ID: 1018297503

View in Genome Browser
Species Human (GRCh38)
Location 6:162364746-162364768
Sequence AAGGGGAATCAGGAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 884
Summary {0: 1, 1: 0, 2: 5, 3: 78, 4: 800}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018297492_1018297503 17 Left 1018297492 6:162364706-162364728 CCAGAAAATGGCTGCACAACTGA 0: 1
1: 0
2: 0
3: 6
4: 157
Right 1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG 0: 1
1: 0
2: 5
3: 78
4: 800

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018297503 Original CRISPR AAGGGGAATCAGGAAGAGGG AGG Intronic
900177708 1:1298165-1298187 AAGGTGAAGCAGGAAGTGGGTGG - Intronic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900868514 1:5285618-5285640 GAGGGCTATAAGGAAGAGGGAGG + Intergenic
901214845 1:7549423-7549445 CGGGGGAATAAGGATGAGGGAGG - Intronic
901240410 1:7689782-7689804 AAGGGGAGGCAGACAGAGGGAGG - Intronic
901244120 1:7715194-7715216 AAGGAAAATCAGGAAAAGGGGGG + Intronic
901637246 1:10676064-10676086 GAGGGGCCCCAGGAAGAGGGCGG + Intronic
902051701 1:13568204-13568226 GAGGGGAAAGAGGCAGAGGGGGG + Intergenic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902750580 1:18506802-18506824 AAGTGGAATGAGGAAGAGGGAGG - Intergenic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
903292123 1:22320878-22320900 ATGGGGAATGAGGGAGAGGAGGG + Intergenic
903394058 1:22985865-22985887 GAGGAGAATCATGTAGAGGGAGG + Intergenic
903549276 1:24146517-24146539 CAGGAGAATCAGGAAGAATGAGG + Intergenic
903549279 1:24146537-24146559 AGGGAGAATCAGGAAGAATGAGG + Intergenic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903661510 1:24981556-24981578 GAGGGGAGTTAGGAACAGGGAGG - Intergenic
904324565 1:29719943-29719965 AAGGGAAAGCAGCACGAGGGTGG - Intergenic
904818172 1:33220985-33221007 AAGGGTCAGCAGAAAGAGGGTGG + Intergenic
905011184 1:34748038-34748060 AAGGGGAATGAGGCAAAGGGAGG - Intronic
905317039 1:37089206-37089228 ACTGTTAATCAGGAAGAGGGAGG + Intergenic
905405803 1:37731642-37731664 AAGGGTGAACAGGAACAGGGAGG + Intronic
906314066 1:44775176-44775198 ATGGGGATTGAGGGAGAGGGCGG - Intergenic
907596699 1:55726927-55726949 AAGGAGAATGAGGGAGATGGAGG - Intergenic
907623109 1:56001890-56001912 AAGGGGAAACAGGGACAGTGAGG - Intergenic
908090419 1:60679718-60679740 AAGGTGAATAAGACAGAGGGAGG + Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
909887803 1:80964288-80964310 GGGGGGAATGAGAAAGAGGGAGG + Intergenic
910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG + Intergenic
910378121 1:86595440-86595462 ATGGGGTAACAGGCAGAGGGTGG - Intergenic
910663271 1:89696483-89696505 AAGGGGAAGAGAGAAGAGGGAGG + Intronic
911374670 1:97037401-97037423 AAGGGGAAAGAGCAAGCGGGAGG - Intergenic
912560102 1:110545006-110545028 AAGGGAAAAGAGGAAGAAGGGGG - Intergenic
912977900 1:114346391-114346413 GAGAGGAATCTGGAAGAAGGAGG - Intergenic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913380091 1:118201183-118201205 AAGGGTAATGGAGAAGAGGGAGG - Intergenic
913446833 1:118959131-118959153 AAGGGGAATGTGGAATAGAGTGG + Intronic
913542469 1:119835168-119835190 AAAGGGGATCAGGAAGAAAGGGG - Intergenic
914255551 1:145959385-145959407 ATGGGGAATGAGGAATGGGGAGG - Intergenic
914336968 1:146724406-146724428 AAGGGGAAACAGGAAGAATGGGG + Intergenic
914343197 1:146777186-146777208 AAGGGGACCCAGGCAGGGGGAGG - Intergenic
914713874 1:150238221-150238243 AAGGGGAAAAGAGAAGAGGGAGG + Intergenic
916150591 1:161785070-161785092 AAGGGGAATGTGGAAGTAGGAGG - Intronic
917452885 1:175161862-175161884 AAGGGTAATGAGGAAGAGGAAGG - Intronic
918069470 1:181124455-181124477 AAGGGGAAGCAGGGAAGGGGAGG - Intergenic
918069610 1:181125357-181125379 AAGGGGTATCAGGGACAGCGGGG + Intergenic
918289316 1:183091492-183091514 GAGGGGAAGGAGGAAGAGGAAGG - Intronic
919612214 1:199759421-199759443 AGGGGGCACCAGGAAGAGGAAGG + Intergenic
919763765 1:201113907-201113929 AAGGGGCACCAGGAAGGGTGAGG + Intergenic
920017387 1:202924215-202924237 AAAGGGAATTAGGAAAAGGTTGG - Intronic
920025041 1:202988142-202988164 AGGGGAAAACAGGAAGGGGGAGG - Intergenic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920199416 1:204250342-204250364 AAGGGGGATGAGGAGGAGGTAGG + Intronic
920203215 1:204273478-204273500 AAGGTGACCCAGGAAGAGAGTGG - Intronic
920794369 1:209124334-209124356 AAAGGGAATCAGGAAGAATGAGG + Intergenic
921382544 1:214539687-214539709 AAAGGCAATAAAGAAGAGGGAGG + Intronic
921944792 1:220879292-220879314 GAGGGGAATTAGGAACAAGGGGG - Intergenic
922515841 1:226207827-226207849 AAGGGGGATAGGGAATAGGGTGG - Intergenic
922722739 1:227906836-227906858 AAGGAGGATGAGGAAGAGGGAGG - Intergenic
922825851 1:228517928-228517950 AAGGGGAAGGAGGAGGAGGAGGG - Intergenic
923109552 1:230879873-230879895 AGGGGGAAGCCGGCAGAGGGAGG - Intergenic
923237293 1:232046524-232046546 AAGGGGGAGTAGGGAGAGGGTGG - Intergenic
923436943 1:233976083-233976105 AAGGCGAAGGAGGAGGAGGGAGG + Intronic
923719682 1:236456251-236456273 CAGAGGAATCAGGGAGATGGAGG - Intronic
923827401 1:237515722-237515744 AAGGGGAAGGAGAAAGAAGGAGG - Intronic
924260973 1:242231214-242231236 AAGAGGGAGGAGGAAGAGGGAGG - Intronic
924291427 1:242540612-242540634 CAGGGGAATCAGTAAAAGAGAGG + Intergenic
924852601 1:247845322-247845344 CAGTGGATCCAGGAAGAGGGAGG - Intergenic
1062815298 10:495223-495245 AAGGGGAAACAGGGAGATGCTGG + Intronic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1063901505 10:10737619-10737641 AAGGGGATTCAGGCAGAGGATGG - Intergenic
1064965436 10:21011476-21011498 GAGGGGAACCAGGAAGCAGGAGG - Intronic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1066334650 10:34463259-34463281 AAGGGGAAGGGGGAAGAGGAAGG + Intronic
1067182136 10:43996325-43996347 AAGAGGGTGCAGGAAGAGGGAGG + Intergenic
1067794339 10:49309907-49309929 AAGGGGAAACAGGAAGACAGTGG - Intronic
1067842066 10:49688879-49688901 AAGGGAGATCAGGAAGAGGGAGG - Intronic
1068161085 10:53264947-53264969 CAGGGGAATCAGTCAGAGGGAGG - Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1068515417 10:58019894-58019916 GAGGGCAATCAGGAAGATGAGGG - Intergenic
1068861531 10:61852924-61852946 ATGGGGAATGAAGAAGAGGTAGG - Intergenic
1069397928 10:68010163-68010185 AATGGGATACAGGGAGAGGGCGG - Intronic
1069556007 10:69399080-69399102 AAGGGGGACCAGGAGGAGTGGGG - Intronic
1069718477 10:70535433-70535455 AGGGGGAAGGAGGAAGCGGGGGG - Intronic
1070105958 10:73431694-73431716 AAGGGGAGACATTAAGAGGGTGG - Intronic
1070228892 10:74542605-74542627 ATGGGGAATGAGGAAGATGAGGG - Intronic
1070234742 10:74611647-74611669 AGGGGGAGGCAGGAAGTGGGTGG - Intronic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071718445 10:88120006-88120028 AGGGGGAAGCAGGAAGGAGGGGG + Intergenic
1071718513 10:88120213-88120235 AAAGGGAAGCAGGAAGGCGGGGG + Intergenic
1072276587 10:93829284-93829306 AAGGGGAAAGAGAAAGAGAGTGG - Intergenic
1072539265 10:96385807-96385829 AAGGAGAATCAGGACAAGAGTGG - Intronic
1072548429 10:96458072-96458094 GAGGGGAATAGGGAAAAGGGAGG + Intronic
1073533575 10:104254870-104254892 CAGGGGATTCAGGAAGTAGGTGG - Exonic
1073537566 10:104291566-104291588 AAGGGGAAGGAGGAAGCGCGCGG - Intronic
1073560889 10:104495944-104495966 AAGGGGACCCAGGTAGGGGGCGG + Intergenic
1073592116 10:104767599-104767621 AAGGGGAAGGGGGAAGGGGGAGG - Intronic
1073698653 10:105899373-105899395 AAGGAGAAACAGGGAGAGAGAGG + Intergenic
1074147666 10:110730830-110730852 GCAGGGAATCAGGAAGAAGGAGG + Intronic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1075517995 10:123124833-123124855 CATGGGAGTCAGGGAGAGGGAGG - Intergenic
1075654751 10:124153402-124153424 AAGGGAAATAAGAAAGGGGGAGG + Intergenic
1076442344 10:130488606-130488628 AAGGGGATTGAGGAAGAGGCAGG + Intergenic
1077909076 11:6558562-6558584 AAGGAGCCTCAGGAAAAGGGTGG - Exonic
1078547113 11:12254452-12254474 AAGGGGTCTCTGGAAGAGGGTGG + Intronic
1078654263 11:13223492-13223514 AAGGGGGAGCAGGAAAAAGGAGG - Intergenic
1078713981 11:13822001-13822023 CAGGGGAATCAGGCAGAAGAAGG - Intergenic
1079445544 11:20553568-20553590 AGGGGGAGGGAGGAAGAGGGAGG - Intergenic
1079996845 11:27304597-27304619 AACGGGAGCCAGGAAGAGGCGGG + Intergenic
1080941602 11:36924445-36924467 AAGAGGAATGAGGAAGGGGGTGG + Intergenic
1081514772 11:43816771-43816793 TCGGGGACTCAGGAAAAGGGTGG - Intronic
1082123598 11:48406459-48406481 AAGGGCAATCAGGCAGGGGAAGG + Intergenic
1083687368 11:64384636-64384658 AGGGAGAATCAGAAAGAGTGGGG - Intergenic
1083775153 11:64891026-64891048 ACGGGGAATGAGACAGAGGGAGG + Intergenic
1083814674 11:65125921-65125943 AGGGGGCCTCAGGAGGAGGGAGG + Exonic
1083855380 11:65390615-65390637 CCGGGGCAGCAGGAAGAGGGTGG - Intronic
1084742780 11:71150130-71150152 AAGGGGAAGGAGGGAGAGGGAGG + Intronic
1085034427 11:73291623-73291645 AAGGGGATTGAGGAACAGAGTGG - Intronic
1085547352 11:77332324-77332346 AAGGGGGAGAGGGAAGAGGGGGG + Intronic
1085807658 11:79651052-79651074 AAGGAGAAGAAGGAAGATGGAGG - Intergenic
1085816550 11:79743278-79743300 AAGAGGAATAAAGAAGAGAGAGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1088178625 11:107082951-107082973 ACTGGGAAACAGGAAGAGGTTGG - Intergenic
1088447167 11:109944085-109944107 AAGGGAGATGAGGGAGAGGGAGG + Intergenic
1088769194 11:113015993-113016015 AAGCGGGATCAGGATGATGGTGG + Intronic
1088813490 11:113406739-113406761 CAGGGGAAGCAGGAAGCTGGTGG - Intergenic
1088968463 11:114749864-114749886 GTGGGGAATCAGGCACAGGGTGG - Intergenic
1089067293 11:115671410-115671432 GAGGGGAAGAAGGAAGAGGATGG - Intergenic
1089160656 11:116434458-116434480 AAGGGGCATCAGGGAGCAGGTGG + Intergenic
1089538111 11:119173045-119173067 AAGGAGAAGCAGGGTGAGGGAGG + Intronic
1089595056 11:119573301-119573323 AAGGGGGATCAGGAAGCTGTGGG - Intergenic
1090878087 11:130808981-130809003 AAGGAGAATTGGGAAGAAGGTGG + Intergenic
1090879473 11:130820986-130821008 AAGAGGAATCTGGGAGATGGAGG - Intergenic
1091033412 11:132211736-132211758 GAGTGGATACAGGAAGAGGGTGG + Intronic
1091456887 12:614545-614567 AAGGGGAAGAAGACAGAGGGAGG - Intronic
1091576516 12:1741431-1741453 ATGGGGGCTTAGGAAGAGGGAGG + Intronic
1092071036 12:5631613-5631635 CAGGGGAGTCTGGAAGTGGGAGG + Intronic
1092388890 12:8057776-8057798 AAGTGGAAGGAGAAAGAGGGTGG - Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093230063 12:16533039-16533061 AAGTGGCAGGAGGAAGAGGGAGG - Intronic
1093499791 12:19798727-19798749 AAAGAGAACAAGGAAGAGGGAGG - Intergenic
1093785967 12:23192660-23192682 TAGGGGAAGGAGGAAGAGGCAGG - Intergenic
1093846687 12:23980678-23980700 GAGGGGAAAACGGAAGAGGGGGG - Intergenic
1094179615 12:27577960-27577982 ACGGGGAAGAAGGAAGAAGGAGG + Intronic
1095200009 12:39372906-39372928 AGGTGGAATAGGGAAGAGGGAGG - Intronic
1095257174 12:40052280-40052302 TAGGGGAAACAGGGAGGGGGTGG - Intronic
1095440838 12:42237878-42237900 GAAGGGAGTCAGGAAGAGGCAGG + Intronic
1095513910 12:42984846-42984868 AATGGGAATCAGGTACAGTGAGG - Intergenic
1095540125 12:43299919-43299941 AAGGGGAAGGAGGAGGAGGTGGG + Intergenic
1095946478 12:47756621-47756643 AGGGGGAAGGAGGGAGAGGGTGG + Intronic
1096121447 12:49091798-49091820 AAGATGAATCAGGCGGAGGGAGG - Intronic
1096781768 12:53995980-53996002 GAGGGGAACCAGGGAGGGGGCGG + Intronic
1097157105 12:57020509-57020531 AAGAGGAAGGAGGAATAGGGTGG - Intronic
1097242427 12:57584839-57584861 AGGGGAAAACAGGAAGAGGGAGG - Exonic
1098316528 12:69199128-69199150 AAGTGGGAGGAGGAAGAGGGAGG + Intergenic
1098393878 12:69997801-69997823 AGGGGGAAGGAGGAAGAGAGAGG - Intergenic
1098408343 12:70151516-70151538 AAGGGGAAGAAGGTACAGGGTGG - Intergenic
1098477946 12:70927258-70927280 AAGGGGAATTAGGCAGGTGGGGG + Intergenic
1099133643 12:78865338-78865360 AAGAGGAAGCAAGAAGATGGGGG - Intronic
1101725884 12:107387902-107387924 GAGGGGAAGCAGGAAGATGAGGG - Intronic
1101828934 12:108242260-108242282 AAGAGGAGTGAGGCAGAGGGAGG - Intronic
1102509442 12:113404092-113404114 AAGGGGAAGTGGAAAGAGGGAGG - Intronic
1102512470 12:113425103-113425125 AAGGGGAAACAGGCACAGAGAGG + Intronic
1103080912 12:118023395-118023417 AAGGGGGAGGAGGAGGAGGGGGG + Intronic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1104232898 12:126902585-126902607 AAAGGGAAAGAGAAAGAGGGAGG - Intergenic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1104689397 12:130813991-130814013 AGGGGGTGTCAGGAAGAGAGTGG - Intronic
1105874658 13:24541264-24541286 AAGGGGCTTCAGGAAGGTGGGGG + Intergenic
1105993970 13:25652474-25652496 AATAAGAATAAGGAAGAGGGAGG - Intronic
1106263860 13:28092320-28092342 ATGGGAAATGAGGGAGAGGGAGG - Intronic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1107421005 13:40246385-40246407 AAGAGGAATCAGGAGGAAGGAGG - Intergenic
1107526110 13:41233283-41233305 TAGAGGAAGTAGGAAGAGGGTGG + Intronic
1107529795 13:41272302-41272324 AAGGGGAAGGAGGTATAGGGTGG + Intergenic
1108177355 13:47806693-47806715 AAGGGGAAAGAGGGAGAGAGAGG + Intergenic
1108755599 13:53498261-53498283 GAGGGGAAGCAGCAATAGGGAGG + Intergenic
1109206543 13:59489082-59489104 AAGGGGAATGAGGAGAAGAGAGG - Intergenic
1109660988 13:65459919-65459941 AAGGGGAATAAGGAAAAGTTTGG + Intergenic
1110103241 13:71635718-71635740 AAGTGGGATATGGAAGAGGGGGG - Intronic
1110306332 13:73991673-73991695 AAGTGGAATCAAAAAGAGGCAGG - Intronic
1111385373 13:87520689-87520711 AATGGGTATCAGGCAGAGGTTGG + Intergenic
1111797935 13:92946863-92946885 AAGGAGGAAAAGGAAGAGGGAGG + Intergenic
1112325386 13:98440057-98440079 AAGGGGAAACAGGCAAGGGGCGG - Intronic
1113285643 13:108845487-108845509 AATGGGAAGGAGGAAGAGGCAGG + Intronic
1113308273 13:109102208-109102230 AAAGGGAAGGAGGAAGAAGGAGG + Intronic
1113843089 13:113371423-113371445 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843097 13:113371443-113371465 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843106 13:113371463-113371485 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843113 13:113371482-113371504 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843122 13:113371502-113371524 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843130 13:113371522-113371544 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843139 13:113371542-113371564 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843147 13:113371562-113371584 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843156 13:113371582-113371604 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843164 13:113371602-113371624 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843173 13:113371622-113371644 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843181 13:113371642-113371664 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843190 13:113371662-113371684 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843198 13:113371682-113371704 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843213 13:113371721-113371743 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843221 13:113371741-113371763 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843229 13:113371761-113371783 GAGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843237 13:113371780-113371802 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843258 13:113371839-113371861 AGGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113843267 13:113371859-113371881 AGGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843276 13:113371879-113371901 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113909876 13:113836721-113836743 GAGGGGAATGAGGAGGAGGAGGG + Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114521086 14:23336736-23336758 AAGGGGAAGGAGGAATAGGATGG - Intergenic
1114552116 14:23538724-23538746 AGGAGGAAGGAGGAAGAGGGTGG + Intronic
1116130752 14:40854124-40854146 TAGGGGATCCAGGAACAGGGAGG + Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117978144 14:61318585-61318607 GAAGGGAATGAGGAAGAGGACGG - Intronic
1118425749 14:65659671-65659693 AAAGGGGAAGAGGAAGAGGGTGG - Intronic
1118533905 14:66737210-66737232 AAGGGAGAACAGGAAGAGGAAGG - Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1118838635 14:69494737-69494759 AAGGGGACTTTGGAATAGGGTGG + Intronic
1119321397 14:73733218-73733240 AAGGTGAATCAGAAATAGGCTGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119598125 14:75955448-75955470 AAGGGGAGGAAGCAAGAGGGCGG - Intronic
1120925332 14:89792298-89792320 AAGGGGAATAAGGAAAAGGCAGG + Intergenic
1120943229 14:89969274-89969296 AAGGGGATGCAGGGAGAAGGAGG - Intronic
1121083066 14:91124327-91124349 AGGAGGCATCAGGAGGAGGGAGG - Intronic
1121833230 14:97069656-97069678 AGGGGGCTTCTGGAAGAGGGTGG + Intergenic
1121863369 14:97339882-97339904 TAGGGGAATCACAAAGAAGGGGG + Intergenic
1122068714 14:99191432-99191454 GTGGGGAGTCAGGAAGAGAGTGG + Intronic
1122074722 14:99228750-99228772 AAGGGGAAGGAGGAGCAGGGAGG - Intronic
1122284394 14:100642161-100642183 AAGGGGACTAGGGAGGAGGGAGG + Intergenic
1122327336 14:100890565-100890587 AAGGGGAGTAAGGGAGAGGTGGG + Intergenic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122507081 14:102238570-102238592 AGGGGTAATGAGGAGGAGGGAGG - Intronic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122949470 14:105033718-105033740 AAGGGGAAGGAGGAACAGGGTGG - Intergenic
1123111053 14:105866983-105867005 TGGGGGAGTGAGGAAGAGGGTGG + Intergenic
1124510025 15:30316011-30316033 CAGGGGCTTCATGAAGAGGGTGG - Intergenic
1124732865 15:32214542-32214564 CAGGGGCTTCATGAAGAGGGTGG + Intergenic
1125197327 15:37062221-37062243 CAAGGGCATCAGTAAGAGGGAGG - Intronic
1125279748 15:38031123-38031145 AAGGGAAAGCAGAAAGATGGAGG - Intergenic
1125600512 15:40912969-40912991 AAGGGGGAACAGGGAGAAGGAGG + Intergenic
1126047874 15:44660776-44660798 AAAGGGAAGCGGGAAGAGGAGGG - Intronic
1126397413 15:48233715-48233737 AAAAGGAATCAGGAAGAAAGAGG - Intronic
1126499823 15:49333254-49333276 AAAGGCAATCAGAAAGAGGGAGG - Intronic
1126553995 15:49965965-49965987 AAGGGCAAGCAGAAATAGGGTGG + Intronic
1127457533 15:59168628-59168650 AAGTGGAAGCAGGGAGAGTGAGG - Intronic
1127685869 15:61343155-61343177 AGGTTGAATGAGGAAGAGGGCGG - Intergenic
1128105406 15:65040651-65040673 AAGAGGAATGAGGAAGTGGAGGG + Intergenic
1128113999 15:65094252-65094274 GAGGGAGATCAGGAAGAGGTGGG - Intronic
1128240758 15:66099596-66099618 AAGGGGAAACAGGACCAGAGAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128690534 15:69721436-69721458 AAGGGGAGACAGAGAGAGGGAGG - Intergenic
1128804278 15:70519071-70519093 AAGGGGAAAAAGGCAGGGGGCGG - Intergenic
1129056076 15:72821532-72821554 AAGGGGAAACAGGAACCAGGAGG - Intergenic
1130904227 15:88228567-88228589 CAGGGGAATCAGGAAGGCTGTGG - Intronic
1130989979 15:88870358-88870380 CAGGGGAAGAAGGAAGAAGGGGG + Intronic
1131014151 15:89043506-89043528 AAGAGGAAGGAGGAAGAGGAGGG + Intergenic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131778591 15:95829231-95829253 ATGGCGGCTCAGGAAGAGGGAGG - Intergenic
1132102297 15:99032959-99032981 AAGGGAAATCAGCAAGAAAGGGG + Intergenic
1132688196 16:1171045-1171067 AAGGGTGTGCAGGAAGAGGGAGG - Intronic
1132879818 16:2157142-2157164 AGAAGGAATGAGGAAGAGGGAGG - Intronic
1132989829 16:2786941-2786963 GAGGGGAGTGAGGAGGAGGGGGG - Intronic
1133225629 16:4339044-4339066 AAGGGCAGTCCGGGAGAGGGTGG - Exonic
1133299968 16:4776439-4776461 CAGGGGAATGAGGAAGGTGGGGG + Intergenic
1133467972 16:6046291-6046313 TAGGGGGATGAGGAAAAGGGAGG + Intronic
1134238583 16:12487049-12487071 AAGGGGAAACAGGCACAGAGAGG - Intronic
1134464918 16:14467033-14467055 CAGGGGCATCAGGAAAAGCGGGG - Intronic
1134846997 16:17448688-17448710 AGGGGGGAGGAGGAAGAGGGGGG + Intronic
1134885083 16:17783674-17783696 AAGGGGGATCAGAAACAGAGTGG - Intergenic
1135127694 16:19824748-19824770 AAGATGAACCAGGAAGAGGAAGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1135821357 16:25689530-25689552 AAGGGAAATGAGGCAGAGTGAGG + Intergenic
1135959643 16:26985013-26985035 TAGGGGAAGGGGGAAGAGGGAGG - Intergenic
1135992863 16:27228482-27228504 GAGGGGAGGCTGGAAGAGGGCGG - Intronic
1137374567 16:47941623-47941645 AGGGGGAGTGAGGAGGAGGGTGG + Intergenic
1137553442 16:49455710-49455732 AGAGGGAGGCAGGAAGAGGGTGG + Intergenic
1138103499 16:54273794-54273816 AATGGGAAAGAGGAAGAGGAAGG - Intergenic
1138339863 16:56281569-56281591 AAGGGGACTGAGAAGGAGGGAGG - Intronic
1138650979 16:58461356-58461378 AAGGTGCATAAGGAAGAGGTAGG - Intergenic
1139189951 16:64850862-64850884 AGGGGGAAATAGGAAGAGGATGG + Intergenic
1139363613 16:66419271-66419293 AAGGGGAAGGAGGAATGGGGAGG + Intergenic
1139436998 16:66942076-66942098 CAGGTGGATCAGGAAGAGGCAGG - Intronic
1139712928 16:68790248-68790270 ACGGGGCATCAGGGAGAGAGAGG + Intronic
1139829863 16:69788600-69788622 TCAGGGGATCAGGAAGAGGGTGG - Intronic
1139946325 16:70644890-70644912 AAGAGGAAGGAGGAAGAGGAGGG + Intronic
1139955012 16:70688979-70689001 AAGGGGTCTCAGGAAGACTGTGG + Intronic
1139990794 16:70938141-70938163 AAGGGGACCCAGGCAGGGGGAGG + Intronic
1139997303 16:70992913-70992935 AAGGGGAAACAGGAAGAATGGGG - Intronic
1140723851 16:77794477-77794499 AAGGTAAATGAGGCAGAGGGAGG - Intronic
1141012468 16:80415740-80415762 AATGCGAATCAGGAAGGGGAGGG - Intergenic
1141270990 16:82541123-82541145 AGGGAGAGTCAGGAGGAGGGAGG + Intergenic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141608452 16:85168821-85168843 AAGGTCAATCAGGACGCGGGAGG - Intergenic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142267783 16:89072474-89072496 ATGGGGAGCCAGGGAGAGGGAGG + Intergenic
1142368548 16:89664416-89664438 GGGTGGAATGAGGAAGAGGGAGG + Intronic
1142683986 17:1566723-1566745 CAGGAGAAACAGGAAGAGAGAGG - Intergenic
1142957145 17:3529819-3529841 AAGGTCAATCAGGAAGAGTCGGG + Intronic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143629982 17:8133521-8133543 AAGGGCAGCCAGGAAGAGGCTGG - Intergenic
1143772641 17:9178457-9178479 GAGGAGAATTAGGAAGAGGAGGG - Intronic
1143846059 17:9773376-9773398 AAAGGGAAACAGGAAGGGAGAGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144560473 17:16316838-16316860 GAGGTGAGTCAGGAAGAGTGTGG - Intronic
1145826362 17:27879990-27880012 AGGGGGCAGCAGGAAGAAGGAGG - Intronic
1146265576 17:31450605-31450627 AAAGGGACCCAGGAGGAGGGCGG - Intronic
1146274028 17:31503475-31503497 AAGGGGGAAGAGGAAGAGGAGGG + Intronic
1146673877 17:34759799-34759821 GAGGGCAATGAGGAAGGGGGGGG - Intergenic
1147774956 17:42894192-42894214 AAGGGGGCTAAGGAAGAGCGAGG + Intergenic
1147995893 17:44360151-44360173 AAAGGGAGTGAGGACGAGGGAGG + Intronic
1147999054 17:44377042-44377064 GTGGGGAATCTGGAAGAGGCTGG - Exonic
1148927929 17:51104049-51104071 AATGGGAATGAGGAAGAGTTAGG + Intronic
1148984965 17:51613329-51613351 AGGGGGGATGAGGGAGAGGGGGG - Intergenic
1149568402 17:57655124-57655146 TAGGGGAATTAGGAACAGGTGGG - Intronic
1149576402 17:57716365-57716387 AAGGGGAAGCAGGAGAAGAGCGG + Intergenic
1150597634 17:66620389-66620411 AAGGGGAAGCAATAAGTGGGAGG + Intronic
1150687644 17:67333388-67333410 AAGGAGGATTGGGAAGAGGGAGG + Intergenic
1150831002 17:68519131-68519153 ACTGGGTAACAGGAAGAGGGTGG - Intronic
1151017476 17:70573312-70573334 AAGGGGAAGCAAGAACACGGAGG + Intergenic
1151964512 17:77424462-77424484 AAGGGGCTTCAGGAGGTGGGAGG + Intronic
1152203659 17:78961812-78961834 CTGGGGAATGAGGAAGAGTGGGG + Intergenic
1152211212 17:79004180-79004202 GAGGGGAGTTAGGGAGAGGGAGG + Intronic
1152211253 17:79004309-79004331 GAGGGGAGTTAGGGAGAGGGAGG + Intronic
1152211265 17:79004337-79004359 GAGGGGAGTTAGGGAGAGGGGGG + Intronic
1152211534 17:79005083-79005105 GAGGGGAGTTAGGGAGAGGGGGG + Intronic
1152228009 17:79101659-79101681 AAGGAGAGAGAGGAAGAGGGAGG + Intronic
1152353569 17:79796318-79796340 AAAGGGAATCAGGAAGAAGTGGG + Intronic
1152933491 17:83122515-83122537 CAGGGGAACCAGGTGGAGGGCGG + Intergenic
1153001853 18:463029-463051 CGGGGGAGTCAGGGAGAGGGTGG + Intronic
1153560497 18:6367724-6367746 ATGGGAAATCTGGAAGTGGGTGG - Intronic
1153606688 18:6840720-6840742 ATGGGGACTAAGGAAGTGGGTGG + Intronic
1154031558 18:10757601-10757623 ATGGGGGATGAGGAAGAGGGAGG + Intronic
1155060584 18:22224588-22224610 CAGGGGATTCAGGATCAGGGTGG + Intergenic
1155144066 18:23069081-23069103 AAGGGGAAAGAGGAAGCAGGAGG + Intergenic
1155336684 18:24772159-24772181 AAGGACAATCAGGCAGAGAGAGG + Intergenic
1155682217 18:28502229-28502251 AAGGAGACACAGGAATAGGGTGG + Intergenic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1157319987 18:46626807-46626829 AAGGAGACTGAGGAAGGGGGAGG - Intronic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159075987 18:63682776-63682798 AGGGAGAATCTGGAACAGGGAGG - Intronic
1159502255 18:69288603-69288625 AAGGGGAGACAGGAAAGGGGAGG + Intergenic
1159554750 18:69933409-69933431 AAGGGCTGGCAGGAAGAGGGAGG - Intronic
1159863393 18:73675535-73675557 AAGGAGTTTCAGGAAGAGGAGGG - Intergenic
1159960410 18:74551141-74551163 AAGGTGAAGCAGGAACAGGCAGG - Intronic
1160498942 18:79393038-79393060 AAGGTGCCTCAGGAAGAAGGGGG + Intergenic
1160505092 18:79422572-79422594 CAGGGGAGTGAGGGAGAGGGAGG + Intronic
1160741644 19:689048-689070 AGCGGGAATGAGGAAGCGGGTGG + Intronic
1160950836 19:1666515-1666537 AAGGAGAAGAAGGAAGAAGGAGG - Intergenic
1161085440 19:2332963-2332985 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085461 19:2333024-2333046 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161085499 19:2333145-2333167 GAGGGGGAGCAGGAGGAGGGTGG + Intronic
1161120015 19:2520577-2520599 AGCGGGCATCAGGAAGAGGAGGG - Intronic
1161541016 19:4851640-4851662 AAGGGGGAAGAGGAGGAGGGCGG + Intronic
1161747306 19:6068854-6068876 TAGGGGAAGAAGGAAAAGGGTGG + Intronic
1161821735 19:6534131-6534153 AAGGGGACTCCTGGAGAGGGCGG - Intronic
1162524693 19:11200608-11200630 AATGGGAATCGGGCAGATGGGGG + Intronic
1162540699 19:11294237-11294259 AAGGGAAAGCAGGAAAATGGGGG - Intergenic
1162838145 19:13335222-13335244 GAAGGGAAACAGGAAGAGGTGGG - Intronic
1162875260 19:13616693-13616715 AAGGGAGATGAGGATGAGGGAGG + Intronic
1162930026 19:13952938-13952960 AGGGAGAATCAGGAGGAAGGGGG + Intronic
1162968430 19:14166532-14166554 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163501031 19:17676363-17676385 CAGGGGATGCAGGGAGAGGGAGG - Intronic
1164502510 19:28831646-28831668 TAGGAGAATCTGGAAGGGGGAGG + Intergenic
1164741578 19:30580053-30580075 AAGGGGTGACAGGGAGAGGGAGG - Intronic
1164798401 19:31055071-31055093 CAGGGCAAGCAGGGAGAGGGAGG + Intergenic
1165213550 19:34254094-34254116 GAGGGGAAAGAGTAAGAGGGAGG - Intergenic
1166035497 19:40165264-40165286 TATGGGAGTAAGGAAGAGGGAGG - Intergenic
1166072166 19:40394057-40394079 AGTGGGGACCAGGAAGAGGGTGG - Exonic
1166257358 19:41615901-41615923 GATGGGAATGAGGAAGATGGGGG + Intronic
1166855226 19:45779938-45779960 AAGGGGAGACAGACAGAGGGTGG - Exonic
1166912692 19:46171320-46171342 AAGGGGAGTCAGCCAGAGGGAGG + Intergenic
1167013623 19:46825169-46825191 AAGGGGAAACCGGAAGATGCAGG - Intergenic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
1167666272 19:50824083-50824105 AAGCAGAAACAGGAAGACGGAGG + Intergenic
1167811873 19:51840397-51840419 AAGTGGGAGCAGGCAGAGGGTGG + Intergenic
924963423 2:55373-55395 AAGGGAAAGCAAGAAGGGGGTGG + Intergenic
925304721 2:2840006-2840028 GAGGGGGAACAGAAAGAGGGGGG + Intergenic
925306101 2:2849074-2849096 AAGGGAAGTCAGGAAGGGAGGGG + Intergenic
926266839 2:11330876-11330898 AAGAGGAATGAGGAGGAGGGAGG + Intronic
926312749 2:11686348-11686370 AGGGGGAACCAGAAAGTGGGTGG + Intronic
926803526 2:16683695-16683717 TAGGAGAATCAGGGAGAAGGGGG - Intergenic
928319286 2:30270308-30270330 AAGGGGCATCTGGCAGGGGGAGG - Intronic
928342650 2:30458521-30458543 AGGGTGATTGAGGAAGAGGGAGG + Intronic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
929034720 2:37679754-37679776 AGGAGGACTCAGGAAGAGGAAGG - Intronic
929046844 2:37798645-37798667 ATGGGGAAAAAGGCAGAGGGTGG - Intergenic
929288516 2:40163468-40163490 AGGGTGAATGAGGAAGAGGGAGG + Intronic
929351835 2:40965644-40965666 AAAGAGAATCAGGATTAGGGAGG - Intergenic
929624299 2:43390545-43390567 AAGGGGAATCAGGAATAGATAGG - Intronic
929996118 2:46827170-46827192 GTGGGGAAGCAGGCAGAGGGAGG + Intronic
930020048 2:46996203-46996225 AAGGGGGCACAGGAAGAGTGGGG + Intronic
930459476 2:51654020-51654042 TAGGGGAATGGGGAAGATGGGGG + Intergenic
930820524 2:55642065-55642087 CAGGTGGATCAGGAAGTGGGGGG - Intronic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931332300 2:61300301-61300323 AAGGAGAATGGGGAAGAGGATGG - Intronic
931340777 2:61398605-61398627 AAAGGGAAGGAGAAAGAGGGAGG + Intronic
931438199 2:62267037-62267059 TAGGGGGATCCAGAAGAGGGAGG + Intergenic
931465991 2:62487332-62487354 AACCGAAATGAGGAAGAGGGAGG - Intergenic
931827298 2:66015030-66015052 ATGGGGAGGCAGGAAGAGAGAGG + Intergenic
932110271 2:68992982-68993004 AAAGGGAATATGGAAGAGAGGGG + Intergenic
932770680 2:74499264-74499286 ACGGGGAACCAGGAGGAGAGAGG + Intronic
933509763 2:83225686-83225708 ATGGAGAATAAGGAAAAGGGTGG + Intergenic
933705835 2:85289613-85289635 AAAGGCAACCAGGAAGAGAGAGG - Intronic
933769098 2:85731938-85731960 AAGCCTAATGAGGAAGAGGGAGG - Intergenic
933792055 2:85890708-85890730 AAGGGGAATCTGGAAGAGAAGGG - Intergenic
933854363 2:86399081-86399103 AAGGGGAACAAAGTAGAGGGAGG + Intergenic
934765214 2:96876718-96876740 AAGAGGAGTCAAGAAGAGGCAGG + Intronic
934925958 2:98381877-98381899 GTGGGGAAAGAGGAAGAGGGAGG + Intronic
935379359 2:102435306-102435328 AAGTGGAAACAGAAAGAAGGTGG + Intronic
935412964 2:102785227-102785249 AAGGGGACTGAGGAGGAGTGGGG - Intronic
936291306 2:111225975-111225997 AAGGGGAACCAGTGGGAGGGAGG + Intergenic
937241441 2:120464995-120465017 GTGGGGGATCAGGGAGAGGGAGG + Intergenic
938064519 2:128273803-128273825 AAACAGAAGCAGGAAGAGGGCGG + Intronic
938079707 2:128363176-128363198 CAGGGGACTCAGGAAGGGGGTGG + Intergenic
939254433 2:139724122-139724144 AAGGGAAAGGAGGAATAGGGTGG - Intergenic
939460177 2:142488754-142488776 CAGGGAACTCATGAAGAGGGTGG - Intergenic
939661396 2:144895091-144895113 AAAGGTGATCAGGAAGAGAGAGG - Intergenic
940800061 2:158123444-158123466 CAGGGAAATCAGGAAGCGGGGGG - Intronic
941038212 2:160590558-160590580 AAGGGGGAAGAGGAAGGGGGAGG - Intergenic
941038216 2:160590564-160590586 AAGGGGAAGGGGGAAGAGGAAGG - Intergenic
941447881 2:165624873-165624895 AAGAGGAAACAGGCAGAGAGAGG + Intronic
942101950 2:172592323-172592345 AAGAGGAGTCAGAAAGAGAGAGG - Intronic
942438370 2:176005126-176005148 ATGGGGACTGAGGGAGAGGGAGG + Intergenic
942579247 2:177398851-177398873 AAAGGGAATTAGGAAGAATGTGG + Intronic
942983158 2:182106441-182106463 AAGGGGAATTTGGTTGAGGGTGG + Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943321937 2:186455366-186455388 AAGGTGAATAAAGAAGAGGGAGG - Intergenic
943357201 2:186871115-186871137 AACGGGAATCTGGAAGGGGGAGG - Intergenic
943567968 2:189539257-189539279 ATAGAGAATCAAGAAGAGGGAGG + Intergenic
943577593 2:189649033-189649055 AAGAGGGATGAGAAAGAGGGAGG + Intergenic
944215238 2:197247989-197248011 AAGGGGAATGATGAGGAGGGAGG - Intronic
944227639 2:197364188-197364210 AAGGTGGGACAGGAAGAGGGTGG - Intergenic
944400554 2:199320781-199320803 AATGGGGAATAGGAAGAGGGAGG - Intronic
944646481 2:201785585-201785607 GAGGGGAATCAGGAACAAGAGGG + Intergenic
945163625 2:206919299-206919321 AAGGGAAAAAAGGAAGAGTGTGG + Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946327188 2:218990783-218990805 ATGGGGACCAAGGAAGAGGGTGG - Intronic
946706031 2:222459778-222459800 ATGGTGAATCAGGAAGAGCATGG - Intronic
946878829 2:224157622-224157644 CAGGGGAGTGAGGAAGAAGGTGG + Intergenic
947751654 2:232535716-232535738 AAGGGTAGGTAGGAAGAGGGAGG - Exonic
947941895 2:234064126-234064148 GAGGGGGAGAAGGAAGAGGGAGG - Intronic
947956497 2:234196603-234196625 GAGGGGAATCAGGAAGGGAAGGG + Intergenic
948541505 2:238694224-238694246 GAGGAGAAAGAGGAAGAGGGAGG + Intergenic
948682439 2:239645014-239645036 AAGGGGCACCAGGGAGAGTGGGG - Intergenic
1168940354 20:1706357-1706379 AAGGGGAGTCAGGCAGAGGGAGG - Intergenic
1168955736 20:1832978-1833000 TAGAGGAATCGGGAACAGGGCGG + Intergenic
1169016924 20:2299612-2299634 AAGGAAAATCAGGCTGAGGGAGG - Intronic
1169210868 20:3765707-3765729 AGGGGGAGGCAGGAGGAGGGAGG - Intronic
1169709654 20:8547524-8547546 ATGGGCAATGAGGAAGAGGGAGG - Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1170190624 20:13641363-13641385 AGGTGGGAACAGGAAGAGGGAGG - Intergenic
1170348507 20:15414637-15414659 AAGGATAACCAGGAAGAGGCTGG - Intronic
1170711986 20:18799472-18799494 AAGAGAGTTCAGGAAGAGGGAGG - Intergenic
1170996324 20:21363213-21363235 AAGGGAAATAAGGAAGAAAGTGG - Intronic
1171474522 20:25397836-25397858 AAGGGGAAGGGGGAAGGGGGAGG + Intergenic
1172013909 20:31861881-31861903 AAGAGGGGTCAGGGAGAGGGAGG - Intronic
1172014210 20:31863347-31863369 AAGGGGAAGGAGGGAGAGGGTGG + Intronic
1172627563 20:36356879-36356901 GTGGGGAATGAGGTAGAGGGAGG - Intronic
1173064388 20:39696245-39696267 AAGGGGAAAGAGAGAGAGGGAGG + Intergenic
1173112287 20:40203229-40203251 GAGGGGAAGAAGGAAGAGGAGGG + Intergenic
1173733193 20:45342480-45342502 AAGGGGAGGCAGGGAGAGGCTGG - Intronic
1174104919 20:48155287-48155309 CAGGGAAAACAAGAAGAGGGGGG - Intergenic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174216620 20:48921238-48921260 AAGGGGCGTCAGGAGGAAGGAGG - Intergenic
1174719416 20:52796135-52796157 AAGGGGCATCTGGAATGGGGGGG - Intergenic
1174842697 20:53915261-53915283 AAGGAGAATAAGAGAGAGGGAGG + Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175996073 20:62812891-62812913 ACGGGGACCCAGGAAGTGGGCGG + Exonic
1175996519 20:62814492-62814514 TAGGGGAACCGGGAAGCGGGGGG - Intergenic
1176347501 21:5763357-5763379 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176354315 21:5883941-5883963 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176497326 21:7561098-7561120 AAGGGGAATCAGCAAGGAGATGG + Intergenic
1176541822 21:8161427-8161449 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1176560773 21:8344472-8344494 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1177369797 21:20187409-20187431 AAGAAGAATCTGGAAAAGGGTGG - Intergenic
1178083484 21:29089915-29089937 AAGGAGAATAAGAAAGAAGGAGG + Intronic
1179149102 21:38795209-38795231 GAGGAGAATGAGGAAGGGGGTGG + Intergenic
1180031674 21:45213548-45213570 AATGGGGATCGGGGAGAGGGAGG - Intronic
1181236031 22:21448172-21448194 CAGGGGAACCATGAGGAGGGTGG + Exonic
1181456662 22:23063799-23063821 AAGGGGAAGCAGGCCCAGGGTGG + Intronic
1181459371 22:23077262-23077284 CATGGGACTCAGGAAGACGGAGG - Intronic
1183138485 22:35913848-35913870 AAGGGGAATGAGGAAGGGGTGGG + Intronic
1183285619 22:36960890-36960912 AAGTGGAATGAGAATGAGGGTGG - Intergenic
1183519915 22:38291020-38291042 AGGTGGAACCAGGGAGAGGGGGG + Exonic
1183538683 22:38417451-38417473 ATGGGGCAGCAGGAATAGGGGGG - Intergenic
1183624277 22:38992160-38992182 ATGGGGCACCAGGCAGAGGGAGG - Intronic
1184050092 22:41997945-41997967 AGGTGGAGACAGGAAGAGGGTGG - Exonic
1185015279 22:48339236-48339258 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1185075037 22:48678427-48678449 CAGAGGAACCAGGAAGAGGTCGG + Intronic
1185271173 22:49929813-49929835 AAGGGGAACTTGGAAGGGGGAGG + Intergenic
1185361940 22:50413673-50413695 AAGGGGAAGAAGGAAGAGGAGGG - Intronic
1203246762 22_KI270733v1_random:77846-77868 AAGGGGAATCAGCAAGGAGATGG - Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
949329740 3:2908475-2908497 AAGCAGAATAAGGAAGAAGGAGG + Intronic
949455607 3:4235217-4235239 AAGGGGGATAAGGGAGAGGAAGG + Intronic
949495562 3:4628453-4628475 AAGGTGAAACAGGATGAGAGAGG - Intronic
949597725 3:5565507-5565529 AAGAGGAATCAGGGGGAGGGTGG - Intergenic
949721921 3:6999453-6999475 AATGGGAAACAGGCAGAGGTTGG - Intronic
949854019 3:8443534-8443556 AAGGTGGAGCAGGAAGAGGCAGG + Intergenic
950167799 3:10814875-10814897 GAGGGGAAACGGGAAGATGGTGG + Intergenic
950921163 3:16696086-16696108 AAGAGGAAGGAGGAACAGGGTGG + Intergenic
951158517 3:19385460-19385482 AAGGGCAATCAGGTAGATTGAGG - Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952746960 3:36790695-36790717 ATGGGGGCTAAGGAAGAGGGAGG - Intergenic
953888595 3:46734170-46734192 AAGGGGAAGCTGGTAGAGGTAGG - Exonic
954411738 3:50374059-50374081 AAGGGGAGGAAGGGAGAGGGAGG + Intronic
954413899 3:50383622-50383644 AAGGGGGATGTGGAAGAGGGTGG - Intronic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
954815997 3:53280988-53281010 CACTGGAATCTGGAAGAGGGTGG + Intergenic
954870389 3:53763388-53763410 AAGGGGAGCCAGGCAGAAGGAGG - Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
956047162 3:65208286-65208308 AAGGGATTTTAGGAAGAGGGAGG - Intergenic
956485596 3:69718949-69718971 AACTGGGATCAGGAAGAGGGGGG + Intergenic
956576364 3:70757023-70757045 CAGGGGAGTCAGGGAGAGAGAGG - Intergenic
957066708 3:75528777-75528799 ACTGGGAAACAGGAAGAGGTTGG - Intergenic
957334053 3:78803801-78803823 AAAGGGGATAAGGAAGAAGGAGG + Intronic
958085753 3:88804206-88804228 AATGAGAATCAGGCAGAGGGAGG + Intergenic
958734554 3:97993712-97993734 GAGGGGAATGGGGAAGAGAGTGG - Intronic
958886194 3:99730083-99730105 AAGAGGAATCAGGAAAAGAAAGG - Intronic
959080274 3:101793560-101793582 AAGGGGAATAGAGAAGAGGTGGG - Intronic
959348251 3:105227122-105227144 CTGGGCAATCTGGAAGAGGGAGG - Intergenic
959440275 3:106365793-106365815 AAGGGGAATATGGAAGATGCTGG + Intergenic
959749807 3:109820062-109820084 AAGGGGAATAAAGAAGAAGGGGG + Intergenic
960068158 3:113397713-113397735 ATGGGGAATGAAGCAGAGGGAGG + Intronic
960555851 3:119029629-119029651 AAGGGGAATACAGAAGAGAGTGG + Intronic
960671986 3:120163166-120163188 AAGGGGACTCAGGAAGCTGTTGG + Intergenic
960967287 3:123114152-123114174 CAGGCGAAACAGGAAGAGAGAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961312692 3:126013822-126013844 TAGGGGAAACAGGACGAGCGGGG + Intronic
961611888 3:128146045-128146067 AAGGGGGATCAGGAGTAGGGAGG + Intronic
962145225 3:132833455-132833477 TAGGGGAATAAGGCAGAGGGTGG - Intergenic
963112540 3:141699259-141699281 AGGGGTAATGAGGAGGAGGGAGG + Intergenic
963272683 3:143301379-143301401 CAGAGAAATCAGCAAGAGGGCGG + Intronic
963957768 3:151274385-151274407 AAGTGAAAAAAGGAAGAGGGAGG - Intronic
964067099 3:152593442-152593464 AAGGGGGAGAAGGAAGAGGGAGG + Intergenic
964075266 3:152684865-152684887 GAGGGGACTGAGGAAGTGGGGGG + Intergenic
964274559 3:154995802-154995824 ACGGGGTAACAGGAAGAGGCTGG - Intergenic
965047104 3:163593331-163593353 AAGAGTAATAAGGAAGATGGGGG + Intergenic
965059841 3:163771801-163771823 AAGAGGAAGAAGGGAGAGGGGGG - Intergenic
965727676 3:171736316-171736338 AAGAGGAAACAGGAACAGAGAGG + Intronic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966339494 3:178909506-178909528 AAAGGGAAAGAGGAAGAGAGAGG + Intergenic
966413456 3:179666233-179666255 AAGTGGAATGAGGAATAGGTGGG + Intronic
966877548 3:184331812-184331834 AAGAGGAACCAGGGAGATGGAGG + Intronic
967180421 3:186898306-186898328 AAGCGGGATCTGAAAGAGGGTGG + Intergenic
967517905 3:190392267-190392289 AGGGGGAATAAAGAAGAGGAAGG - Intronic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
968288170 3:197520160-197520182 GAGGGGAAGCAGGGAGAGGGAGG + Intronic
968603858 4:1522371-1522393 AAGGGGCATGAGGGTGAGGGGGG - Intergenic
968614907 4:1573392-1573414 GAGAGAAACCAGGAAGAGGGAGG - Intergenic
968658291 4:1787934-1787956 AAGGGGCATCCTGAAGAGGGCGG + Intergenic
968744438 4:2352393-2352415 AAGGGGAGATAGGAGGAGGGAGG + Intronic
968827051 4:2906310-2906332 AAGGGGAGACAGGAAGAAGGGGG - Intronic
968897777 4:3414686-3414708 AAGGGGAAGTAGGAAAAAGGAGG + Intronic
968956956 4:3724302-3724324 TGGGGGGATGAGGAAGAGGGAGG + Intergenic
969345086 4:6564918-6564940 AAGGCCAAGAAGGAAGAGGGAGG - Intergenic
969504277 4:7574555-7574577 AGGGGGAAGGAGGAAGAGAGGGG + Intronic
969551277 4:7869230-7869252 AAGGGGAAGGAGGAAGGGGAAGG + Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969673696 4:8603374-8603396 AAGGGGGCTGGGGAAGAGGGAGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970228576 4:13885393-13885415 AAGGGGTGTGAGGCAGAGGGAGG - Intergenic
971354980 4:25887074-25887096 AAGGGAACTGAGGCAGAGGGAGG - Intronic
971763698 4:30802705-30802727 GAGGGGAATGAGGATAAGGGTGG + Intronic
972078528 4:35118026-35118048 AAAGGGATTTAGGAAGAGGATGG + Intergenic
972647529 4:40983156-40983178 CAGGGAAATGAGGAACAGGGAGG + Intronic
973136644 4:46716356-46716378 AAGGGGAAGCAGGAACATGATGG + Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
974921312 4:68243428-68243450 AAGAGGTATAAGGAAGAGGTAGG - Intronic
975311905 4:72912901-72912923 AAGGGGTAACAGGCAGAGGTTGG + Intergenic
975467507 4:74724975-74724997 AAGGGGAAAAAGGAAGGGGTTGG - Intergenic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
975955388 4:79831051-79831073 ATGGAAAATTAGGAAGAGGGAGG + Intergenic
975959253 4:79880848-79880870 AAAAGGATTCAGGAAGAGTGTGG + Intergenic
976039543 4:80866447-80866469 AAGGAGAATCATGAAGAAAGAGG + Intronic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976608142 4:87001828-87001850 AAGCAGACACAGGAAGAGGGAGG - Intronic
977270274 4:94909651-94909673 ATGTAAAATCAGGAAGAGGGAGG - Intronic
977790082 4:101089262-101089284 AAGAGGCATCAGGAAGAGAAGGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978979335 4:114922614-114922636 AAGGGGCATAAGGCAGAGTGTGG - Intronic
979126993 4:116985819-116985841 AAGGATAACCAGGTAGAGGGAGG + Intergenic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
979833498 4:125330898-125330920 AAGGGGAATCAGGAAAAAAGAGG - Intronic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981091640 4:140738468-140738490 AAGGGGAAAGAGCAAGAAGGAGG - Intronic
982043682 4:151420426-151420448 ATGGGGAAAAAGGAAGAGGTAGG - Intronic
982136912 4:152280983-152281005 AAGGGACAGCAGGCAGAGGGTGG - Intergenic
982159347 4:152552311-152552333 AAGGGGAACCAAGAAGAAAGTGG - Intergenic
982943075 4:161583257-161583279 ACAGGGAAACAGGAAGAGGGAGG - Intronic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
983759211 4:171384744-171384766 AAGGTGAAGGAGGAGGAGGGGGG - Intergenic
984852844 4:184168899-184168921 TGGGGGAATGAGGAAGCGGGGGG - Intronic
985155671 4:186984842-186984864 GAGGTGAAACAGGACGAGGGAGG - Intergenic
985292912 4:188404876-188404898 TAGGGGCATGAGGAAGAGTGTGG - Intergenic
986248698 5:6034759-6034781 AAGAGGCATCAGGAAGGGGCTGG - Intergenic
986774876 5:11005244-11005266 AAGGGGAAGCAAGAACAGCGTGG + Intronic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
988544916 5:32146445-32146467 AAAGGGAATCAGGCAGATGGAGG - Intronic
988690418 5:33566504-33566526 ATGGGGAATGAAGAAGAGAGAGG - Intronic
988839179 5:35066562-35066584 AAGGGGAAATAAGAAGAGGAAGG - Intronic
989446501 5:41535913-41535935 AAGGGCAATCAGGCAGTGGAAGG - Intergenic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989723583 5:44559568-44559590 TTGGGGACTCAGGGAGAGGGTGG + Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990895439 5:60695328-60695350 AAGCGGAAGCAGGCAGAAGGAGG + Intronic
991195778 5:63930422-63930444 AAGGAAAATGAGGCAGAGGGTGG + Intergenic
991611945 5:68458549-68458571 AAGAGGCAGCAGGAAGAAGGAGG + Intergenic
992523053 5:77576302-77576324 AAGGGGTGTCAGGTTGAGGGGGG - Intronic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993098516 5:83508097-83508119 AAGGGGAATGAGGCAGAGCAGGG - Intronic
993340378 5:86718256-86718278 AGGAGGAATGGGGAAGAGGGAGG - Intergenic
994413800 5:99442566-99442588 AAGGGTCATCAGGAAGATGATGG - Intergenic
995119806 5:108523513-108523535 AAGGGGAACCAAAAAGAGTGAGG - Intergenic
995235530 5:109825704-109825726 AGAGGGAAACAGGAAGAGAGGGG - Intronic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997862282 5:137428768-137428790 TGGAGGAATTAGGAAGAGGGAGG - Intronic
998394726 5:141811462-141811484 AAGGGGAATGAGGAAGGAGATGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999705299 5:154267308-154267330 AAGTGGTAGCAGGTAGAGGGTGG + Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
999955703 5:156699222-156699244 AATGGGAATCAGGTATAGAGTGG + Intronic
1000022621 5:157331608-157331630 ATGGAGAATCATTAAGAGGGGGG + Intronic
1000185105 5:158851482-158851504 AAGGGGAGGAAAGAAGAGGGGGG + Intronic
1000371660 5:160542360-160542382 AAGGGGATTAAGGAAGAGAAAGG - Intergenic
1000953998 5:167520753-167520775 ATGAGGAAGCAGGAATAGGGAGG - Intronic
1001468482 5:171990142-171990164 AAGGGGAAAGAGGAAGAGAAGGG + Intronic
1001920223 5:175594078-175594100 AAGGGGTGGCTGGAAGAGGGTGG - Intergenic
1002107678 5:176888206-176888228 AAGGGCACTTAGGCAGAGGGAGG - Intronic
1002316919 5:178349571-178349593 AAGGTGAGGCAGGAAGCGGGAGG - Intronic
1002569308 5:180130980-180131002 GAGGGGCATGAGGGAGAGGGCGG - Intronic
1003013065 6:2444599-2444621 AAGGGGCATCAAGAAGGAGGAGG + Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003765965 6:9236817-9236839 AAGGGGAAATGGGAAGAGGTAGG - Intergenic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1004028615 6:11843815-11843837 GAGGGGAATCAGGGTGAGTGGGG + Intergenic
1004058047 6:12161167-12161189 AAGGGGAATGAGGCAGGTGGAGG - Intronic
1004135725 6:12964439-12964461 AATGGGGAACAGAAAGAGGGAGG + Intronic
1004442196 6:15664068-15664090 ATGGGGAATGAGGAAAAGAGGGG - Intergenic
1004542285 6:16562409-16562431 AAGGGGAATGGGGAAGGGGAAGG + Intronic
1004588257 6:17024319-17024341 GAGAGGAAGCAAGAAGAGGGAGG - Intergenic
1005327652 6:24719110-24719132 AAAGGGATTAAGGAACAGGGAGG + Exonic
1005821519 6:29603465-29603487 CAGGGGACTCAGGAAGCAGGGGG - Exonic
1005828993 6:29655573-29655595 ATGGGAGATCAGGATGAGGGTGG - Intergenic
1006148518 6:31973216-31973238 GAGGAGAGTGAGGAAGAGGGAGG + Intronic
1006188166 6:32192038-32192060 AAGGGGAGTCTGGAGGAGGTGGG + Intronic
1006387485 6:33739413-33739435 AAGGGGCAGAAGGAGGAGGGAGG + Intronic
1007177833 6:39908859-39908881 AAGGGGGATCATGAACAGTGGGG + Intronic
1007485706 6:42179207-42179229 AAAGGGAATCAGGGGGAGGAGGG - Intronic
1007593198 6:43035899-43035921 AAGGGGGATGAGGAAGAGTCAGG - Intergenic
1007694521 6:43723920-43723942 AAGGCTAATGAGGAAGAGGCTGG + Intergenic
1007926039 6:45650594-45650616 AGGGAGAGTCAGGGAGAGGGAGG + Intronic
1008475520 6:51931843-51931865 AAGGAGAATAAAGGAGAGGGAGG + Intronic
1009901394 6:69811794-69811816 AAGGAGAATTAGGAAAACGGAGG + Intergenic
1009979292 6:70708107-70708129 GAGAGGAAACAGGAAGAGGGAGG - Intronic
1010510213 6:76709000-76709022 AATGGGAACCAGGCAGAGGAAGG + Intergenic
1010524413 6:76882759-76882781 AAGGGAAAGGTGGAAGAGGGAGG - Intergenic
1011484746 6:87829964-87829986 AAGGAGAAGGAGGAAGAAGGAGG - Intergenic
1011721230 6:90158536-90158558 AAGGGACATCAGGAAGAGCGTGG + Intronic
1011765729 6:90617479-90617501 AAGAGGAATAGGGAAGAGGAAGG - Intergenic
1011845274 6:91555307-91555329 AAGAGGAATCAAGAAGAGACTGG + Intergenic
1012528375 6:100204629-100204651 AAAGGGAATAAGAAAGAGAGGGG + Intergenic
1012648159 6:101716023-101716045 AAGGGGAAGCAGGTAGAAGGTGG - Intronic
1013308605 6:108872734-108872756 AAGGGTTTTCAGCAAGAGGGTGG - Intronic
1013600284 6:111697904-111697926 AGGGTGAATGAGGAAGAAGGAGG + Intronic
1014480161 6:121926473-121926495 AAGGGGAATTTGGAACAGGTTGG + Intergenic
1014785650 6:125615711-125615733 AAGAGGGAACAGGAAGATGGTGG - Intergenic
1015241074 6:131024214-131024236 AAGAGAAAGCAGGCAGAGGGAGG + Intronic
1015379652 6:132551728-132551750 AGGGGGAATCTGGCAGTGGGTGG + Intergenic
1015437670 6:133208391-133208413 CAGGGGAAACAGGGAGAGAGGGG - Intergenic
1015561981 6:134525743-134525765 ATGGCCAATCAGCAAGAGGGTGG + Intergenic
1015647044 6:135403795-135403817 AAGGGGAAGGAAGACGAGGGGGG - Intronic
1015937883 6:138420769-138420791 AAGAGGAAGCAGGACGAGGCAGG - Exonic
1016058442 6:139603104-139603126 AAGGGGAAGCAGGGAGAAAGAGG + Intergenic
1016363818 6:143294750-143294772 AGAGTGTATCAGGAAGAGGGGGG - Intronic
1016443078 6:144104668-144104690 AAGGGTAATCAATAAAAGGGTGG - Intergenic
1016561143 6:145396284-145396306 AAAGGGAATGAGGGAGAGGAAGG - Intergenic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1017764024 6:157592690-157592712 AGGGGGAAGGAGGAAAAGGGCGG + Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1019396314 7:821110-821132 AAGGGGTATGTGGAAGAGAGTGG + Intronic
1020786027 7:12573379-12573401 AAGGGGAAACAGGAAGAAGTTGG + Intronic
1022099651 7:27161562-27161584 AAGGGGAACCAGGGCGCGGGTGG - Intergenic
1022343131 7:29486981-29487003 AAGGGGGAAGAGGAAGAGAGAGG - Intronic
1022491479 7:30823454-30823476 AAGGGAAAGAAGGAAGAAGGTGG - Intronic
1022650250 7:32267450-32267472 AAGTGGAGTCAGGTAGAAGGGGG + Intronic
1022693574 7:32682445-32682467 AATGGGTAACAGGCAGAGGGTGG + Intergenic
1022699695 7:32747669-32747691 AGGGGAGATAAGGAAGAGGGGGG + Intergenic
1022935647 7:35173379-35173401 AGGGGAGATAAGGAAGAGGGGGG + Intergenic
1023150312 7:37195764-37195786 AATGGAGACCAGGAAGAGGGAGG - Intronic
1023173514 7:37413208-37413230 AAGGGGAAGGGAGAAGAGGGAGG - Intronic
1023316469 7:38942886-38942908 GAGGGGACCCAGGAAGATGGAGG + Intergenic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1025818604 7:64942979-64943001 CAGGGGAATGAGGAGGAGCGGGG + Intergenic
1025922658 7:65927940-65927962 AAGGGGAGGCAGGAAGGAGGAGG + Intronic
1026130548 7:67617086-67617108 AAGGGGCATAAGGGACAGGGAGG - Intergenic
1026488767 7:70845415-70845437 AAGGGAAATCAGAAAGAGAAAGG + Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026741208 7:72979815-72979837 AAGGGGCATGAGGCAGAGTGAGG - Intergenic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026801047 7:73400162-73400184 AAGGGGCATGAGGCAGAGTGAGG - Intergenic
1027102526 7:75385263-75385285 AAGGGGCATGAGGCAGAGTGAGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027171790 7:75878084-75878106 AAGAGGAAACAGGACTAGGGAGG - Intronic
1027533259 7:79362769-79362791 GAGGGGAATTAGGAATAGAGGGG + Intronic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1028557191 7:92136747-92136769 ATGGGGACTCAGGGAAAGGGTGG + Intronic
1028562929 7:92195299-92195321 ATGGGAAATAAGGAAGAGGTAGG - Intergenic
1028715061 7:93956234-93956256 AAAGGGAAGCTGGAAGAGGAAGG + Intergenic
1028903613 7:96128571-96128593 ACGGGGGATCAGGAGGAAGGTGG + Intronic
1028914546 7:96243839-96243861 AAAGGGGATGAGGATGAGGGAGG + Intronic
1029288573 7:99484167-99484189 GAGTGGAATCAGGAAGAGGAAGG + Intronic
1029611051 7:101626752-101626774 CTGGGGAATGAGGAAGAGGAGGG - Intronic
1029831601 7:103266113-103266135 AGGGGAGATAAGGAAGAGGGGGG + Intergenic
1030136445 7:106255844-106255866 AAAGGGAAACAGGTAGATGGAGG + Intronic
1030154977 7:106445566-106445588 AAGGGGAATAGAGAAGTGGGAGG - Intergenic
1030462406 7:109855907-109855929 AAGAGGAAGAAGGAAGAAGGAGG + Intergenic
1030685702 7:112485040-112485062 AGGGGGCATTAGGAAGAGGTTGG + Intronic
1031372698 7:120987131-120987153 AATGGGAATTGGGAAGAAGGTGG - Intergenic
1031431509 7:121676411-121676433 AAGAGGAATCAGGAGCAGGCAGG + Intergenic
1031434770 7:121719707-121719729 AAGGGGGAGGAAGAAGAGGGAGG - Intergenic
1031597968 7:123669565-123669587 AAGGTCACTCAGGAAGAGTGTGG + Intergenic
1031854625 7:126907283-126907305 AAAGGGGAGGAGGAAGAGGGAGG + Intronic
1032748018 7:134807574-134807596 ATGGGGGAGCATGAAGAGGGTGG + Intronic
1032824816 7:135558449-135558471 AAAGGTGGTCAGGAAGAGGGTGG + Intronic
1033128615 7:138726377-138726399 AAGGGGAAACAGAACGTGGGGGG + Intronic
1033143980 7:138855114-138855136 AGGGGGAATCAGGAAAAGCCTGG + Intronic
1033415627 7:141158957-141158979 AAGGGAAATGAGGAAGAGGTTGG + Intronic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033961549 7:146919714-146919736 AAGGAGGATCAGGCAGTGGGCGG + Intronic
1034198708 7:149267177-149267199 AAGGGGAATGAAGTAGAGGTGGG + Exonic
1034250477 7:149686594-149686616 AAGGTGAAACAGAGAGAGGGAGG + Intergenic
1034572751 7:151970188-151970210 AAGGGAAAGCAGGAAGGGGCGGG + Intronic
1034606825 7:152323816-152323838 AAGGGGATTAAGGAAGAGTGGGG + Intronic
1034643747 7:152625924-152625946 ATGGGGAAGCAGGAACAAGGGGG + Intergenic
1034748182 7:153542747-153542769 AAGGGGAAACAGGGAGATGATGG + Intergenic
1034935333 7:155196107-155196129 AATAGGAAGCAGGAAGATGGTGG - Intergenic
1035479067 7:159167560-159167582 CAGGGGAAGGAGGGAGAGGGTGG - Intergenic
1035785932 8:2261140-2261162 AAGGGCAATCAAGATGAGAGAGG - Intergenic
1035806875 8:2460576-2460598 AAGGGCAATCAAGATGAGAGAGG + Intergenic
1035826881 8:2654199-2654221 AAGGGGATTGAGGGAGGGGGTGG - Intergenic
1037753410 8:21696928-21696950 AAGGGGACAGAGGAAGGGGGAGG + Intronic
1038251667 8:25910808-25910830 AAGTGGGAGGAGGAAGAGGGAGG + Intronic
1038438957 8:27558525-27558547 AAGGAGACTCAGGGAGAAGGTGG - Intergenic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039099002 8:33920849-33920871 AAGTGGAAACAGAGAGAGGGAGG + Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039413236 8:37373205-37373227 AAGGGGAAGCAGGCACAAGGCGG + Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039567784 8:38563854-38563876 AAGGGGAATGGGGAGGAGGAGGG - Intergenic
1040079788 8:43274964-43274986 AAGGGGGAGGAGGAAGAGGGAGG - Intergenic
1040499280 8:47992827-47992849 AGGGGTAATGAGGAGGAGGGAGG + Intergenic
1040609825 8:48973073-48973095 ATGGGGAATGAGGGGGAGGGAGG - Intergenic
1041465083 8:58150510-58150532 AAATGGAATGAGGAAGAGGCCGG - Intronic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1042064918 8:64864196-64864218 AAGGGAAGGAAGGAAGAGGGAGG + Intergenic
1042105066 8:65317396-65317418 AAGGGGAAGCAGGTACAGGCAGG + Intergenic
1042728444 8:71903906-71903928 AATGGGAAACAGGCAGAGGTTGG - Intronic
1043645581 8:82514140-82514162 AAGGGGATTCAGGAACAAAGAGG - Intergenic
1044958527 8:97506352-97506374 AAGGGTGACCAGGAAGATGGAGG + Intergenic
1045192916 8:99900909-99900931 AGGGAGAATGGGGAAGAGGGAGG - Intergenic
1045508544 8:102795440-102795462 AAGGGGGGTCAGGTGGAGGGAGG + Intergenic
1045677018 8:104618458-104618480 AATTGGAATGAAGAAGAGGGAGG + Intronic
1045685117 8:104703643-104703665 GAAGGGAAGCAGGGAGAGGGAGG - Intronic
1046184482 8:110694648-110694670 AATGGGAAAGAGGGAGAGGGTGG + Intergenic
1046739678 8:117814771-117814793 AAAGGGAAAGAGGAAAAGGGAGG + Intronic
1048299076 8:133238466-133238488 AAGAGGAAACGGGAAGTGGGCGG + Exonic
1048355288 8:133648904-133648926 GTGGGGAGTCAGGAAAAGGGAGG - Intergenic
1048671380 8:136726551-136726573 GAGGGGAATGAGGAAGAGTCTGG - Intergenic
1048878166 8:138852752-138852774 GAGGAGAACCAGGGAGAGGGAGG + Intronic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049402618 8:142436333-142436355 AAAGGGGAGCAGGAGGAGGGTGG - Intergenic
1049424995 8:142534029-142534051 AGGGGGACCCAGGAAGGGGGAGG - Intronic
1049554393 8:143274897-143274919 AAGGGGCCCCAGGAAGGGGGTGG - Intronic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1050044278 9:1527138-1527160 GAGGGGAAATAAGAAGAGGGAGG + Intergenic
1050084184 9:1947342-1947364 AAGGGGAAACATGAAATGGGAGG + Intergenic
1050093325 9:2038341-2038363 AAGGGGAATCAAGAAGATATGGG - Intronic
1050116301 9:2266983-2267005 AAGAGGAATGAGGAAGAAAGAGG - Intergenic
1050268195 9:3913555-3913577 AAGGGGACTCCAGATGAGGGAGG - Intronic
1050305339 9:4300010-4300032 GAGGGGAAGGGGGAAGAGGGAGG + Intronic
1050386271 9:5094319-5094341 AAGGGGAGTCCAGAAGAGGAGGG - Intronic
1050767054 9:9147756-9147778 GAAGGGAAGCAGGGAGAGGGGGG - Intronic
1051056586 9:12994697-12994719 AAAGGAAATCAGGACGTGGGAGG - Intergenic
1051806550 9:20999508-20999530 ATGGGGACTCAGGAAGACAGTGG + Exonic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1054754453 9:68943234-68943256 CAGATGAATGAGGAAGAGGGTGG - Intronic
1054874807 9:70084583-70084605 GAAAGGAATCAGGCAGAGGGAGG - Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055881024 9:81003555-81003577 AAGAGGACTCAGCAAGAAGGTGG - Intergenic
1056578473 9:87873156-87873178 AAGGGGAAGGAGGAGGAGAGAGG + Intergenic
1056755155 9:89377013-89377035 AAGAGGAGCCAGGAGGAGGGAGG + Exonic
1056823540 9:89861001-89861023 GAGGGGGAGGAGGAAGAGGGTGG + Intergenic
1056834734 9:89945231-89945253 AAGGTGAATGGGGAAGAGGAAGG - Intergenic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1057499109 9:95582679-95582701 ATGGGGAATTAGGATGATGGTGG + Intergenic
1057554839 9:96079728-96079750 GAAGGAAAGCAGGAAGAGGGAGG + Intergenic
1058715955 9:107722187-107722209 AAGGGGAGTGAAGAGGAGGGGGG - Intergenic
1058771410 9:108236370-108236392 AGGGGGAAACAGGGAGATGGTGG + Intergenic
1059117188 9:111610175-111610197 AACGGGAGTCAGGAAGTGAGTGG + Intergenic
1059277652 9:113109350-113109372 GAGGGGGATCAGGAACAGGAAGG + Intergenic
1059278599 9:113115201-113115223 GAGGGGGATCAGGAACAGGAAGG - Intergenic
1060006583 9:120005639-120005661 AAGGGCAATCAGCAAGTTGGGGG - Intergenic
1060176169 9:121499187-121499209 AAGGGGAATCTGGGAGTGGGGGG - Intergenic
1060221769 9:121767883-121767905 TTTGGGAATGAGGAAGAGGGAGG + Intronic
1060365655 9:123010412-123010434 AAAGTGAATCAGAAAGAGAGAGG + Exonic
1060894829 9:127210935-127210957 AGGGGCACTCAGGAAGAGGAGGG + Intronic
1060900520 9:127253566-127253588 AGGGAGAGTCAGGAAGAAGGAGG + Intronic
1061039416 9:128131281-128131303 GAGGGGGAGGAGGAAGAGGGTGG - Intergenic
1061047900 9:128177211-128177233 AAGAGGAAACAGGCACAGGGTGG + Intronic
1062099936 9:134722821-134722843 AAGGAGAAAGAGGGAGAGGGAGG + Intronic
1062275164 9:135727084-135727106 AAGGGGAAAGAGGGAGAGAGAGG - Intronic
1062638411 9:137503594-137503616 AAGGAGAAGGAGGAAGAAGGAGG + Intronic
1203463096 Un_GL000220v1:60908-60930 AAGGGGAATCAGCAAGGAGATGG - Intergenic
1185499165 X:584408-584430 AAGTAGAAGCAGGAAGAGTGGGG + Intergenic
1185561579 X:1063981-1064003 AAGGGGAAAGGGGAAGAAGGGGG + Intergenic
1185717788 X:2356667-2356689 GAGGAGAAGGAGGAAGAGGGAGG - Intronic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1185989429 X:4876462-4876484 CAGTGGAAAGAGGAAGAGGGTGG + Intergenic
1186072930 X:5842254-5842276 GAGGGGAAGGAGGAAGAGGAGGG + Intronic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186890565 X:13955503-13955525 AACAGGCATCAGGAAGAGTGGGG - Intergenic
1187447668 X:19373130-19373152 CAGGGGAAGGAGGAAGAGAGAGG + Intronic
1187877216 X:23814416-23814438 AAGAGGAGTCAGGAACTGGGAGG - Intergenic
1187985400 X:24805131-24805153 AGGGGGAAACAGGAAAGGGGTGG - Intronic
1188012888 X:25076067-25076089 AAGGATAATCAGGAAGAGAATGG - Intergenic
1188058188 X:25565859-25565881 TAGGGGAATTTGGAAGTGGGGGG - Intergenic
1188639242 X:32478356-32478378 ATGGGGAATGAGGAAAAAGGTGG - Intronic
1188876855 X:35441060-35441082 AAGGGGAAGGAGAAATAGGGTGG + Intergenic
1189333227 X:40155445-40155467 GTGGGGAAGCAGGAAGGGGGTGG + Intronic
1189402356 X:40682926-40682948 AAGTGCAATCAAGAAGAGAGCGG + Exonic
1191007513 X:55726018-55726040 AGAGGGAAGCAGGAAGTGGGTGG + Intronic
1192175346 X:68881492-68881514 AAGGGTAAGCAGGGAGAGGTGGG - Intergenic
1192214175 X:69146703-69146725 CAAGGGAAGCAGGAAGCGGGAGG + Intergenic
1192452170 X:71251433-71251455 AAGGAGAGTTAGGAGGAGGGAGG - Intronic
1192576255 X:72245600-72245622 CAGGGGAAGCAGGAAGGAGGAGG + Intronic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193546609 X:82838475-82838497 AAGAGGAAGGAGGAATAGGGTGG - Intergenic
1193585609 X:83318212-83318234 AATGGGTATCAGAAAGAGGTTGG + Intergenic
1193699238 X:84742551-84742573 AGGGGTAATGAGGAGGAGGGAGG - Intergenic
1194234137 X:91361265-91361287 AGGGGGAAGGAGGAATAGGGTGG + Intergenic
1194414514 X:93593843-93593865 AAGGGGAATCAGCTAAACGGGGG + Intergenic
1194997409 X:100606272-100606294 AAGGGGGTTCAGAAAGAGAGAGG + Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195239234 X:102934765-102934787 CCAGGGACTCAGGAAGAGGGAGG - Intergenic
1195702629 X:107716529-107716551 GAGGGGACGCAGGAAGGGGGGGG - Intronic
1195923419 X:110003425-110003447 ACCGGGAATTAGGAAGCGGGAGG - Intronic
1196011563 X:110893427-110893449 AAAGAGAATCAGGCAGAGTGTGG + Intergenic
1196398684 X:115291478-115291500 AAGGAGAAGCAGGAACAAGGAGG + Intronic
1196417942 X:115492956-115492978 AAGGGGAAACAGGAATTTGGGGG - Intergenic
1196478233 X:116113424-116113446 TTGTGGAATCTGGAAGAGGGTGG + Intergenic
1196556343 X:117089032-117089054 AAGAGAAATCAGGAAGACGCTGG + Intergenic
1196747235 X:119082015-119082037 GAGTGGAATTAGGAATAGGGAGG - Intronic
1197738293 X:129869667-129869689 ACAGTGAATAAGGAAGAGGGAGG - Intergenic
1198204480 X:134452886-134452908 AAAGGAAGTCAGGAACAGGGTGG + Intergenic
1198791088 X:140347088-140347110 AAATGGAATCAGGAAGAGTTAGG - Intergenic
1199323362 X:146467820-146467842 AAGGGGACTAATGAAGAGGGAGG + Intergenic
1199770000 X:150969211-150969233 AGGGGGAATGAGGAAAAGAGAGG - Intergenic
1200414211 Y:2890864-2890886 AAGGAGGAGAAGGAAGAGGGAGG + Intronic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic