ID: 1018294203

View in Genome Browser
Species Human (GRCh38)
Location 6:162328412-162328434
Sequence CTGTGTTCACAGAACAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018294203 Original CRISPR CTGTGTTCACAGAACAAGCA GGG (reversed) Intronic
900802238 1:4744566-4744588 CTGTGTGCACACAACATGAAGGG + Intronic
901549418 1:9984399-9984421 CTTTGTACAGAGAACAAGCTTGG + Exonic
902050467 1:13560372-13560394 CTCTGTGCACAGACCAAGGAAGG + Intergenic
904466306 1:30709926-30709948 CTGTGTGCACAGCACAAGCCAGG - Intergenic
907571318 1:55486620-55486642 CTGTGTTCACAGCCCAGGCTGGG + Intergenic
907654070 1:56324426-56324448 ATGTGGTAACAGAACAAGTAAGG - Intergenic
908144840 1:61229610-61229632 CTTTGATCACAGAGCAAGGATGG - Intronic
908645755 1:66275945-66275967 CTGTGTCCACAGAGTAAGCTGGG + Intronic
909207847 1:72782283-72782305 CTGTGTTCTCTAAACAAGAAGGG + Intergenic
910147161 1:84094546-84094568 CTGTGTTCAGAGAACATGTTTGG + Intronic
912451796 1:109771990-109772012 GTGTGTGCACAGAGCCAGCATGG + Intronic
914714252 1:150240987-150241009 CTGTCATCACAGAACAAAAAGGG - Intergenic
917221354 1:172732112-172732134 CTGGTTTCATAGAACAAGCTTGG - Intergenic
917459037 1:175212382-175212404 CTTTGTTCACAGAACTAATATGG - Intergenic
918148499 1:181778781-181778803 CTGTGTTCAGAGAGCAGCCAGGG - Intronic
918185772 1:182126517-182126539 CTGTGTTCTGAGATAAAGCAAGG - Intergenic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
918955889 1:191206473-191206495 CAATGTTCACAGTAAAAGCAAGG - Intergenic
919459925 1:197864572-197864594 CTGTGTTCACTGAAAAGGCCTGG + Intergenic
920186024 1:204159989-204160011 CTGAGTTCACAGAAAAAGGAAGG + Intronic
920386830 1:205575521-205575543 CTCTTTTCACAGAACCAGGAAGG + Intronic
920945864 1:210528017-210528039 CTGTGTTCCAAGAACAAGTAGGG - Intronic
921739460 1:218667305-218667327 CTGTTTTAAAAGAACAAGGAAGG + Intergenic
923090052 1:230733598-230733620 CTGTTTTCACACAATAAGCAAGG - Intergenic
924674793 1:246164983-246165005 CAGTGTGCAGAGAACAAACAAGG + Intronic
1063119286 10:3093258-3093280 CAGTGTTGAAAGACCAAGCAAGG + Intronic
1063135708 10:3214427-3214449 CTGTGTTCACAGCAAAGCCAGGG + Intergenic
1063232257 10:4076681-4076703 TTGTGGCCCCAGAACAAGCAGGG + Intergenic
1064142047 10:12798843-12798865 CTGTGCACACAGAAGAATCAGGG + Intronic
1065810504 10:29438618-29438640 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1067066924 10:43109375-43109397 CTGTGTGCACAGAAGAGGCCTGG + Intronic
1067732245 10:48820679-48820701 CGGTGTTCTCAGGAGAAGCAGGG + Intronic
1068465614 10:57386683-57386705 CTGTGCTTAGAGGACAAGCAAGG + Intergenic
1069687529 10:70327991-70328013 CTTTGGCCACTGAACAAGCAAGG - Intronic
1071283805 10:84125952-84125974 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1073574506 10:104611398-104611420 GTTGGTTCACAGGACAAGCAGGG - Intergenic
1075719401 10:124576114-124576136 CTGTGTTCACTGAACACCCCGGG + Intronic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1081560900 11:44215643-44215665 CTTATTTCAGAGAACAAGCAAGG - Intronic
1085038595 11:73313951-73313973 CTGTGTTCACAAGCCAAGCCTGG - Intronic
1085393372 11:76193882-76193904 CTGTGGTCACAGAACAACTCGGG - Intronic
1085818377 11:79765916-79765938 ATGTTTTCACAGGACAAGCCTGG - Intergenic
1086414029 11:86570849-86570871 CTGTGCTCACACAGCCAGCATGG + Intronic
1086985964 11:93249561-93249583 CAGTGGTCAAGGAACAAGCAGGG - Intergenic
1087209523 11:95432535-95432557 CTATCTCCCCAGAACAAGCAAGG + Intergenic
1087294306 11:96351985-96352007 CAGTGTCCACAAAAAAAGCAAGG - Intergenic
1089751296 11:120653205-120653227 TTGTATTCAAAGTACAAGCATGG + Intronic
1090866962 11:130709733-130709755 CTGTGTTATCAGAACAATCTGGG + Intronic
1090939167 11:131372476-131372498 TTGTGCACCCAGAACAAGCAGGG - Intronic
1093128291 12:15357042-15357064 CAGTGTTCACACCACATGCATGG - Intronic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1098304693 12:69090788-69090810 CTGTTTGCAGAGAACAAGGATGG + Intergenic
1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG + Intronic
1099955495 12:89349551-89349573 TTGTGTTCACAGATGAAGCCCGG - Exonic
1099959574 12:89383863-89383885 CTGTGTTCATTGAACACCCAAGG - Intergenic
1100524703 12:95408413-95408435 CTGTGCTCACAGGAGCAGCATGG + Intergenic
1101444281 12:104726500-104726522 CTCTTTCCACAGAACAAGCAGGG + Intronic
1101743684 12:107521724-107521746 TTGTGCTCAAGGAACAAGCAGGG - Intronic
1102757629 12:115355988-115356010 CTGTGTGCAGAGACCAGGCAGGG - Intergenic
1103447270 12:121002318-121002340 CTGTGAACCCAGGACAAGCATGG + Exonic
1103672975 12:122633322-122633344 GTGTGATCAGTGAACAAGCAGGG - Intergenic
1105521638 13:21136367-21136389 CTGGCTTCCCACAACAAGCATGG + Intergenic
1105669151 13:22593097-22593119 CTGTGTTCATATCACCAGCAGGG + Intergenic
1106950059 13:34873331-34873353 CAGTGATGACAAAACAAGCACGG + Intergenic
1108591858 13:51919479-51919501 CTGTGGTCAAAGTACAAACATGG - Intergenic
1110740959 13:78995970-78995992 TTGTGTTCATAAAACAAGAACGG + Intergenic
1111616987 13:90672249-90672271 CTGTGTTCCAAGAACAGACAAGG - Intergenic
1113062387 13:106337078-106337100 ATATGTTCAGAGAACCAGCAGGG + Intergenic
1113454883 13:110441283-110441305 CTGTGGTCCTGGAACAAGCATGG - Intronic
1114539976 14:23447984-23448006 TTATGTTCACAAATCAAGCAAGG + Intergenic
1117020446 14:51565131-51565153 CTGTGTACACAGAAGAACAAAGG - Intronic
1117157504 14:52955299-52955321 CTGTTTTCACAGACCAAAGAAGG + Intergenic
1117179897 14:53181153-53181175 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1117858218 14:60058543-60058565 GTGTATTAAAAGAACAAGCATGG + Intronic
1118475741 14:66115209-66115231 GTGGGTTCACAAAACCAGCACGG - Intergenic
1119467156 14:74867300-74867322 TTGTGTTCACTGAACAGGCCAGG + Intronic
1125038691 15:35157757-35157779 ATTTGTTCACAGAACAGGAATGG - Intergenic
1127630986 15:60827584-60827606 CTGTGTTCAGACAACCAGCTTGG + Intronic
1127769125 15:62216568-62216590 CTGTGTGCTCAGAAGAACCAGGG - Intergenic
1127785762 15:62353412-62353434 CTGGGCTTCCAGAACAAGCAGGG + Intergenic
1130373228 15:83305297-83305319 CTGTGTTCAGGGAACAAGAGAGG - Intergenic
1131538414 15:93256067-93256089 CTTTGTTCAAAAAAAAAGCAGGG - Intergenic
1131842209 15:96449521-96449543 CTGTGTTGACAAAATAAGCAGGG - Intergenic
1132714018 16:1281781-1281803 GGGAGTTCTCAGAACAAGCACGG + Intergenic
1132858856 16:2060186-2060208 CTGTGAGCACAGAACGAGGACGG - Intronic
1132981617 16:2741153-2741175 CTGGGTTCACACAACAAGCTCGG - Intergenic
1135146614 16:19968340-19968362 ATGTGGTCACAGTACAAGAAAGG + Intergenic
1135900563 16:26455813-26455835 CTGAGCACACAGAACAAACAAGG + Intergenic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1138533585 16:57648043-57648065 CTGAGGTCACATAGCAAGCAAGG - Intronic
1140260607 16:73375485-73375507 CTGTGTTCACTGAAAAGGCTTGG - Intergenic
1141024872 16:80537080-80537102 CTTTGTTCAAAGAAGAAGAAAGG - Intergenic
1141657562 16:85424210-85424232 CTGTGTTCACAGGACTGGGATGG + Intergenic
1141806739 16:86346987-86347009 CCGAGGTCACAGAACAAGCAAGG + Intergenic
1145077866 17:19870052-19870074 CTGTATTCACAGGCCAAACATGG + Intergenic
1145869479 17:28261713-28261735 CTGACTTCCCACAACAAGCATGG - Intergenic
1146595645 17:34166166-34166188 GAGTGTTCACAGAACCACCAAGG - Intronic
1152641372 17:81450637-81450659 CTGTGTTCAGAGACCGGGCAGGG + Intronic
1152939629 17:83161362-83161384 CTGTGTGCCCAGAAGAGGCAGGG - Intergenic
1154516145 18:15167644-15167666 CTGTTTTCCCACAACAAGAAGGG - Intergenic
1156517844 18:37696249-37696271 TTCTGTTTACAGAACAAGCGTGG + Intergenic
1156609526 18:38709857-38709879 CTGTAATGACAGAATAAGCATGG - Intergenic
1158204682 18:54979561-54979583 CTGTGGTCAAAGAACAGCCAGGG + Intergenic
1159719462 18:71869392-71869414 CTGTGTTCTCATAACGACCAAGG - Intergenic
1159870074 18:73751178-73751200 CTGTGTTCTGAGAACAAGTTAGG - Intergenic
1159972230 18:74668986-74669008 GTGTGCTCCCGGAACAAGCATGG - Intronic
1161592007 19:5133131-5133153 CTGTGTCCACAGGAGATGCAGGG + Intronic
1162594780 19:11619911-11619933 CAGTGTTCAGAGAATAAGTAAGG - Intergenic
1162772555 19:12958033-12958055 CTGTGTGCACAGAAGACACATGG - Intergenic
1162997150 19:14343414-14343436 CTGTGTTCACAGAGCCAGCCAGG + Intergenic
1163807555 19:19408850-19408872 CTGGGGTCAGAGAACAAGAAGGG + Intronic
1164906712 19:31973991-31974013 CTGTGTGCTCAGAACAGGTAGGG + Intergenic
1166140332 19:40802000-40802022 CTGTGGCCCCAGACCAAGCACGG + Intronic
1168163965 19:54533909-54533931 CTGTGACCCCAGAACACGCAGGG + Exonic
1168201435 19:54818495-54818517 CTGTGACCACAGCACATGCAGGG + Exonic
1168493681 19:56832812-56832834 CTCTGTATACAGAACAAGCCTGG + Intronic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
926166302 2:10523674-10523696 CTGTGTGCCCAGCACAGGCACGG - Intergenic
926853888 2:17231049-17231071 CTGTGTTCTCACAATAAACAAGG + Intergenic
928607882 2:32960825-32960847 CTATGTTCCCACAACAAGCCAGG - Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
930603484 2:53468800-53468822 CTGTGTGCACACACCAAGGAAGG - Intergenic
932498657 2:72160634-72160656 CTTTCTTCACAGAAGAAGCTGGG - Intergenic
933060178 2:77726947-77726969 CTATGTTCACAGACCCATCATGG - Intergenic
933390247 2:81657869-81657891 CTCTGTGCACAGACCAAGGAAGG - Intergenic
933874305 2:86602845-86602867 CTGGGTTCACAGGAGTAGCAGGG - Intronic
936012667 2:108934989-108935011 GTGTGTTCACAGAACCTGCTGGG - Intronic
937057606 2:118952607-118952629 CTTTGTGCACAGACCAAGGAAGG - Intronic
937463909 2:122112495-122112517 CTCAGTTCGCAGAACTAGCAAGG + Intergenic
938102071 2:128504225-128504247 CTGAGGTCACAGAACAGGCACGG - Intergenic
938630852 2:133165598-133165620 CTGGGGTGATAGAACAAGCAGGG + Intronic
940421760 2:153487217-153487239 CTATTTTCAGATAACAAGCAGGG + Intergenic
940568647 2:155402665-155402687 CTGTGTTCCAAGTACAACCATGG - Intergenic
940736350 2:157457211-157457233 CTGTGTTCCCTGAACAAACATGG + Intronic
941624077 2:167810933-167810955 CTGTGTTCTCAGTACCAGAATGG + Intergenic
942481106 2:176389115-176389137 ATGTGTTCAGAGAAGTAGCAAGG - Intergenic
945719912 2:213407016-213407038 CTCTGTGCACAGACCAAGGAAGG + Intronic
945901012 2:215537697-215537719 CTATGTTAACAGAACCAGAATGG - Intergenic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
946551257 2:220804183-220804205 CTCCTTTCACAGAACCAGCAGGG + Intergenic
947556769 2:231099919-231099941 CTCTGTGCACAGACCAAGGAAGG - Intronic
947752773 2:232541351-232541373 CTGTATGCACAGAACAGGCCAGG - Intronic
948237108 2:236399641-236399663 CTGTGTCCACTGACCAGGCATGG + Intronic
948723124 2:239913714-239913736 CAGTGTTGACAGATCAAACATGG - Intronic
1169267329 20:4174657-4174679 CTGTGGTCAGGGAAGAAGCAGGG + Intronic
1169760994 20:9093838-9093860 CTGAGCTCTCACAACAAGCAGGG - Intronic
1170334815 20:15257420-15257442 CTGTATTCAAAGTACCAGCATGG - Intronic
1170525776 20:17235656-17235678 CTGTGTTTACACAGAAAGCAAGG - Intronic
1170920664 20:20676495-20676517 CTGTGTTCAAACAGCTAGCAAGG - Intronic
1172123483 20:32611887-32611909 CTCTGTTCACAGAGGAGGCATGG + Intergenic
1173120904 20:40287887-40287909 CAGAGTTGGCAGAACAAGCAGGG + Intergenic
1173791034 20:45827822-45827844 CTGTGTACCCAGCACAAGCTAGG - Intronic
1175805069 20:61822854-61822876 CTGTGTTCACAGATCACGGGAGG - Intronic
1176366208 21:6034327-6034349 CTTTGTTCCCAGAACCGGCAGGG - Intergenic
1177121672 21:17144671-17144693 CTGTGTTCACAAAACAGGTATGG - Intergenic
1178417543 21:32416026-32416048 CTTTGTTCAGAGAACAAGACAGG + Intronic
1178836757 21:36104961-36104983 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1179757309 21:43504218-43504240 CTTTGTTCCCAGAACCGGCAGGG + Intergenic
1180056962 21:45363935-45363957 CAGTGGTCACAGCACAAGCCAGG - Intergenic
1181327861 22:22064695-22064717 CTGTGTTTAGAGAACAAGAGAGG + Intergenic
1183108010 22:35628501-35628523 CTGTGTTAGCAGAATAAGGATGG - Intronic
1184827790 22:46964831-46964853 CTGTGGTCACTCAACAGGCATGG - Intronic
1185348330 22:50320374-50320396 CTATTTTCACAGAGCAAGCTGGG - Intronic
949768984 3:7557798-7557820 CTGTCTTAAGAGAACAAGGAGGG - Intronic
949856613 3:8467516-8467538 CTATGATCACAGAACATGGATGG - Intergenic
950162038 3:10767550-10767572 CTCTGTGGGCAGAACAAGCATGG - Intergenic
950658031 3:14449375-14449397 CTGAGTTCACAGACAAAGAAAGG + Intronic
950846896 3:16023506-16023528 CTCTGTGCACAGACCAAGGAAGG - Intergenic
953216662 3:40924632-40924654 GTCTCTTTACAGAACAAGCAAGG + Intergenic
954604412 3:51897649-51897671 CTCTGTGCACAGACCAAGGAAGG + Intronic
954715893 3:52526662-52526684 CTGTCTTCAAAAAACAAGAATGG - Intronic
956908700 3:73794660-73794682 GAGTGTTCAAAGAAAAAGCAAGG + Intergenic
957198921 3:77107076-77107098 CTGAGTTCAGAGAGCCAGCATGG + Intronic
957335463 3:78822173-78822195 CTATATGCACAGTACAAGCATGG + Intronic
960720836 3:120623059-120623081 CTCTGTGCACAGACCAAGGAAGG - Intergenic
961357419 3:126347888-126347910 CTGTGCTCGGAGAACAAGCCAGG - Intronic
962139520 3:132773579-132773601 CTTTGTTCACTGAAAAAGCATGG - Intergenic
965516279 3:169624745-169624767 CTGTTTTCCCAGACCAAACATGG + Intronic
966672809 3:182547479-182547501 CTGTGGGCACAGAACAAGCATGG + Intergenic
967213139 3:187186602-187186624 CTGTGTGGAAAGAACAAGAAAGG - Intergenic
968173850 3:196531643-196531665 TTGTGTTTGCAGAACAAGGACGG - Intergenic
969595968 4:8149474-8149496 CTGTGGACACAGACCAAGCTGGG - Intronic
970093015 4:12430877-12430899 CTCTGTGCACAGACCAAGGAAGG - Intergenic
970313185 4:14804297-14804319 CTTTGTTATGAGAACAAGCATGG - Intergenic
970431618 4:15994165-15994187 CTGTGTTCACAGATTAAACAAGG - Intronic
971408886 4:26348995-26349017 CTTTGTTTACAGACCAGGCATGG - Intronic
972631211 4:40843438-40843460 CTGTTTTTATAAAACAAGCATGG + Intronic
974832427 4:67206099-67206121 GTGTGTGCACACAACCAGCATGG + Intergenic
978313698 4:107413792-107413814 CTCTGTGCACAGATCAAGGAAGG + Intergenic
981611982 4:146603275-146603297 CTGTGTTCACAGAACACACTTGG + Intergenic
983275303 4:165609564-165609586 GTGTCTTCACAGAACATGCTAGG + Intergenic
983981758 4:174006146-174006168 CTGTGTTGCCAGAACGGGCAAGG + Intergenic
984026964 4:174554523-174554545 CTGTGATTACAAAACAAACAGGG + Intergenic
984080361 4:175241202-175241224 CAGCATTCACAGAAGAAGCAGGG + Intergenic
984226557 4:177042370-177042392 TGGTGTTCAGAAAACAAGCAGGG + Intergenic
985647561 5:1092186-1092208 CTGTGTTTACAGTAAAAGGAAGG + Intronic
986147557 5:5093093-5093115 CTGTTTTCAGAGAACAAGCCAGG + Intergenic
988585744 5:32505974-32505996 AAGTTTTCACAGAACAAGCCAGG - Intergenic
989258831 5:39396534-39396556 GTGTATACACATAACAAGCAAGG - Intronic
989415710 5:41172870-41172892 GAGTGTTCACGGAAGAAGCATGG - Intronic
989615838 5:43335889-43335911 CTCTGTGCACAGACCAAGGAAGG - Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
996099928 5:119435780-119435802 CTCTGTGCACAGACCAAGGAAGG + Intergenic
998552897 5:143094272-143094294 CTCTGTGCACAGACCAAGGAAGG - Intronic
999884221 5:155902595-155902617 CTGTGGTCACAGAATAACTAGGG - Intronic
1000228839 5:159296271-159296293 ATGTGTGCGCAGAACAATCAGGG - Intergenic
1000277253 5:159748809-159748831 CTGTGATCAAAGAAGAATCAAGG - Intergenic
1000412774 5:160950880-160950902 CTGTGTACTCAGAATAAGAAAGG + Intergenic
1002262148 5:178000897-178000919 CTGTGGTCACACAGCAAGCAAGG - Intergenic
1003871624 6:10408454-10408476 ATATTTTCAAAGAACAAGCAAGG + Intronic
1004098437 6:12583188-12583210 ATGTTTTCATAAAACAAGCAGGG - Intergenic
1005968465 6:30743222-30743244 TTGTGTTCACAGAACATACTAGG + Exonic
1008836614 6:55839603-55839625 CTTTGTTCACAGACCAAGCATGG - Intronic
1009635438 6:66259372-66259394 CTCTGTGCACAGATCAAGAAAGG + Intergenic
1011274584 6:85617557-85617579 CTTTGGTCCCAGAACAAGCATGG + Intronic
1013520380 6:110927252-110927274 CTGTGATCACAGAAAAAGCAAGG - Intergenic
1014812140 6:125899337-125899359 CTGTGATCCCAGTAGAAGCAAGG - Intronic
1016792685 6:148082160-148082182 CTGGACTCACAGAAAAAGCACGG - Intergenic
1018137032 6:160788923-160788945 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1018191715 6:161314886-161314908 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1018294203 6:162328412-162328434 CTGTGTTCACAGAACAAGCAGGG - Intronic
1019091019 6:169533674-169533696 CTGTGTTCACAGAACCATGCAGG + Intronic
1019933163 7:4236909-4236931 CTGTCTCCACAAAACAAGCAAGG - Intronic
1020768772 7:12360102-12360124 CTGTGTTCACAGAACACAGTGGG - Intronic
1023329975 7:39104520-39104542 CTGGGTTCCCAGGGCAAGCATGG + Intronic
1023436732 7:40147593-40147615 CTCTGTGCACAGACCAAGGAAGG - Intronic
1023798578 7:43813949-43813971 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1028039825 7:86037642-86037664 CACTCTTCACTGAACAAGCAGGG + Intergenic
1028525215 7:91776794-91776816 GTGTGTTCACAAAATAAGCTTGG + Intronic
1028793416 7:94878423-94878445 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1030870213 7:114746590-114746612 CTGTGTTATCAGAATTAGCAGGG + Intergenic
1032137622 7:129295244-129295266 CTGGCTTCACAGAACCAGCCTGG - Intronic
1034049605 7:147968593-147968615 CTTTGTTCATAAAACAAACAGGG - Intronic
1035986444 8:4437745-4437767 CTGTCTTCACACCACAAACATGG - Intronic
1036094065 8:5703775-5703797 CTGACTTCAGAGAACAGGCAGGG - Intergenic
1036105155 8:5830296-5830318 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1036533620 8:9622493-9622515 CTAAGTTCACAGAACCATCAAGG + Intronic
1037049436 8:14351893-14351915 CCGTGTTCATATAAAAAGCATGG - Intronic
1040621212 8:49095258-49095280 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1040931505 8:52739819-52739841 CTGTGCTCACAAATAAAGCAAGG + Intronic
1041224577 8:55685648-55685670 CTGTGTTTACAGAACACTTAGGG + Intergenic
1042082266 8:65067978-65068000 CTGTGGTCAGAGAAGAAGCTTGG + Intergenic
1042088416 8:65132777-65132799 CTCTGTGCACAGATCAAGGAAGG - Intergenic
1042354315 8:67809506-67809528 CGGGGTTCACAGTAGAAGCAGGG + Intergenic
1042972388 8:74424253-74424275 CTGTGTGCACTGAACATGTATGG - Intronic
1043871831 8:85441660-85441682 CTGAGACCACAGAACTAGCAAGG + Intronic
1044129259 8:88500127-88500149 CTGTGTTCAAATAAAAAGAAAGG - Intergenic
1045363784 8:101456674-101456696 CTGTGTTCATAGAACACACTTGG - Intergenic
1047221202 8:122919794-122919816 TTGTTTTCAGAGAGCAAGCATGG - Intronic
1048353995 8:133638642-133638664 TTGTGTTCCCTGAACAAACATGG - Intergenic
1049004176 8:139844454-139844476 CGTTGTTCACAGAAAGAGCAGGG - Intronic
1049461715 8:142732638-142732660 CTCTGTGCACAGACCAAGGAAGG - Intronic
1049998775 9:1053710-1053732 TTGTGTTTACAGGACAAGAAGGG + Exonic
1055610454 9:78018977-78018999 ATCTGTTCTCATAACAAGCATGG + Intronic
1056415010 9:86367284-86367306 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1056421846 9:86436024-86436046 CTCTGTTCAGAGATCAAGAAGGG + Intergenic
1057556583 9:96093140-96093162 CTGTGATCCAAGAACAAGCCTGG - Intergenic
1059189486 9:112310872-112310894 CTGTTTTTCCAGAACATGCAAGG - Intronic
1059798976 9:117730529-117730551 CTGTGTGCATAGACCATGCAAGG + Intergenic
1059902640 9:118945346-118945368 CTGTGTGCACAGAGCCAGCACGG + Intergenic
1060617186 9:125027909-125027931 CTGAGTTCAGAAAACAAGAAGGG - Intronic
1185836935 X:3353384-3353406 CTAGCTGCACAGAACAAGCATGG - Intergenic
1186473566 X:9839528-9839550 CTGTGTCCCCAGCCCAAGCACGG + Intronic
1186727509 X:12372921-12372943 CTGGGTCCTCAGGACAAGCAAGG + Intronic
1187798999 X:23039232-23039254 CTGAGTTCAGAGAGCAAGCTGGG - Intergenic
1188623464 X:32255171-32255193 CTGTGTACACTGACCAAGAATGG - Intronic
1189034150 X:37479030-37479052 CTCTGTGCACAGACCAAGGAAGG + Intronic
1191890251 X:65932222-65932244 CTCTGTGCACAGACCAAGGAAGG - Intergenic
1192024721 X:67437300-67437322 CAGTGTTCTAAGAACAAGAAGGG + Intergenic
1192725114 X:73741777-73741799 ATGTGTTTAGAGAACCAGCATGG - Intergenic
1194258382 X:91663259-91663281 CTGAGTTCAGAGACAAAGCATGG + Intergenic
1195022514 X:100844280-100844302 CTGTGTTCTCAAAACAGGGAAGG - Intronic
1195847296 X:109241959-109241981 TTCTGTGCACAGACCAAGCAAGG - Intergenic
1196194708 X:112827521-112827543 CTGTGTGCCCAGGACAAACAAGG - Intronic
1196242378 X:113357390-113357412 ATGTGTTCAGACAAAAAGCAAGG + Intergenic
1198706870 X:139459120-139459142 CTGTATTCACAGGACTACCATGG + Intergenic
1199504269 X:148543929-148543951 CTGCCTTCACAGAACATGGAGGG - Intronic
1199637266 X:149825746-149825768 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1199637770 X:149829861-149829883 CTCTGTGCACAGACCAAGGAAGG + Intergenic
1200209300 X:154339483-154339505 CTGTGTTCATAGTAAATGCAAGG + Intergenic
1200221576 X:154392644-154392666 CTGTGTTCATAGTAAATGCAAGG - Intronic
1200577149 Y:4902754-4902776 CTGAGTTCAGAGACAAAGCATGG + Intergenic
1201900272 Y:19041390-19041412 CTCTGTGCACAGACCAAGGAAGG - Intergenic