495 4:168805220-168805242 GCCCCTGCTGTGTATTTAGAGGG + Intronic
984273112 4:177572552-177572574 CTTCTTGCTGTGTCATAACATGG + Intergenic
984441317 4:179774196-179774218 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
984857546 4:184207902-184207924 CGCCTTGCTGTGTCCTCAGATGG + Intronic
986805816 5:11307985-11308007 GTCTTTGCTGTGTCCTCACATGG - Intronic
986985783 5:13499688-13499710 CTGCTTGCTGTGTCCTAACATGG - Intergenic
986986316 5:13504455-13504477 CTTCTTGCTGTGTCTTCACATGG + Intergenic
987166353 5:15202269-15202291 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
987424366 5:17756174-17756196 GTCCTTGATGTGTCTAAGGCTGG + Intergenic
987839683 5:23207180-23207202 CTTCTTGCTGTGTCTTCACATGG + Intergenic
989522689 5:42420432-42420454 CTCCCTGCTGTTTCTTAAGCAGG - Intergenic
990532047 5:56683828-56683850 CTTCTTGCTGTGTCTTCACATGG - Intergenic
990807568 5:59682659-59682681 CTCCTTGCTGTGTTTTTACATGG - Intronic
991183347 5:63779903-63779925 CTCCTTGCTGTATCTTCACATGG + Intergenic
992397601 5:76382056-76382078 GGCCTTCCTGTCTCTTTAGAAGG + Intergenic
994254408 5:97576275-97576297 CTTCTTGCTGTGTCTTCACATGG - Intergenic
994564011 5:101417133-101417155 CTTCTTGCTGTGTCTTCATATGG + Intergenic
995425300 5:112014635-112014657 ATCTTTGCTGGGTCTTAACAAGG + Intergenic
995788802 5:115861201-115861223 GTTCTAGCTGTGTCTTAGAAAGG + Intronic
999107536 5:149086940-149086962 GTCCCTGCTGTGTTTCAAGACGG - Intergenic
999458776 5:151740044-151740066 GTCCTTGCTCTGTGTGCAGAGGG + Intergenic
1001059055 5:168472696-168472718 GTGCTTTCTGTATCTCAAGAAGG + Intergenic
1001335336 5:170791920-170791942 CTTCTTGCTGTGTCATCAGATGG + Intronic
1002119401 5:176990312-176990334 CTTCTTGCTGTGTCTTCACATGG - Intronic
1002453864 5:179334502-179334524 GCGCTTGCTGTGGATTAAGATGG - Intronic
1003193031 6:3890836-3890858 ATTCTTGCTGTGTCTTCACATGG + Intergenic
1003650197 6:7952243-7952265 CTCATTGCTGTTTCTTAACAAGG - Intronic
1005118622 6:22365872-22365894 CTTCTTGCTGTGTCATAAAATGG + Intergenic
1005878498 6:30034716-30034738 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1005916334 6:30355310-30355332 GTCCTTGCTGTGCTTCAAGGGGG + Intergenic
1006294441 6:33163806-33163828 GGCCTTGCTGTGTCTTCAGGGGG + Exonic
1007031889 6:38635675-38635697 CTTCTTGCTGTGTCATAACATGG - Intronic
1007548377 6:42710529-42710551 TGCCTGGCTTTGTCTTAAGAGGG - Intronic
1008798784 6:55340986-55341008 GTCATTGCTGAGGCTTGAGAAGG + Intronic
1009324013 6:62327922-62327944 CTCCTTGCTGTGTCCTCACATGG + Intergenic
1009501548 6:64420193-64420215 GTTCTGGCTGTGGCTTCAGAGGG - Intronic
1009627258 6:66150805-66150827 GAGATTGCTGTGTCTTATGATGG + Intergenic
1009758489 6:67972956-67972978 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1009992733 6:70863907-70863929 GTCCTAGTTGTGTCTAAGGAAGG - Intronic
1011441313 6:87390602-87390624 CTTCTTGCTGTGTCTTCACATGG + Intronic
1011672761 6:89699600-89699622 GTCCTTGCTGCATCATCAGAAGG - Exonic
1011777028 6:90742327-90742349 CTTCTTGCTGTGTCCTCAGATGG - Intergenic
1012109816 6:95215195-95215217 TTCCTTGCTGTGTCTCAAACTGG - Intergenic
1012405896 6:98897700-98897722 TTTCCTGCTGTGTCTTAACATGG + Intronic
1013473787 6:110488775-110488797 ATCCTTGCCTTTTCTTAAGAGGG - Intergenic
1013823697 6:114185362-114185384 CTTCTTGCTGTGTCTTCACATGG - Intronic
1014403809 6:121023821-121023843 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1014524608 6:122487565-122487587 CTTCTTGCTGTGTCTTCACATGG - Intronic
1014912303 6:127109632-127109654 CTCCTTGCTATGTCTTCACATGG + Intergenic
1015927873 6:138328467-138328489 TTTCTTCCTGTGTCTTAACATGG + Intronic
1016329534 6:142943144-142943166 GTCCTTTCTGTGACTAAAGTGGG - Intronic
1016371844 6:143382902-143382924 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1017186968 6:151611457-151611479 CTTCTTGCTGTGTCTTCACATGG + Intronic
1017320161 6:153082399-153082421 TTCCTCTCTGTGTCTTAAGCTGG + Intronic
1017324911 6:153132639-153132661 CTCCTTGCTGTGTCTTCACGTGG + Intergenic
1017497222 6:154993594-154993616 GTGCTTGCTTTGTTTTGAGATGG - Intronic
1018225869 6:161628370-161628392 CTTCTTGCTGTGTCTTCACACGG + Intronic
1018234902 6:161714426-161714448 CTCCTTGCTGTGTCTTCACATGG - Intronic
1018288233 6:162263945-162263967 GTCCTTGCTGTGTCTTAAGAGGG - Intronic
1018520578 6:164645669-164645691 GTTCTTGCTGTGTCCTCACATGG - Intergenic
1019229659 6:170548729-170548751 TTTCCTGCTGTGTCTTAACATGG - Intronic
1019401233 7:855337-855359 CACCTTGCAGTGTCTTCAGAGGG + Intronic
1020628739 7:10615262-10615284 GTCATTGCTGGGTCTTGAGGTGG - Intergenic
1020635983 7:10696214-10696236 GTCATTGCTGAGGCTTAAGTAGG + Intergenic
1021097064 7:16547153-16547175 TTCCTGGCTGTGTCTTCAGCTGG - Intronic
1021265936 7:18522722-18522744 GCCCATGATATGTCTTAAGAAGG + Intronic
1021412796 7:20347064-20347086 CTTCTTGCTGTGTCTTCATATGG - Intronic
1022647611 7:32245787-32245809 CTCCTTGCTGTGTCCTCACATGG + Intronic
1023588790 7:41759161-41759183 GTCCTTGCCTTTTATTAAGAAGG + Intergenic
1024250563 7:47502825-47502847 CTCCTTGCTGAGTCTGTAGAAGG - Intronic
1025768604 7:64482498-64482520 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
1026104590 7:67410781-67410803 CTCCTTGCTGTGTCCTCAAAAGG - Intergenic
1026248016 7:68640096-68640118 GTTCTTGCTGTGTCTTCACATGG - Intergenic
1026330038 7:69344035-69344057 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1026479229 7:70764147-70764169 GGCCTTGCTTTTTCCTAAGAGGG + Intronic
1026508182 7:71004552-71004574 CTTCTTGCTGTGTCTTAACATGG + Intergenic
1027409817 7:77904595-77904617 CTTCTTGCTGTGTCTTCACAGGG + Intronic
1028462813 7:91115345-91115367 CACCTTGCTGTGTCTTCACAGGG + Intronic
1028953589 7:96664437-96664459 GTCCTTGCTGTCTTTGAAGATGG - Intronic
1029302961 7:99598956-99598978 GTCCTTTCTGTTTTTTGAGACGG + Intronic
1029601574 7:101566621-101566643 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1031035918 7:116787483-116787505 CTTCTTGCTGTGTCATAACATGG + Intronic
1031448213 7:121881184-121881206 CTTCTTGCTGTGTCTTTACATGG - Intronic
1031656212 7:124359547-124359569 CTCCTTGCTGTATCTTCACATGG + Intergenic
1032715680 7:134507188-134507210 CTTCTTGCTGTGTCTTCAGATGG - Intergenic
1032935345 7:136723631-136723653 CTTCTTGCTGTGTCATAACATGG - Intergenic
1033578013 7:142704614-142704636 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
1034055880 7:148034504-148034526 CTTCTTGCTGTGTCATAACATGG - Intronic
1034056128 7:148036525-148036547 CTTCTTGCTGTGTCATAACATGG - Intronic
1035279802 7:157770729-157770751 GACCTTGCTGTGTCTGGAGCTGG - Intronic
1036461292 8:8955195-8955217 CTTCTTGCTGTGTCATAACATGG - Intergenic
1036730891 8:11263629-11263651 CTCTTTCCAGTGTCTTAAGATGG + Intergenic
1036752214 8:11450553-11450575 GTAAGTGCTGTGGCTTAAGAGGG - Intronic
1037586916 8:20283351-20283373 CTTCTTGCTATGTCTTCAGATGG - Intronic
1038852689 8:31295562-31295584 GTCTTTTCTGTGTCCTAACATGG + Intergenic
1039100302 8:33934507-33934529 CTTCTTGCTGTGTCTTAGCATGG + Intergenic
1039165115 8:34670280-34670302 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1039772571 8:40702096-40702118 TTTCTTGCTGTGTCATAACATGG - Intronic
1039853754 8:41395217-41395239 CTTCTTGCTGTGTCATAACATGG + Intergenic
1040026098 8:42784323-42784345 GTCCCTGCCTTGTCTCAAGAGGG - Intronic
1041324954 8:56653827-56653849 GTCTTTGTGGTGTTTTAAGAAGG - Intergenic
1043255753 8:78134871-78134893 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1043412756 8:80015704-80015726 ATCCTTGCTGTGTCTGAATCTGG - Intronic
1044560873 8:93610885-93610907 GTCTTTTCATTGTCTTAAGAAGG - Intergenic
1044847456 8:96396178-96396200 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1045313366 8:101022857-101022879 CTTCTTGCTGTGTCATAACACGG - Intergenic
1045428165 8:102087509-102087531 GTCCTTGCCTTTTATTAAGAGGG - Intronic
1045434306 8:102145414-102145436 TTACTTGCTGTGTCTTCACATGG + Intergenic
1045542741 8:103102135-103102157 CTCCTTGCTGTGTGTTGATATGG + Intergenic
1045825094 8:106387919-106387941 GTCCTTAATGTGTCCTAGGATGG - Intronic
1048076353 8:131075417-131075439 CTTCTTGCTGTGTCCTAACATGG - Intergenic
1049124613 8:140775511-140775533 GTCCTTGATTTTTTTTAAGACGG + Intronic
1049774333 8:144397592-144397614 CTCCTTGCTGGGGCTGAAGAGGG + Exonic
1050190078 9:3015728-3015750 CTTCTTGCTGTGTCTTACCACGG + Intergenic
1051225271 9:14892422-14892444 GTCCTTGCCTTTTATTAAGAGGG - Intronic
1051313950 9:15808952-15808974 CTTCTTGCTGTGTCTTCACATGG + Intronic
1051523458 9:18016270-18016292 GTCCTTACAGTCTCTTAAGTGGG + Intergenic
1052445179 9:28552528-28552550 TTCAATGATGTGTCTTAAGATGG + Intronic
1052891494 9:33704440-33704462 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
1053044250 9:34900844-34900866 TTCCTTGCTGTGTCCTCACATGG - Intergenic
1053369996 9:37552786-37552808 GTCCTTGCTCTGTTCTTAGATGG + Intronic
1053829637 9:42064310-42064332 CTTCTTGCTGTGTCATAACAAGG + Intronic
1054600924 9:67123144-67123166 CTTCTTGCTGTGTCATAACAAGG - Intergenic
1055578236 9:77681140-77681162 CTCCTTGCTGTGCCTTCACACGG - Intergenic
1056463257 9:86828450-86828472 GTCCTTCCTATGTCTAAGGATGG - Intergenic
1057951277 9:99370673-99370695 CTCCTTGCTGTGTCTTTACATGG - Intergenic
1058015750 9:100030474-100030496 GTCCTTGCCTTTTATTAAGAGGG - Intronic
1058335866 9:103828250-103828272 CTTCTTGCTGTGTCTTCACACGG - Intergenic
1058356011 9:104084112-104084134 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
1058600091 9:106659877-106659899 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1058777355 9:108297450-108297472 CTTCTTGCTGTGTCATAACATGG + Intergenic
1059474489 9:114533598-114533620 TTTCTTGCTGTGTCTTCACATGG + Intergenic
1059496992 9:114718235-114718257 CTTCTTGCTGTGTCTTCATATGG - Intergenic
1059519835 9:114930767-114930789 GTCCTTGCTGGGTCTCAGGGAGG + Intergenic
1059808985 9:117835211-117835233 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1060681377 9:125568105-125568127 GTCCTTGCCTTTTATTAAGAGGG - Intronic
1060739262 9:126087502-126087524 TTTCTTGCTGTGTCATAACATGG + Intergenic
1061375191 9:130219924-130219946 GTCCCAGCTGTGTCTGCAGAGGG + Intronic
1062512483 9:136914430-136914452 GGCCCTGCTGTGGCTCAAGATGG + Intronic
1186396568 X:9214614-9214636 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1186716590 X:12258429-12258451 CTTCTTGCTGTGTCATAACATGG - Intronic
1186929036 X:14367828-14367850 CTTCTTGCTGTGTCCTAACATGG - Intergenic
1187329148 X:18319894-18319916 TTTCTTGCTGTGTCTTCACATGG - Intronic
1187555626 X:20348685-20348707 CTCCTCGCTGTGTCTTCACATGG + Intergenic
1189017669 X:37301263-37301285 GCCATTGCTGTGGCTTAAGTAGG - Intergenic
1189259945 X:39671178-39671200 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1189404038 X:40702028-40702050 CTTCTTGCTGTGTCTTCACATGG - Intronic
1189793962 X:44629674-44629696 CTCTTTGCTGTGTCTTCACATGG - Intergenic
1189815578 X:44821610-44821632 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1190962548 X:55266973-55266995 GTCCTTGCCTTTTATTAAGAGGG - Intronic
1191005939 X:55711639-55711661 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
1193705899 X:84820288-84820310 ATCCTTGCTTTTTATTAAGAGGG + Intergenic
1193995217 X:88358436-88358458 CTTCTTGCTGTGTCATAACATGG + Intergenic
1194040919 X:88941198-88941220 GTCCTTGCCTTTTATTAAGAGGG + Intergenic
1194950490 X:100120216-100120238 GTCCATGCTGTGACTCCAGATGG - Intergenic
1195463027 X:105148880-105148902 ATTCTTGCTGTGTCTTCAAATGG - Intronic
1196975258 X:121151932-121151954 GTCCTTGCCTTTTATTAAGAGGG - Intergenic
1197401162 X:125992506-125992528 CTTCTTGCTGTGTCTTCAGATGG + Intergenic
1197405762 X:126047075-126047097 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1197712965 X:129685385-129685407 CTTCTTGCTGTGTCTTCACATGG + Intergenic
1198009736 X:132539396-132539418 CTTCTTGCTGTGTCCTAACATGG + Intergenic
1198798112 X:140421195-140421217 CTTCTTGCTGTGTCATAACATGG + Intergenic
1199155313 X:144539690-144539712 CTTCTTGCTGTGTCTTCACATGG - Intergenic
1199191150 X:144972633-144972655 ATCCTTGCTGTGTCTTCACATGG - Intergenic
1199869681 X:151887234-151887256 GTCCTTACTGTCTCTTAGTAGGG - Intergenic
1199938855 X:152604497-152604519 CTCCTTGCTGTGTCATATGGGGG + Intergenic
1202013737 Y:20377990-20378012 ATACTTGCTGTGTCTTTAAATGG + Intergenic