ID: 1018296492

View in Genome Browser
Species Human (GRCh38)
Location 6:162351394-162351416
Sequence TAAAAGGTATTCAATTTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018296492 Original CRISPR TAAAAGGTATTCAATTTGAC AGG (reversed) Intronic
901361743 1:8707147-8707169 TTAATGGTACTCAACTTGACAGG - Intronic
908349548 1:63271004-63271026 TAAAACGTATACAATCTGGCAGG + Intergenic
909088025 1:71190985-71191007 TTAATGGTATCCAATTTTACTGG + Intergenic
909371713 1:74891156-74891178 GAAAACTTATACAATTTGACCGG + Intergenic
909821300 1:80065175-80065197 TGAAAGTTGTTCAATATGACTGG + Intergenic
909972951 1:82012371-82012393 TAAAATATATTCAAGTTTACTGG + Intergenic
910152294 1:84164536-84164558 AAAAAGGTATTTTATTTGTCTGG + Intronic
910707440 1:90144881-90144903 CAAAAGGAATTCAGTGTGACTGG - Intergenic
910931300 1:92445120-92445142 TAAAAAGTATTCAATATGTGAGG - Intergenic
911974242 1:104471491-104471513 TAAAAGGTGCTAAATTTGAATGG + Intergenic
912148713 1:106828814-106828836 TAAAAGGTATTCAAATTGGAAGG + Intergenic
912478220 1:109956460-109956482 TACAAAATATTCAATTTGATAGG + Intergenic
913019076 1:114768387-114768409 TAAAAGGGAGTCTATTTGCCGGG + Intergenic
913681901 1:121194131-121194153 TTTAAGGTATACAATTTGATAGG + Intronic
914033737 1:143981755-143981777 TTTAAGGTATACAATTTGATAGG + Intergenic
914155710 1:145086217-145086239 TTTAAGGTATACAATTTGATAGG - Intronic
915653623 1:157339117-157339139 TAAAGGGTATTCAAATAGAGAGG - Intergenic
916228218 1:162511461-162511483 TATAAGGAACTCAATTTGGCTGG - Intronic
917107921 1:171513340-171513362 TAAAAGTATTTCAATTTGTCAGG + Intronic
917230423 1:172830686-172830708 AGAAAGGTATTCAATTTCACTGG + Intergenic
918746254 1:188203900-188203922 TAAAAGGTGTTCAATCTGTAAGG - Intergenic
918905855 1:190492364-190492386 TAAAAGAAATTCCATTTTACTGG - Intergenic
918956557 1:191216400-191216422 TAAAATGTATTCAATTTAACTGG + Intergenic
920469217 1:206212640-206212662 TTTAAGGTATACAATTTGATAGG + Intronic
921922394 1:220684322-220684344 TAAAAGGTATTTAATGTGGAAGG + Intergenic
923482930 1:234401676-234401698 TAAAAGTTATACAATATGGCAGG + Intronic
923719822 1:236457217-236457239 TAAAACATATTCAAGTTTACCGG + Intronic
1062853368 10:763725-763747 TAAAAGATATCCAAATTGAGTGG + Intergenic
1063196451 10:3747974-3747996 AAAAAGGTATTCTATGTGACCGG + Intergenic
1063797524 10:9529352-9529374 CAAAAGCTATTCAAGTTCACAGG - Intergenic
1066517164 10:36175700-36175722 GAAAATGTATTCAATATCACTGG + Intergenic
1066698942 10:38105950-38105972 TAAAAGACATTCAAATTGAAAGG - Intronic
1066993709 10:42542277-42542299 TAAAAGACATTCAAATTGAAAGG + Intergenic
1069001707 10:63274130-63274152 TAGGAGGAATTCAACTTGACTGG + Intronic
1070034675 10:72710880-72710902 TAAAAGGTATTAAACTGGCCGGG + Intronic
1071891782 10:90015996-90016018 TAAAAGGCATCAAATTAGACAGG - Intergenic
1072767077 10:98103924-98103946 TTAAAGGTTTTCAACTTGAGTGG - Intergenic
1074191449 10:111141153-111141175 TAAAAGGTATAGAATTTAAAGGG + Intergenic
1074809414 10:117088300-117088322 TAAAAGGTACTAAATGTGAATGG - Intronic
1076316842 10:129548075-129548097 TAAACTGTATTCAATTTGCTAGG + Intronic
1079969652 11:27020606-27020628 TAAAACATCTTCAATTTCACAGG - Intergenic
1080259171 11:30327194-30327216 AAATAGGTATTCAACTTCACTGG + Intronic
1080480230 11:32639743-32639765 CAAAAAGAATTCAATTTGGCCGG - Intronic
1080977037 11:37355831-37355853 TTAAAGTTTTTCAATTTCACTGG + Intergenic
1081593498 11:44443538-44443560 TACAAGGAATTCAATATGGCTGG - Intergenic
1081832534 11:46125954-46125976 TAAAAAGTATTTAATTAGGCCGG + Intergenic
1082918386 11:58464726-58464748 TAAAAAGTATTGTATTTGGCTGG - Intergenic
1083091585 11:60205105-60205127 TAAAAAGTATTGAATTTGCATGG - Intronic
1085025252 11:73232703-73232725 TAAAAGTTATTCACTTAGGCCGG - Intronic
1085415040 11:76314100-76314122 TGAAGGGAATGCAATTTGACGGG + Intergenic
1086143267 11:83522236-83522258 TAACAGGTATTCAAATGGGCGGG - Intronic
1086790555 11:91032711-91032733 TAAAATGAAAACAATTTGACTGG - Intergenic
1086829746 11:91545697-91545719 TAAAAATTATTAAATTTGTCCGG + Intergenic
1087109469 11:94447892-94447914 TAATAAGTATTAAATTTGATTGG - Intronic
1087241485 11:95786409-95786431 TAAAAGTTATTGCATGTGACAGG - Intronic
1087995421 11:104800710-104800732 TAACAGGCATTGTATTTGACAGG + Intergenic
1093207156 12:16264403-16264425 TAAATTGTTTTCAATTTTACAGG + Intronic
1093536724 12:20231348-20231370 TTAAAGGTATTCAGTTTAAAAGG - Intergenic
1095310847 12:40694512-40694534 TAAAAAGTATTCTATTTGAGGGG - Intronic
1098225484 12:68317948-68317970 TAATACATATTCAATTTTACTGG + Intronic
1098362921 12:69672678-69672700 TAAAAGGAACTAAATTTCACTGG + Intronic
1098511363 12:71317848-71317870 AAACAGGTATTCAAATTGAAAGG + Intronic
1099493088 12:83309678-83309700 TAAAAGGTATTTAATTTTGCAGG + Intergenic
1099590132 12:84576221-84576243 TAATAGGTATTAAATGTAACAGG + Intergenic
1101288560 12:103342382-103342404 TAAAAGGTACTCAAATAGAGAGG + Intronic
1101675974 12:106916643-106916665 TAAAATGTATTCAATTAAATGGG - Intergenic
1102850485 12:116239780-116239802 TAAAAGATATGCAATTTGGGAGG - Intronic
1104085334 12:125469660-125469682 TAAAAGCTCTTCATTTTGAGGGG - Intronic
1105643410 13:22289843-22289865 AAAAAGGTATTCAAATTGAAAGG - Intergenic
1106928575 13:34639011-34639033 CAAAAGGTATTCAAATTCAAAGG + Intergenic
1108324040 13:49312832-49312854 TAAAATCTATTCAATTTGTGAGG - Intronic
1110142838 13:72151961-72151983 TAAAAGGTCTTCCATTTGAGGGG + Intergenic
1110885328 13:80625890-80625912 CAAAAGTTACTCAATATGACTGG - Intergenic
1111308111 13:86443128-86443150 TAAAAGGTATGCAATTCTTCAGG + Intergenic
1113304454 13:109061705-109061727 GAAAAGGTTTTAAATATGACAGG + Intronic
1113342172 13:109436883-109436905 TAGAAGGTATTCTAATTTACTGG + Intergenic
1114052101 14:18929060-18929082 TACAAGGTACTCAAATTAACAGG - Intergenic
1114110458 14:19472864-19472886 TACAAGGTACTCAAATTAACAGG + Intergenic
1115122350 14:29952336-29952358 TATAAGGAATTCAACATGACTGG - Intronic
1116640564 14:47456596-47456618 TAAAAGGTAAACAATTGGCCGGG - Intronic
1117522575 14:56565637-56565659 TAAAAGGTTTTCAATCAGATGGG + Intronic
1121481864 14:94284494-94284516 TAAAAGGTTTTCAAGCTGCCTGG + Intronic
1122815818 14:104313217-104313239 TAAAAGTTAGTCATTCTGACAGG - Intergenic
1123183717 14:106493953-106493975 TAAAAGGCATACAAATTGAGGGG - Intergenic
1123969817 15:25496835-25496857 TAAAAGGTATACAATTAGGAAGG + Intergenic
1124144658 15:27112734-27112756 TAAAAAGTAATCAATGTGGCTGG - Intronic
1125560518 15:40628870-40628892 TAAAAGGTATTTGTTTTGGCCGG + Intronic
1126208297 15:46071476-46071498 TAAAAGATGTTCAGTTTGACTGG + Intergenic
1126848886 15:52785788-52785810 TAAAAGGTAGTTAATTTGGTGGG + Intronic
1131915584 15:97262009-97262031 CAGAAGGAATTCAATTTGGCTGG - Intergenic
1131960745 15:97787919-97787941 TAAATGGAATTAAATTTAACTGG + Intergenic
1133012451 16:2921765-2921787 TAAAAGGTATTCATTCTGGCCGG + Intronic
1133673733 16:8049451-8049473 TAAAATTTATTCAATTTAAAGGG - Intergenic
1134282972 16:12834258-12834280 TAAAGGAGATTCAATTTGGCTGG - Intergenic
1137229677 16:46551909-46551931 TAAAAGTTCTTCGATTAGACCGG + Intergenic
1137477610 16:48824027-48824049 TAAAAGGCATTCAACTGGAAAGG - Intergenic
1138066925 16:53951708-53951730 TAAAATATATTCAGTTAGACAGG - Intronic
1142517199 17:440154-440176 TAAAAGGTCTGTAATTTGAAAGG + Exonic
1146410500 17:32579538-32579560 TTTAAGGTATACAATTTGACAGG + Intronic
1146537356 17:33664303-33664325 TAGAAGGCTTTCACTTTGACTGG - Intronic
1148062551 17:44846837-44846859 TAGAAGGTATCCCATTGGACAGG + Intronic
1149203750 17:54218820-54218842 TGAAAGTTATTTAATTTGCCTGG - Intergenic
1151708885 17:75788479-75788501 AAAAAGGTAAAAAATTTGACAGG - Intronic
1153178015 18:2400969-2400991 TAAAAGGCATCCAAATTGAGGGG + Intergenic
1153477152 18:5509437-5509459 TAAAAGGTTTGCAATTTAAATGG + Intronic
1153714443 18:7832374-7832396 GAAAAGGTGTTCAATATCACTGG - Intronic
1153966557 18:10188184-10188206 TAATAGGTTTTCAAATTTACTGG - Intergenic
1155667703 18:28331438-28331460 TAAAAGGTATACAAATTGGGAGG - Intergenic
1156314056 18:35950910-35950932 TAAAAGTTATACAATCTGGCTGG + Intergenic
1157994639 18:52540489-52540511 TAAAAGTCATTCAATTTTAGTGG + Intronic
1159430165 18:68341456-68341478 TAAAAGGTATGGAATTTTAGGGG + Intergenic
1162296358 19:9816363-9816385 TTAAAGGTATTCAGTTTTATAGG - Intronic
1162879736 19:13649138-13649160 TAAAAAGTTTTCAATTAGGCTGG + Intergenic
1164974147 19:32559205-32559227 TACAAGGTATTCAATTTTGGGGG - Intergenic
1165545716 19:36533916-36533938 TAAAAGCTATTCAAAATCACTGG - Intergenic
1168619506 19:57866744-57866766 TAAAAGGTAGTCATTTAGGCTGG + Intronic
925605723 2:5658019-5658041 TAAAATGTATTGAATATTACTGG + Intergenic
926608600 2:14922854-14922876 TAAAAAGTATTCATTTGGGCCGG + Intergenic
927347626 2:22064765-22064787 TAAAAGGTATACAGATTGTCAGG - Intergenic
929418732 2:41769460-41769482 TAAAAAGGATTGAATTTAACTGG - Intergenic
930466156 2:51752539-51752561 TAAAAGGTATTGAATCTCTCTGG - Intergenic
930508524 2:52315051-52315073 TAAAAGGTATTCTCTCTGAAAGG - Intergenic
930777512 2:55188347-55188369 GAAAAGATACTCAATTTCACTGG + Intronic
930934626 2:56932875-56932897 TTAAAGGTATTTAATTTAGCAGG - Intergenic
933129275 2:78652782-78652804 TGAAATGTATTAAATTTGTCTGG - Intergenic
933493700 2:83020684-83020706 AAAAATGTATTCCATTTGATAGG - Intergenic
935793801 2:106619535-106619557 TAAAAGGTATACAGATTGAGTGG - Intergenic
936980317 2:118257936-118257958 TAAAATATTTTCAAGTTGACTGG - Intergenic
938325648 2:130397954-130397976 TAAAAGATAACCAATTTGTCGGG + Intergenic
938423312 2:131162243-131162265 TAAAAGATAACCAATTTGTCAGG - Intronic
938585238 2:132684052-132684074 TAAAAGGTATTCTCTTCAACTGG + Intronic
940554168 2:155201794-155201816 TAAAATGGATTCCATTTTACAGG - Intergenic
940623652 2:156145917-156145939 TAAAATGTATTCACATTTACTGG - Intergenic
941968760 2:171327214-171327236 TATAAGGGATTGTATTTGACTGG - Intronic
942259513 2:174144436-174144458 TCTAGGGTATTCCATTTGACAGG - Intronic
942436975 2:175989245-175989267 TAAATGGTTTTCAATTTAAGTGG + Intronic
942808374 2:179963636-179963658 TAAAAAGTATTAAATATGGCCGG - Intronic
943954603 2:194172613-194172635 TAAGTGGAAATCAATTTGACAGG - Intergenic
943962474 2:194283965-194283987 GAAAATGTATAAAATTTGACAGG - Intergenic
1169113742 20:3049311-3049333 TAAAAGGTTTTCATTTCGGCCGG - Intergenic
1170134343 20:13056298-13056320 TAAAAGGTATGCCATGTGAAAGG - Intronic
1175049288 20:56139067-56139089 TTAAAGGTTTTCAATATGTCTGG + Intergenic
1177968716 21:27761124-27761146 TAAAAGTTATTAATTTTAACAGG - Intergenic
1178875267 21:36409295-36409317 TAAAAGGTAAACATTTTGGCAGG - Intronic
1180470573 22:15651433-15651455 TACAAGGTACTCAAATTAACAGG - Intergenic
1181656583 22:24305894-24305916 GAAAAGGTATTCAATCTTACTGG - Intronic
1183312735 22:37119842-37119864 TACAAGGTATTTGATTTTACTGG + Intergenic
1183373900 22:37451038-37451060 TAAAAGGAATCCACTTTGATAGG + Intergenic
1184914625 22:47561134-47561156 TAAAATGTATGCAAATTGAAGGG + Intergenic
949223204 3:1660636-1660658 TAAAAGGTATTCAAATAGGAAGG + Intergenic
949315850 3:2754207-2754229 TATAAAGTAATCAGTTTGACAGG - Intronic
949454355 3:4223128-4223150 TAAAAGCTATTCTATTTGTCAGG - Intronic
949660728 3:6275480-6275502 TATTAGGTGTCCAATTTGACTGG - Intergenic
951121024 3:18929061-18929083 AAAATGGCATTCAATTTGAAAGG - Intergenic
951711959 3:25592282-25592304 ATAATGGCATTCAATTTGACTGG - Intronic
951845557 3:27080736-27080758 TAAAAGGCATAGAATTTTACAGG - Intergenic
952551399 3:34482674-34482696 TAAGAAGTATTCAATATGGCAGG - Intergenic
953473640 3:43187450-43187472 TAAAAGGCATCCAAATTGAAAGG - Intergenic
953637394 3:44674736-44674758 AAAAAGGGATTTTATTTGACTGG + Intergenic
954559140 3:51541279-51541301 TATAATGTATTAATTTTGACTGG + Intronic
954953310 3:54493939-54493961 TAAAAGTTATTCAATAGGGCAGG - Intronic
955538751 3:59952119-59952141 TAGAAGGTAGTGAAATTGACTGG - Intronic
956562339 3:70593889-70593911 TAAAATGTACTCATTTTGCCAGG + Intergenic
956870168 3:73408957-73408979 TTAATGATATTGAATTTGACCGG - Intronic
957161319 3:76612916-76612938 CAAAAGGTATTCCATATGAATGG - Intronic
958830190 3:99077867-99077889 TAAAAGGTAGTCACTCTGGCTGG - Intergenic
960772100 3:121205679-121205701 TAAAAGTTATATAATTTTACAGG + Intronic
960772775 3:121213178-121213200 TAAAGGGTATTCAAATAGAAAGG - Intronic
962130918 3:132674675-132674697 TAAAAAGTATCAGATTTGACTGG + Intronic
962182550 3:133223814-133223836 TAAAAGCTATAAAACTTGACAGG + Intronic
962420172 3:135220982-135221004 GAAAAGGTTTTCAAAATGACAGG - Intronic
963168352 3:142227097-142227119 TAAAAGATAATCATTTTGGCTGG + Intergenic
963863531 3:150335193-150335215 TGAAAGTGACTCAATTTGACAGG + Intergenic
964011954 3:151902159-151902181 TAAAAGCTATTTAACTTGATGGG + Intergenic
964803364 3:160579303-160579325 TAAAAGGTACTCACTTTGATAGG - Intergenic
964843937 3:161025932-161025954 TAAAAGTTATTAAAGTTGAGTGG + Intronic
966111515 3:176408340-176408362 TTGAAGGCATTCAATTTCACAGG + Intergenic
966634108 3:182113162-182113184 GAAATGGAATTCTATTTGACTGG + Intergenic
966775712 3:183541181-183541203 TAAAAGGTATCCCTTGTGACAGG + Intronic
969207832 4:5661168-5661190 TAAATGGAATCCAATTTGAAGGG + Intronic
971468332 4:26989638-26989660 TAAAAGGCATTCAAATTGAAAGG + Intronic
971579708 4:28320024-28320046 TAAAAGGCATCCAAATTGAAGGG + Intergenic
972099648 4:35397960-35397982 TAAAGAATATTTAATTTGACTGG + Intergenic
972225250 4:37004819-37004841 TTAAAGGCATTCAATTTTATAGG + Intergenic
973115832 4:46457684-46457706 TAAAAGCTATTCCATTTAAATGG + Intronic
973937714 4:55865833-55865855 AAAAAGGCATTCAATTTTTCAGG + Intronic
973947347 4:55972355-55972377 TAAGAGGTATTAAATTAGAATGG + Intronic
974452048 4:62077232-62077254 TAAAAATTATTCAATCTGAATGG - Intronic
976424175 4:84881478-84881500 TAAAAGGAATGTAATTTGACAGG - Intronic
976517768 4:85989971-85989993 TAAAAGGTATAAAATTGGAAAGG + Intronic
976535823 4:86215563-86215585 TAAAAAATATTCAAGTTGGCAGG + Intronic
977789177 4:101078320-101078342 TAAAAGCTAATCTCTTTGACTGG - Intronic
978862204 4:113463669-113463691 TAAAAGGTATTAAAAGTGCCAGG - Intronic
979002717 4:115245690-115245712 TTAAAAGTATTTAATTTGACTGG - Intergenic
979022479 4:115521038-115521060 TAAAGGGTATTCAAATAGAAAGG - Intergenic
979096485 4:116557485-116557507 TAAAGGGTATTCAAATAGAAAGG - Intergenic
980719698 4:136679037-136679059 AAAAAGATTTTCTATTTGACTGG + Intergenic
980938770 4:139252472-139252494 GAAAAGATATTCAACTTTACTGG - Intergenic
981274235 4:142879115-142879137 TAAATGGTATTCCATTGTACAGG - Intergenic
981794435 4:148580176-148580198 TACAAGGTATACAAGGTGACTGG + Intergenic
982200059 4:152951318-152951340 TAAAGGGTGTTGAGTTTGACAGG + Intronic
983662983 4:170149697-170149719 CAAAAGGCATTCAAATTGAAAGG - Intergenic
983961103 4:173756197-173756219 TAAAAGTTAATCAACTTCACTGG - Intergenic
984371605 4:178873728-178873750 TAAGAAGAATTCAACTTGACAGG + Intergenic
984944939 4:184963332-184963354 GAAAAAGTATTCATTTTCACAGG + Intergenic
986323676 5:6655123-6655145 GAAAAAGTATTCAATGTCACTGG + Intronic
987458853 5:18181892-18181914 TACTAGGAATTCAATTTCACTGG + Intergenic
989763124 5:45044914-45044936 TCAAAGTTATTCAAGTTTACAGG + Intergenic
990219399 5:53571094-53571116 TATAAAGTATACAATTTGACTGG + Intronic
991903685 5:71486622-71486644 TAAAAGGTATTGATTTTAAAAGG + Exonic
992195915 5:74339120-74339142 TAAAAGGTAAATAATTTGGCCGG + Intergenic
993181306 5:84556525-84556547 TAAAGGGTATTCAAATAGGCAGG - Intergenic
993358605 5:86945317-86945339 TACCAGGTATTCAATTTGTATGG + Intergenic
993838509 5:92846358-92846380 TGTAAGGCATTCCATTTGACTGG - Intergenic
994089655 5:95798904-95798926 TAAAAGGTAATATATTTGCCTGG + Intronic
994325750 5:98442877-98442899 TTAAAGGCATTCAATTTTATAGG - Intergenic
995353275 5:111207094-111207116 TAAAAGATATTCATTCTCACTGG - Intergenic
995508093 5:112881203-112881225 TAAAACATATTCAAGTAGACTGG + Intronic
997864789 5:137451410-137451432 TACAATGTATTCAATTTTGCAGG + Intronic
999924237 5:156357780-156357802 TAAAAATTATGCATTTTGACCGG + Intronic
1000082334 5:157859609-157859631 TACAAGTTCTTCAATTTTACAGG - Intergenic
1000719452 5:164688692-164688714 TAAGAGGAACTCAATTTTACAGG + Intergenic
1002156779 5:177288194-177288216 AAAAAGGTACTCAAATTAACAGG - Intronic
1006546927 6:34787894-34787916 GAAAAGGTATTCAATGTCATTGG + Intergenic
1006820299 6:36888048-36888070 TATTAGGTATTTAATTTGTCTGG + Intronic
1007055636 6:38881412-38881434 TGAAAGTAATTCAATTTGAATGG + Intronic
1008660000 6:53657711-53657733 TGAAGGGTTTTCAATTTGATGGG + Intronic
1009637052 6:66280154-66280176 TTAAAGGTATTCAGTTTTAAAGG + Intergenic
1011280701 6:85674422-85674444 TAAAAAGTATACAATTTGATGGG - Intergenic
1011556799 6:88577986-88578008 TAAAAGGTGTTCAACATCACTGG - Intergenic
1012152018 6:95765868-95765890 TCAAAGTTATGCAACTTGACAGG - Intergenic
1012373580 6:98534495-98534517 TAAAAGTTATTGAATTGGGCTGG - Intergenic
1013629951 6:111976766-111976788 TAGGATGTATTCATTTTGACTGG - Intergenic
1013805629 6:113992995-113993017 TAAAAGGAATTGCATTTGTCTGG - Intronic
1014335882 6:120136013-120136035 TAAAAGTTATTAAATTTAAATGG + Intergenic
1014340611 6:120201857-120201879 TAAAAGGTATACCAATTGAAAGG + Intergenic
1014922313 6:127228082-127228104 TAAAAGATATTCAATAAGAAAGG + Intergenic
1015758423 6:136631772-136631794 TAAAAGAGATTCAATCTGAAGGG - Intronic
1015868293 6:137750201-137750223 TAAAAGCTTTTCCACTTGACAGG + Intergenic
1016179647 6:141128980-141129002 TCAAAAATATTCAAGTTGACTGG - Intergenic
1016383116 6:143505713-143505735 TCAAAGTTACTCAACTTGACAGG + Intronic
1018245374 6:161817489-161817511 TAAAAGGGAATCATTTTAACAGG - Intronic
1018296492 6:162351394-162351416 TAAAAGGTATTCAATTTGACAGG - Intronic
1018609383 6:165632738-165632760 TGAAAGGTATTGGATTCGACTGG - Intronic
1020732638 7:11902577-11902599 TAAAAGGCATTCAAATTGAATGG + Intergenic
1020738121 7:11977563-11977585 TAAAGGGAATTCAATATGAATGG + Intergenic
1021239444 7:18182239-18182261 TAAAATGTATTTTATTTGACAGG + Intronic
1021370446 7:19838711-19838733 TAAAAGGCATAGAATGTGACTGG - Intergenic
1026050310 7:66941085-66941107 TAAAAGGTAATAAATTAGCCGGG + Intronic
1026441435 7:70447882-70447904 TGAAAGGTATTTATTTTGATAGG + Intronic
1027473398 7:78600080-78600102 AAAAAGGTATCCAATTTTATTGG - Intronic
1027861759 7:83592886-83592908 TAAAAGGTATTCATTGTAGCAGG + Intronic
1028286488 7:89009431-89009453 TATAGTGTTTTCAATTTGACAGG - Intronic
1028771235 7:94624432-94624454 TAAAAGGTATATATTTTGAAAGG + Intronic
1028871539 7:95775947-95775969 TAAAAGTTATTCCTCTTGACTGG + Intronic
1029522493 7:101072406-101072428 TAGAAGGTATTCAGTCTCACCGG + Intergenic
1030740203 7:113100549-113100571 GACAAGGCATTCAGTTTGACAGG + Intergenic
1031514652 7:122687098-122687120 TAAAAAGTATTTAGTTTGAAGGG - Intronic
1031781327 7:125969813-125969835 TAAAATTTATTTAATTTTACAGG - Intergenic
1033677016 7:143552809-143552831 TAAAAAATATTGAATTTAACTGG - Intergenic
1033694819 7:143776628-143776650 TAAAAAATATTGAATTTAACTGG + Intergenic
1037158229 8:15732663-15732685 TATAAGTTATACAATTTAACGGG - Intronic
1037280893 8:17240813-17240835 TAAAAGGTTTTCAGTTTGAGTGG + Intronic
1039817293 8:41105809-41105831 TACATGGTGTTCAATTTCACTGG + Intergenic
1042967945 8:74375806-74375828 TAAAAGGTATAAAATTTTAAAGG + Intronic
1043242989 8:77959974-77959996 GAAATGGTATTCAATTTCAGAGG + Intergenic
1044739985 8:95316244-95316266 TAAAAGAAATTCAATTTCTCCGG - Intergenic
1045156469 8:99479256-99479278 TAAAAAAGATTCAATTTCACTGG - Intronic
1049482017 8:142829798-142829820 TAACAGTTATTCATTTTGAAGGG - Intergenic
1050430835 9:5560181-5560203 TAAAAGGGATGCAATTTAATTGG - Intronic
1051277786 9:15414043-15414065 TAAAAGATATAGAATTAGACTGG - Intergenic
1051423114 9:16908474-16908496 TAAAAGGCATTCAATTAGTTTGG + Intergenic
1051614765 9:18996867-18996889 TAAAAGGCATCCAATTGGAAAGG + Intronic
1051871437 9:21742160-21742182 TGAAAGGTATTCAATTTAACAGG + Intergenic
1052551767 9:29959789-29959811 TAAAAGTTATGAAATTTGAAAGG - Intergenic
1052696235 9:31882955-31882977 TCAAAGGTAGTCAAGTTGAGTGG + Intergenic
1055390567 9:75817718-75817740 TAAAGGGTATTCAAATAGAGAGG - Intergenic
1057337052 9:94164286-94164308 GAAAAGATATACAATTTGCCCGG + Intergenic
1058267710 9:102926580-102926602 TAGAAAGTGTTCAATTTGAAAGG - Intergenic
1058626399 9:106938068-106938090 TAAAATGTAATTAATTTAACAGG + Intronic
1060330747 9:122667233-122667255 TAAACTGTTTTCAATTTTACAGG - Intergenic
1062731014 9:138108946-138108968 TAAAATATATTCAGTTTGGCCGG - Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1187706789 X:22017169-22017191 TAAAAGGGAATCATTTTGAATGG - Intergenic
1187852038 X:23600597-23600619 TAAAAGGCACTCGATGTGACAGG + Intergenic
1189158877 X:38790311-38790333 TAAAAAGTATTAAAATTGTCCGG + Intergenic
1190257261 X:48772933-48772955 TATAAGGAATTAAATTTTACAGG + Intronic
1192534702 X:71917446-71917468 AAGAAGGTATTCAATCTAACAGG - Intergenic
1192972419 X:76247487-76247509 TGAAAGGTATCCAAATTGAAAGG - Intergenic
1193280007 X:79636447-79636469 TAAAAGATATTGAATAGGACAGG - Intergenic
1193528435 X:82622783-82622805 TAAAGGGTATTTAATTAGAAAGG + Intergenic
1194338391 X:92678239-92678261 TAAAGGGCATTCAAATTGAAAGG - Intergenic
1194816666 X:98449902-98449924 TAATATGGTTTCAATTTGACAGG - Intergenic
1195592453 X:106646143-106646165 TAAAAGGTATTCCATGTCAATGG - Intronic
1196206815 X:112949233-112949255 TACAAGGTATTCAGTGTGGCTGG + Intergenic
1196333821 X:114505975-114505997 TTTAATGTATACAATTTGACAGG - Intergenic
1197824923 X:130579275-130579297 GAAAAGGTACTCAACTTGATTGG + Intergenic
1199143990 X:144343901-144343923 TAAAAGGTACTCCATATGGCAGG - Intergenic
1199739553 X:150720767-150720789 TAAAAGGCATTCAAATTGGAAGG - Intronic
1200646792 Y:5795022-5795044 TAAAGGGCATTCAAATTGAAAGG - Intergenic
1201547621 Y:15183159-15183181 TAGAAGATATTGAATTTGAGAGG + Intergenic