ID: 1018292787

View in Genome Browser
Species Human (GRCh38)
Location 6:162310103-162310125
Sequence AGTCTGTATGAGAATATAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018292786_1018292787 -6 Left 1018292786 6:162310086-162310108 CCACATTTTCTTTATCTAGTCTG 0: 40
1: 1149
2: 9195
3: 27184
4: 13564
Right 1018292787 6:162310103-162310125 AGTCTGTATGAGAATATAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018292787 Original CRISPR AGTCTGTATGAGAATATAGA CGG Intronic
No off target data available for this crispr