ID: 1018298701

View in Genome Browser
Species Human (GRCh38)
Location 6:162377086-162377108
Sequence CATCCTAAGAGGATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018298694_1018298701 12 Left 1018298694 6:162377051-162377073 CCAAATCATGAACGAGGACGTTC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 1018298701 6:162377086-162377108 CATCCTAAGAGGATGGTGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 313
1018298693_1018298701 13 Left 1018298693 6:162377050-162377072 CCCAAATCATGAACGAGGACGTT 0: 1
1: 0
2: 0
3: 1
4: 55
Right 1018298701 6:162377086-162377108 CATCCTAAGAGGATGGTGGAGGG 0: 1
1: 0
2: 2
3: 28
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018298701 Original CRISPR CATCCTAAGAGGATGGTGGA GGG Intronic
901372804 1:8815031-8815053 CAGACGAAGAGGATGGGGGAGGG - Intronic
902153350 1:14462700-14462722 CATCTTACCTGGATGGTGGAAGG + Intergenic
902556679 1:17250860-17250882 CTTCCTTAGAGGATAGAGGATGG + Intronic
904290795 1:29484819-29484841 CATCCAAAGAGGATGGTCCTCGG + Intergenic
907176926 1:52532715-52532737 CATCCTAGGAGGATGGTGGTAGG - Intronic
909568999 1:77086848-77086870 CTTCCTCAGGGGATGGTGGCTGG + Intergenic
909577504 1:77190972-77190994 CATCCTGAGAGGAATGGGGAAGG - Intronic
909612503 1:77567515-77567537 TATCCTGAGAGGTTGGTGGGGGG - Intronic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
911778670 1:101847123-101847145 CTTCCCACGAGGATGGGGGAAGG - Intronic
911855843 1:102873447-102873469 CATCTTACGTGGATGGTGGCAGG + Intergenic
914943815 1:152046169-152046191 CTTCCTCACAGCATGGTGGATGG - Intronic
916347726 1:163812891-163812913 CATACTAAGATGATGTTGGTTGG + Intergenic
916412493 1:164559637-164559659 CCTCTTTAGAGGATGGTGGGAGG - Exonic
917043812 1:170834577-170834599 CATCTTACGTGGATGGTGGCAGG - Intergenic
917290704 1:173469992-173470014 CATCTTACGTGGATGGTGGCAGG - Intergenic
919300399 1:195756127-195756149 CATCCTCAGAGGATAGTGACTGG + Intergenic
919518724 1:198560262-198560284 CATCGTAGGAGGGTGGTGTAAGG - Intergenic
921610543 1:217207537-217207559 CATCTTATGTGGATGGTGGCAGG - Intergenic
921899938 1:220439404-220439426 CATAGCAAGAGGGTGGTGGAGGG + Intergenic
922319986 1:224478857-224478879 CATCTTATGTGGATGGTGGCAGG + Intronic
923556973 1:235008872-235008894 CATCTTACGTGGATGGTGGCAGG + Intergenic
1063626089 10:7691443-7691465 CATCTTACGTGGATGGTGGCAGG + Intergenic
1064336033 10:14442244-14442266 CATGCTTTGAGGATGGAGGAAGG + Intronic
1065378825 10:25068555-25068577 CACCCTAGGAGGAGGGAGGAAGG + Intergenic
1066287296 10:33980756-33980778 CACCCTCAGAGCATGGTGCATGG - Intergenic
1066375818 10:34857027-34857049 CATCCTAACAGGAAAGTGAAGGG - Intergenic
1066527780 10:36300018-36300040 CATCTTATGTGGATGGTGGCAGG + Intergenic
1067165017 10:43858980-43859002 AATCCTAATAGGATGCTGAAGGG - Intergenic
1067659754 10:48225567-48225589 CATCCCAGGAGGCTGGGGGAAGG - Intronic
1067841211 10:49680765-49680787 CTTCCTGAGAGGATGGAGGTGGG + Intronic
1069791420 10:71024676-71024698 CATCCCATGTGGAAGGTGGAAGG - Intergenic
1071119964 10:82265744-82265766 TATCATCAGAGGATGGTGGTGGG + Intronic
1071151710 10:82643346-82643368 CATCTTAAATGGATGGTGGCAGG - Intronic
1071996843 10:91157759-91157781 CATGATAAGAGGATGGAGCATGG + Intergenic
1072311155 10:94156686-94156708 CCTCCCTAGAGGATGGTGGGTGG + Intronic
1074972564 10:118551123-118551145 CATCAGAAAAGGATGGGGGAGGG + Intergenic
1077425777 11:2475836-2475858 CATCTTACGTGGATGGTGGCAGG - Intronic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1077689805 11:4331762-4331784 CATCCTGAGAGGTTGGGGTAAGG + Intergenic
1078686754 11:13539085-13539107 CATCTTATGTGGATGGTGGCAGG - Intergenic
1080829639 11:35879614-35879636 CATCCAAGGAGGACGGGGGATGG - Intergenic
1080959985 11:37146795-37146817 CATCTTATGTGGATGGTGGCAGG + Intergenic
1081002686 11:37694654-37694676 CATCTTATGTGGATGGTGGCAGG - Intergenic
1081120735 11:39262604-39262626 TATCCTACGTGGATGGTGGCAGG + Intergenic
1083554940 11:63618605-63618627 GACCCTAAGAGGATGGAGGTGGG + Intergenic
1083708123 11:64530557-64530579 CCTTCTAAGAGGGAGGTGGAGGG + Intergenic
1084119535 11:67060759-67060781 GATCCTTAGAGAATGGTGGGTGG + Intronic
1085059755 11:73434268-73434290 TATCCTAAGAGGGTGGGAGAAGG + Intronic
1086314797 11:85580116-85580138 CATCCTACATGGATGGTGGCAGG - Intronic
1086412320 11:86554985-86555007 CAGCCTGAGGGGATGGGGGAGGG + Intronic
1087341948 11:96917047-96917069 CATCTTACGTGGATGGTGGCAGG - Intergenic
1087496150 11:98893319-98893341 CATCTTAAGTGGATGGCGGTAGG + Intergenic
1092652090 12:10645934-10645956 CATCTTACGTGGATGGTGGCAGG - Intronic
1092662801 12:10756557-10756579 CATCTTACGTGGATGGTGGCAGG + Intergenic
1093193697 12:16105252-16105274 CATCTTACGTGGATGGTGGCAGG + Intergenic
1094499373 12:31008644-31008666 CCTCCCAGGAGGATGGTGGAGGG - Intergenic
1094716329 12:33018355-33018377 CATCTTACGTGGATGGTGGCAGG - Intergenic
1096063452 12:48721106-48721128 CATTTTAAGTGGATGGTGGCAGG + Intergenic
1096816279 12:54203811-54203833 CATCCTGAGAAGATGAGGGACGG + Intergenic
1098743288 12:74201574-74201596 CATCCTTCGTGGATGGTGGCAGG + Intergenic
1098925373 12:76343561-76343583 CATCATAAGAGCATGTGGGATGG - Intergenic
1099609661 12:84851565-84851587 CATCTTATGTGGATGGTGGCAGG - Intergenic
1102596976 12:114000400-114000422 CATCTTACGTGGATGGTGGCAGG + Intergenic
1103890858 12:124238145-124238167 CATCCTCTGAGGGTGGAGGAAGG - Intronic
1104340258 12:127942791-127942813 AATGCGAAGAGGATGGTGGGGGG + Intergenic
1106485381 13:30167700-30167722 CATCTTATGTGGATGGTGGCAGG - Intergenic
1107670868 13:42745111-42745133 CATCCTCAGTGGCTGGTGGATGG - Intergenic
1108790828 13:53967256-53967278 CATCTTAAATGGATGGTGGTAGG - Intergenic
1109407197 13:61917926-61917948 TATCTTAAGTGGATGGTGGCAGG + Intergenic
1110146156 13:72192862-72192884 GAACCTATGAAGATGGTGGAGGG + Intergenic
1110552094 13:76821667-76821689 CGTCTTAAGTGGATGGTGGCAGG + Intergenic
1111220476 13:85198523-85198545 CATCTTACGTGGATGGTGGGAGG - Intergenic
1111325687 13:86693990-86694012 CATCTTACGTGGATGGTGGCAGG + Intergenic
1111336714 13:86835637-86835659 CATCATATGTGGATGGTGGCAGG + Intergenic
1112661091 13:101509167-101509189 CATCTTACGTGGATGGTGGCAGG + Intronic
1112874983 13:104026115-104026137 CATCTTACGTGGATGGTGGCAGG - Intergenic
1112882223 13:104122331-104122353 CATCTTACAAGGATGGTGGCAGG - Intergenic
1114673324 14:24425441-24425463 CAGCCTAACAGGAAGGAGGAAGG - Intergenic
1115710799 14:36048887-36048909 CTTCCTCACAGGATGGTGGCTGG + Intergenic
1116642608 14:47484821-47484843 CATCCTACATGGATGGTGGCAGG - Intronic
1117603864 14:57404723-57404745 CATCTTACGTGGATGGTGGCAGG + Intronic
1118125360 14:62896470-62896492 CATGGTAAGAGGAAGGTGAAAGG - Intronic
1118155444 14:63236452-63236474 CATCCTACGTGGATGGTGTTAGG + Intronic
1118475737 14:66115180-66115202 CAGCCTCAGAGGATTGTGGAGGG + Intergenic
1118811098 14:69274596-69274618 CATCTTAATAGTATGGTGGTTGG + Intronic
1119422694 14:74516975-74516997 CAGCCCTGGAGGATGGTGGAGGG + Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1122996760 14:105269285-105269307 CATCCTCTGAGGATGCTGAAGGG + Intronic
1123975456 15:25549394-25549416 CATAATAAGAGGATGGGGGTGGG + Intergenic
1124046049 15:26150737-26150759 CATCTTATGTGGATGGTGGCAGG - Intergenic
1124889568 15:33719897-33719919 CATAATAATGGGATGGTGGAAGG - Intronic
1125370181 15:38967124-38967146 CATCTTATGTGGATGGTGGTAGG + Intergenic
1126907612 15:53384634-53384656 CACTCTAAGAGGGTGGTAGAGGG + Intergenic
1127097021 15:55522466-55522488 CATCTTACGTGGATGGTGGCAGG - Intergenic
1130486009 15:84398913-84398935 CAGCCAAAGAGGCTGCTGGACGG - Intergenic
1131818747 15:96249824-96249846 CATCCTAAGATGCTGTTGGTGGG - Intergenic
1133367544 16:5222428-5222450 AAAACTAAGAGGGTGGTGGAAGG + Intergenic
1133405884 16:5524091-5524113 CATCCTGTGAGGCTGGTGGAAGG - Intergenic
1134336909 16:13308771-13308793 AACCCTAAGAGGATGGTGGTGGG - Intergenic
1137337012 16:47559638-47559660 CTTCCTAACAGCATGGTGGCTGG + Intronic
1137859107 16:51828447-51828469 CATCCTAGGAAGATGGTAGATGG + Intergenic
1138700889 16:58862194-58862216 CATCTTACGTGGATGGTGGTGGG + Intergenic
1139122888 16:64042340-64042362 CATCCTATGTGGATGGCGGCAGG + Intergenic
1139902671 16:70340647-70340669 CGTCTTCACAGGATGGTGGATGG + Intronic
1140744039 16:77965379-77965401 CATCCCAAGTGCATGGTGGCAGG - Intronic
1141058635 16:80843050-80843072 CATCCCAAGTGGCTCGTGGAGGG - Intergenic
1144440126 17:15273712-15273734 CTTGCTCAGATGATGGTGGAAGG - Intergenic
1144871078 17:18371473-18371495 CCTCCTCACAGGATGGTGGCAGG - Intergenic
1145781863 17:27568698-27568720 AATCCTATGAGGAGGGTGCAGGG - Intronic
1150498589 17:65628730-65628752 TTGCCTAAGAGGATCGTGGAGGG - Intronic
1150637285 17:66922584-66922606 CCTCCCAAGAGGTTGGGGGATGG + Intergenic
1150687207 17:67330361-67330383 CATCTTACGTGGATGGTGGCAGG - Intergenic
1151051671 17:70985251-70985273 CATCCTACGTGGATGGTGGCAGG + Intergenic
1153080107 18:1212883-1212905 CATTCTAAGAGTATGTTGGTAGG + Intergenic
1155035147 18:22019747-22019769 CATCCAAAAAGTATGCTGGATGG - Intergenic
1155810489 18:30227101-30227123 CATCTTAAGTGGATGGAGGCAGG - Intergenic
1157819610 18:50756490-50756512 CATCTTATGTGGATGGTGGCAGG - Intergenic
1158500561 18:57996996-57997018 CATCTTACGTGGATGGTGGCAGG + Intergenic
1159157202 18:64600585-64600607 CATCTTATGTGGATGGTGGCAGG + Intergenic
1159507891 18:69359806-69359828 CATCTTATGTGGATGGTGGCAGG - Intergenic
1160246740 18:77165532-77165554 CACCCTATGAGGCTGGGGGAAGG + Intergenic
1160305071 18:77725213-77725235 CATCTTATGTGGATGGTGGCAGG - Intergenic
1160421560 18:78751021-78751043 GATTCTATGAGGATGGTGTAAGG - Intergenic
1160601904 18:80020152-80020174 CATCTTACGTGGATGGTGGTGGG - Intronic
1160625611 18:80202359-80202381 CCTCCTAACAAGATGATGGAGGG + Intronic
1164457839 19:28423437-28423459 CTTCTAAAGAGCATGGTGGAGGG - Intergenic
1166360724 19:42251933-42251955 CACCCTGAGGGGCTGGTGGAAGG - Intronic
1168072090 19:53959040-53959062 CATCCAGAGAGGAGGGAGGAGGG - Intergenic
925803762 2:7628308-7628330 CATCGTAAGTGGTTGGTGGCAGG + Intergenic
926870097 2:17406967-17406989 CATCTTATGTGGATGGTGGCAGG - Intergenic
928246450 2:29632796-29632818 CATCTTATGTGGATGGTGGCAGG + Intronic
929376276 2:41290228-41290250 CATCTTACGTGGATGGTGGCAGG + Intergenic
929702001 2:44169846-44169868 CATCCGAAAAGGATGGTGCTAGG - Intronic
930254861 2:49078225-49078247 CATCTTAAATGGATGGTGGCAGG + Intronic
931645194 2:64415938-64415960 CATATTAAGAGGATGGGAGACGG - Intergenic
931749502 2:65318169-65318191 CATCTTACGCGGATGGTGGCAGG - Intronic
931785220 2:65612034-65612056 AATCCAAAAAGGGTGGTGGAAGG - Intergenic
931833678 2:66077363-66077385 GCTCCTTAGAGGGTGGTGGAAGG - Intergenic
932420992 2:71601255-71601277 CATACTAAGAGGAAGTTTGAAGG - Intronic
933750406 2:85599448-85599470 CCTCCCAAGAGGATGGGGGGTGG - Intronic
934038202 2:88106460-88106482 TATGCCAGGAGGATGGTGGACGG + Exonic
934991726 2:98926396-98926418 GCTCCCAAGAGGATGGTGGGAGG - Intronic
935243252 2:101196145-101196167 CATCTTATGTGGATGGTGGCAGG - Intronic
937677341 2:124606694-124606716 CATCTTAAGTGGATGGCGGCAGG + Intronic
937763058 2:125628484-125628506 CATCTTATGTGGATGGTGGCAGG - Intergenic
938027584 2:127963790-127963812 CATCTTACGTGGATGGTGGCAGG - Intronic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
938764373 2:134450584-134450606 CAGTCTAAGAGGAGGGTGGGGGG + Exonic
940543122 2:155046861-155046883 CATCTTATGTGGATGGTGGCAGG + Intergenic
940858429 2:158748115-158748137 CATCCAAAAAGTATGATGGAGGG - Intergenic
942982010 2:182094170-182094192 CATCTTATGTGGATGGTGGCAGG + Intronic
942992608 2:182219406-182219428 CAACCTAGGAGGATAGAGGAAGG - Intronic
943277046 2:185880776-185880798 CATCCAAAGGGGATGGTGAAAGG + Intergenic
943565482 2:189510813-189510835 CATCTTACGTGGATGGTGGCAGG - Intergenic
944252169 2:197589286-197589308 CATCTTACGTGGATGGTGGATGG - Intronic
947296552 2:228636716-228636738 CATCTTATGTGGATGGTGGCAGG + Intergenic
1172307747 20:33893428-33893450 CATCCTAAGTGGAGGCTGGAGGG + Intergenic
1173980500 20:47220272-47220294 GAGCCTAAGAGAATGGAGGAGGG + Exonic
1174259905 20:49286369-49286391 CATGCTAAAAGGATAGTGAAAGG - Intergenic
1174987773 20:55474677-55474699 CATTCTAGGAGGTTGATGGAGGG + Intergenic
1175653051 20:60745392-60745414 AATCCTAAGCAGATGGAGGAGGG - Intergenic
1178173772 21:30073676-30073698 CATCATATGAGGATGGAGCAAGG - Intergenic
1178717789 21:34982474-34982496 TATGCTAAGAGGAGAGTGGATGG - Intronic
1180218215 21:46340125-46340147 CATCTTAGGTGGATGGTGGAAGG + Intronic
1181788705 22:25246310-25246332 TTTCCAAAGAGGATAGTGGATGG + Intergenic
1181820390 22:25471011-25471033 TTTCCAAAGAGGATAGTGGATGG + Intergenic
1182653652 22:31872525-31872547 CACCCTAAGAGCATGGGGAATGG - Intronic
1182985288 22:34710538-34710560 CTTCCTCAGAGCATGGTGGCTGG - Intergenic
1183092194 22:35530117-35530139 CATGCTAAGAATATGCTGGAAGG + Intergenic
1183765850 22:39874034-39874056 CATCTTATGTGGATGGTGGCAGG + Intronic
1184397474 22:44251631-44251653 CATCTTATGTGGATGGTGGCAGG + Intronic
1184874533 22:47265310-47265332 CATCTTATGTGGATGGTGGCAGG + Intergenic
950253191 3:11484069-11484091 CAGCCTAAGAGGAAGGTGATAGG + Intronic
951774801 3:26297905-26297927 CATCCTAACAACATGGTGGCTGG - Intergenic
951942252 3:28092379-28092401 CTTCATAGGAGGATGGTTGATGG + Intergenic
952036819 3:29212724-29212746 CATCTTAAATGGATGGTGGCAGG - Intergenic
953744567 3:45564492-45564514 CCTCATAAGATGATGGTGGTTGG - Intronic
955682749 3:61519253-61519275 CATCCTATGTGGATGGCGGCAGG + Intergenic
955826446 3:62952372-62952394 CATCTTATGTGGATGGTGGCAGG - Intergenic
956128820 3:66036509-66036531 CATCCTAGCAGGATTCTGGAGGG + Intronic
956579123 3:70791005-70791027 CATCTTATGTGGATGGTGGCAGG - Intergenic
956714034 3:72062739-72062761 CATCTTACGTGGATGGTGGCTGG + Intergenic
956777253 3:72575649-72575671 CACCCTGGGAGGATGGTGGATGG - Intergenic
957398541 3:79677432-79677454 CATCGTATGTGGATGGTGGCAGG + Intronic
959273242 3:104241263-104241285 CATCTTATGTGGATGGTGGCAGG - Intergenic
959815531 3:110669787-110669809 CATCTTAAATGGATGGTGGCAGG - Intergenic
960485850 3:118252002-118252024 CTTACTAAGAGAGTGGTGGAGGG - Intergenic
960644992 3:119870167-119870189 CTTCCAGTGAGGATGGTGGAGGG - Intronic
960854787 3:122091933-122091955 CATCCCATGGGGATGGGGGAAGG + Intronic
961575183 3:127830236-127830258 CAACGTAAGAGGATGCTGAAAGG - Intergenic
961780278 3:129316807-129316829 CATCCAAAGGGGATGGCGGATGG + Intergenic
962154535 3:132931993-132932015 CATCTTAGGTGGATGGTGGCAGG - Intergenic
962182881 3:133226923-133226945 CATCTTATGTGGATGGTGGCAGG + Intronic
963510144 3:146236619-146236641 CATCTTATGTGGATGGTGGCAGG - Intronic
963513287 3:146276083-146276105 CATCTTACGTGGATGGTGGCAGG - Intergenic
967832184 3:193929037-193929059 CATCCTGAGAGGCTGCTGGGAGG + Intergenic
967911502 3:194546060-194546082 ACTCCTCAGAGGATGGGGGATGG + Intergenic
968265711 3:197361392-197361414 CATCTTATGGGGATGGTGGCAGG - Intergenic
968748240 4:2372224-2372246 CATCCTAGAAGGATGGTGGCGGG + Intronic
969144877 4:5113871-5113893 CATCTTACGTGGATGGTGGCAGG + Intronic
969225503 4:5795353-5795375 CATCAGAAGAGGATGGAGGCTGG + Intronic
969583757 4:8080328-8080350 GATCCCATGGGGATGGTGGAGGG + Intronic
970151825 4:13098070-13098092 CTTCCTAAGAGAAAGGTGCAGGG + Intergenic
970457668 4:16241019-16241041 CATCTTACGTGGATGGTGGCAGG - Intergenic
970579778 4:17464665-17464687 CATCTTAAATGGATGGTGGCGGG - Intronic
970746774 4:19307667-19307689 CATCTTATGTGGATGGTGGCAGG - Intergenic
971070105 4:23081311-23081333 CATCTTACGTGGATGGTGGCAGG - Intergenic
971141447 4:23929378-23929400 CATCCTAAGATGGTGGTTGATGG - Intergenic
972081029 4:35149862-35149884 CATCTTATGTGGATGGTGGCAGG + Intergenic
972599508 4:40559663-40559685 GGACCTTAGAGGATGGTGGAGGG - Intronic
974272377 4:59667166-59667188 TATCCTTAGAGGATGGAAGATGG - Intergenic
974324253 4:60393486-60393508 CATCTTACGTGGATGGTGGCGGG - Intergenic
974742111 4:66020936-66020958 CCTCCTCACAGGATGGTAGAAGG + Intergenic
975131409 4:70836266-70836288 CATACTCAGGGGGTGGTGGAAGG + Exonic
975300280 4:72782388-72782410 CATCTTACGTGGATGGTGGCAGG + Intergenic
975543461 4:75537487-75537509 CATCTTAAGAGGATGGTGGCAGG - Intronic
975851317 4:78575528-78575550 CATCTTACGTGGATGGTGGCAGG - Intronic
976726717 4:88222508-88222530 CATCTTATGTGGATGGTGGCAGG - Intronic
978994501 4:115132838-115132860 CATCTCACGTGGATGGTGGAAGG - Intergenic
979370399 4:119879138-119879160 CATCTTATGTGGATGGTGGCAGG - Intergenic
979810319 4:125028555-125028577 CATCCTATGTGGATGGTGGCAGG + Intergenic
980495111 4:133579260-133579282 CATCTTACGTGGATGGTGGCAGG - Intergenic
981075288 4:140585375-140585397 CATCTTAGGAGCGTGGTGGAGGG - Intergenic
981121125 4:141052013-141052035 CATCTTAAGTGGATGGTAGCAGG + Intronic
981426311 4:144607585-144607607 AATGCTAAGAGGCTGGTGCATGG - Intergenic
983431648 4:167658977-167658999 CATCTTATGTGGATGGTGGCAGG + Intergenic
984637976 4:182134372-182134394 TAAACTAAGAGGATGCTGGAAGG - Intergenic
986525339 5:8668067-8668089 CATATTCTGAGGATGGTGGAGGG - Intergenic
986649576 5:9949784-9949806 CGTCTTAAGTGGATGGTGGCAGG - Intergenic
986690681 5:10311245-10311267 CATCTTATGTGGATGGTGGCAGG + Intergenic
987265114 5:16245376-16245398 CATCCTCACAGCATGGTGGCTGG - Intergenic
987520739 5:18980083-18980105 CATCTTAAGAGTCTGGTGGGAGG - Intergenic
989354843 5:40531986-40532008 CATCTTACGAGGATGGTGGCAGG + Intergenic
989651741 5:43697752-43697774 CATCTTATGTGGATGGTGGCAGG + Intronic
990064009 5:51689764-51689786 CATCCTATGTGAATGGTGGCAGG - Intergenic
990560017 5:56974532-56974554 CATCCTAAGAACCTGGTGGAAGG - Intergenic
992871857 5:81014381-81014403 CATCTTATGTGGATGGTGGCAGG + Intronic
993873058 5:93274171-93274193 CATCTTACGTGGATGGTGGTAGG - Intergenic
994416330 5:99476543-99476565 CATCTTACGTGGATGGTGGCAGG - Intergenic
994463638 5:100098630-100098652 CATCTTACGTGGATGGTGGCAGG + Intergenic
994542938 5:101122490-101122512 CATCTTATGTGGATGGTGGCAGG + Intergenic
994801389 5:104381374-104381396 CATCTTATGTGGATGGTGGCAGG + Intergenic
995336380 5:111004552-111004574 CCTCCTAAGAGGAGGTGGGATGG - Intergenic
997678139 5:135730406-135730428 CATCCTAAGTGGGTGGCGGCAGG - Intergenic
998378939 5:141710290-141710312 CATCCTAGGAGGTTGTGGGAAGG + Intergenic
999426932 5:151496236-151496258 CATCTTAAGCGGATGGCGGTAGG - Intergenic
999964638 5:156796201-156796223 CCTCCTAAGAGGATAGCTGAGGG - Intergenic
1000328398 5:160188851-160188873 CACCCCAAGGGGATGGGGGAGGG - Intronic
1001685048 5:173587154-173587176 CATCTTACGTGGATGGTGGCAGG + Intergenic
1002390823 5:178910388-178910410 CATCCTCAGGAGATGGTGGGAGG - Intronic
1003334168 6:5154963-5154985 CGTTCTAACAGGATGGTGGATGG + Intronic
1004172156 6:13303674-13303696 CATCCTGAGAAAGTGGTGGATGG - Intronic
1004736275 6:18409502-18409524 CAACCCAAGAGGGTGGGGGAGGG - Intronic
1004902416 6:20206489-20206511 TTTCCTATGAGGATAGTGGAAGG - Intronic
1006309455 6:33247738-33247760 CATCTTAAGTGGAGGGTGGGTGG + Intergenic
1007229407 6:40337983-40338005 TATCCTCAGAGGACTGTGGATGG + Intergenic
1007737544 6:43990945-43990967 CACCATAGGAGGAGGGTGGAGGG + Intergenic
1008655997 6:53614443-53614465 CATCCTAATAACCTGGTGGATGG + Intronic
1008681315 6:53876165-53876187 CATCTTATGTGGATGGTGGCAGG + Intronic
1008765869 6:54914474-54914496 CATCCAAAGAGACTGATGGATGG - Intronic
1008950584 6:57153897-57153919 TCTCCTGAGAGGATGGTGAAAGG - Exonic
1009572348 6:65402943-65402965 CTTCCTGAGAGCATGGTGGCTGG - Intronic
1009669653 6:66730435-66730457 CATCTTAAGTGGATGGTGGCAGG - Intergenic
1010275819 6:73967323-73967345 CATCTTAAGTGGATGGCGGCAGG - Intergenic
1010511954 6:76730670-76730692 CATCTTACGTGGATGGTGGCAGG - Intergenic
1011167981 6:84471666-84471688 CATCCTACATGGATGGTGGCAGG - Intergenic
1011920679 6:92573416-92573438 CATCTTACGTGGATGGTGGCAGG - Intergenic
1012161181 6:95887826-95887848 CATCTTACGTGGATGGTGGCAGG + Intergenic
1016014340 6:139168240-139168262 TATCCTGAGAGGAAGGAGGAGGG - Intronic
1016075799 6:139794425-139794447 CATCTTATGTGGATGGTGGCAGG + Intergenic
1016139909 6:140595315-140595337 CATCTTACGTGGATGGTGGCAGG - Intergenic
1016924684 6:149331921-149331943 CATACTTAGATGATGGTGGCTGG + Intronic
1017277014 6:152581450-152581472 CATCCTAAAAGGATGATGTAGGG + Intronic
1018298701 6:162377086-162377108 CATCCTAAGAGGATGGTGGAGGG + Intronic
1018433660 6:163742846-163742868 CTTCCTAAGGGGTTGGAGGATGG + Intergenic
1019043574 6:169125722-169125744 CATCTTACGTGGATGGTGGCAGG - Intergenic
1019287315 7:230173-230195 CCTCATAAGAGGGAGGTGGAGGG + Intronic
1019906655 7:4070000-4070022 GATGCTAAGAGGACTGTGGATGG - Intronic
1020085375 7:5307561-5307583 CATCCTGAGAGGGTGGGGGCAGG + Exonic
1021654927 7:22865346-22865368 CAGCCCAGGAGGATGGTGGATGG - Intergenic
1022492742 7:30833326-30833348 CATCTTATGTGGATGGTGGCAGG + Intronic
1024381654 7:48703760-48703782 TATCCTAAGAGGTTGAGGGAAGG + Intergenic
1026228001 7:68459567-68459589 CCTCCTCTGAGGATGGAGGATGG + Intergenic
1026391830 7:69910560-69910582 CATCTTACGTGGATGGTGGCAGG + Intronic
1026481104 7:70780320-70780342 CTGCCTAAGAGGATGGTAGGCGG + Intronic
1028669067 7:93380330-93380352 CATCTGAATAGGATGTTGGAAGG - Intergenic
1028947262 7:96594360-96594382 AATCCTCAGAGGATGTGGGATGG - Intronic
1029115085 7:98232567-98232589 CAACCTCAGAGGGTGGTGGGTGG - Intronic
1029350776 7:100011372-100011394 CTTCCTCACAGGATGGTGGCTGG - Intergenic
1031645321 7:124218986-124219008 CATCTTACGTGGATGGTGGCAGG + Intergenic
1032534813 7:132653968-132653990 CTGCCTGAGAAGATGGTGGAAGG + Intronic
1032610465 7:133407284-133407306 CAAAGTAAGAGGATGGTGGATGG - Intronic
1033295626 7:140131657-140131679 AATCCTCAGAGGTTGGGGGAAGG - Intronic
1033759846 7:144426641-144426663 CATCTTACGTGGATGGTGGCAGG + Intergenic
1033998864 7:147386971-147386993 CATCTTATGTGGATGGTGGCAGG + Intronic
1035402750 7:158577819-158577841 AATCCTAAGTGGATGGAGTAAGG + Intronic
1035844632 8:2849571-2849593 CATCTTATGTGGATGGTGGCAGG - Intergenic
1038010038 8:23468277-23468299 CCTCCTAATATGATAGTGGATGG + Intergenic
1038786319 8:30619987-30620009 CAACAGAAGAGGATGGAGGAAGG + Intronic
1040999330 8:53434921-53434943 CATCCGAAGGGGATGGGAGAGGG + Intergenic
1041942567 8:63404620-63404642 CAACCTAAGAGACTCGTGGAAGG + Intergenic
1042391393 8:68239827-68239849 CATCTTATGTGGATGGTGGCAGG + Intergenic
1042428517 8:68676861-68676883 CATCTTATGTGGATGGTGGCAGG + Intronic
1043282424 8:78484785-78484807 CAGACTAAGATGATGGTGTAGGG - Intergenic
1043592331 8:81845851-81845873 CATCCTACGTGGATGGTAGTAGG + Intergenic
1045588311 8:103563841-103563863 CATCTTACGTGGATGGTGGCAGG + Intronic
1046851980 8:118984874-118984896 CATCTTACGTGGATGGTGGCAGG + Intergenic
1048327481 8:133450623-133450645 CATCACAAGAGGATGGTGAGGGG - Intergenic
1048432117 8:134380349-134380371 CATCCTAAGAGCATAGGGTAGGG + Intergenic
1050214475 9:3307081-3307103 CATCTTATGTGGATGGTGGCAGG - Intronic
1051560465 9:18435753-18435775 CATCTTACGTGGATGGTGGCAGG + Intergenic
1052267538 9:26591508-26591530 CATCATATGTGGATGGTGGCAGG + Intergenic
1055934054 9:81588717-81588739 CATGCTGAGAGGAAGGTGGTGGG + Intronic
1058111886 9:101039691-101039713 CATCTTACGTGGATGGTGGCAGG + Intronic
1061316063 9:129796501-129796523 CAACCTAGGAGGCTGGTGGCAGG + Intergenic
1061640771 9:131953177-131953199 CATCCAAACAGGATAATGGAAGG + Intronic
1061929794 9:133826639-133826661 CATCCTAGGTGGCTGGGGGAGGG - Intronic
1062091516 9:134680965-134680987 CATCCTGGGAGGATGGCAGATGG - Intronic
1187170179 X:16843470-16843492 ACTCCTAAGAGGCTGTTGGAGGG - Exonic
1188095355 X:26014547-26014569 CATCTTACGTGGATGGTGGCAGG + Intergenic
1188327341 X:28822019-28822041 CAAACTAAGTGGATGGTGGGAGG - Intronic
1188431766 X:30111639-30111661 AATACTAAGAGGAGGGTGGAAGG - Intergenic
1188614317 X:32138641-32138663 CATACTAAGTGTGTGGTGGATGG + Intronic
1188997733 X:36905735-36905757 CATCTTAGGTGGATGGTGGCAGG - Intergenic
1189242282 X:39534585-39534607 CATCTTATGTGGATGGTGGCAGG - Intergenic
1189960772 X:46323046-46323068 CATCCTACGTGGATGGTGGCAGG + Intergenic
1190952873 X:55163051-55163073 CATTCTCTGAGGAAGGTGGAGGG + Intronic
1191673246 X:63768793-63768815 CATTTTAAGTGGATGGTGGCAGG - Intronic
1193519467 X:82511426-82511448 CATCTTATGTGGATGGTGGCAGG + Intergenic
1193862248 X:86683948-86683970 AATCCTAATAGCATAGTGGAAGG - Intronic
1194198674 X:90928717-90928739 CATCCCTGGAGGTTGGTGGATGG - Intergenic
1194216267 X:91133815-91133837 CATCTTACGTGGATGGTGGCAGG - Intergenic
1194506077 X:94735386-94735408 CATCTTACGTGGATGGTGGCAGG + Intergenic
1195558472 X:106255175-106255197 CATCTTACGTGGATGGTGGCAGG + Intergenic
1195621143 X:106956095-106956117 CTTCCCAAGAGGAAGGAGGAAGG + Intronic
1196218255 X:113081076-113081098 CATCTTAAGTGGATGGTGGGAGG + Intergenic
1196586077 X:117429499-117429521 CATACTAAGGAGATGGTGTATGG + Intergenic
1197493587 X:127150248-127150270 TATCCTAATAGCATGGTGTAAGG + Intergenic
1199274881 X:145929132-145929154 CATCTTACGTGGATGGTGGCAGG - Intergenic
1199389548 X:147263147-147263169 CATCTTACAAGGATGGTGGCAGG - Intergenic
1200544668 Y:4505161-4505183 CATCCCTGGAGGTTGGTGGATGG - Intergenic
1202180629 Y:22136836-22136858 AATCCTAAGATGATGGAGGAGGG + Intergenic
1202210731 Y:22449563-22449585 AATCCTAAGATGATGGAGGAGGG - Intergenic