ID: 1018299902

View in Genome Browser
Species Human (GRCh38)
Location 6:162390140-162390162
Sequence TCATGAGATCCTACATAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018299896_1018299902 18 Left 1018299896 6:162390099-162390121 CCAATGTTCATTTCCCGTAAATG 0: 1
1: 0
2: 0
3: 7
4: 145
Right 1018299902 6:162390140-162390162 TCATGAGATCCTACATAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1018299898_1018299902 5 Left 1018299898 6:162390112-162390134 CCCGTAAATGTTGGAAACTCCTT 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1018299902 6:162390140-162390162 TCATGAGATCCTACATAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1018299899_1018299902 4 Left 1018299899 6:162390113-162390135 CCGTAAATGTTGGAAACTCCTTT 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1018299902 6:162390140-162390162 TCATGAGATCCTACATAACGTGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018299902 Original CRISPR TCATGAGATCCTACATAACG TGG Intronic
909290686 1:73879389-73879411 TCAAGAGTTACTACATAACCTGG + Intergenic
909864788 1:80654006-80654028 TCAGGAGATCCTAGCTAACATGG - Intergenic
921965549 1:221084665-221084687 TCTTGAGTTCCTTCATAACAGGG - Intergenic
1063162837 10:3431990-3432012 ACAGGAGATCCTACAGAATGGGG + Intergenic
1070388488 10:75948338-75948360 TCATGATATGCCACATAATGGGG - Intronic
1074004172 10:109402978-109403000 TCATGAGCTCATAGATAACATGG + Intergenic
1080643797 11:34173880-34173902 TCATGACAGCCTCCATAAGGAGG - Intronic
1093367890 12:18325854-18325876 CCATAAGATCCTACATAATTTGG - Intronic
1103000880 12:117384595-117384617 TTCTGTGATCCTACATCACGGGG - Intronic
1107122630 13:36812100-36812122 TCTTCAGATCCTTCATAACTTGG - Intergenic
1109154812 13:58894165-58894187 ACATGAGATACTACATAGAGAGG - Intergenic
1112696721 13:101957832-101957854 ACATGTGATCATATATAACGTGG - Intronic
1115246229 14:31298778-31298800 GCATGAGTTCATACTTAACGGGG - Intronic
1132087756 15:98922011-98922033 TCATGAGTTCTTACCTAAGGGGG + Intronic
1138155543 16:54699873-54699895 TCGTGAGATCCTACAAAAGAAGG - Intergenic
1143982601 17:10882989-10883011 GCATGAGATCCTACCTCAAGGGG - Intergenic
1149103240 17:52930754-52930776 GCATCAGATCCTACAAGACGTGG - Intergenic
1152747744 17:82049074-82049096 TCCTGAGAACCCACATAACGTGG - Exonic
1157878204 18:51293609-51293631 TCATGTGATCCTAAACAACCTGG - Intergenic
1166273734 19:41735944-41735966 TCATCTGATCCTACATCACCAGG + Intronic
1166450586 19:42896984-42897006 TCATCTGATCCTACATCACTAGG - Intronic
1166468621 19:43057777-43057799 TCATCTGATCCTACATCACTAGG - Intronic
943965188 2:194323034-194323056 TCATCAGTTCATACATAAAGTGG + Intergenic
1170472704 20:16684197-16684219 TGATGAGATCCATCATCACGGGG - Intergenic
1178020731 21:28405553-28405575 TCATGAGATGCTACCTAGCTAGG - Intergenic
1178881521 21:36453906-36453928 TGATGAGCTCCTACCTAAGGCGG + Intergenic
951850953 3:27139378-27139400 TCATGAGATCCAACACAATGAGG + Intronic
953272543 3:41459520-41459542 CCATGAGATCCTAGATAATGGGG - Intronic
954569799 3:51631204-51631226 TCATGGGATCCCACAGAAAGAGG - Intronic
954672057 3:52296486-52296508 TCGTGAGATCCTACATGAGTGGG - Intergenic
959841121 3:110976538-110976560 TCATTAGATCCTGCATTACCAGG - Intergenic
964028478 3:152107245-152107267 TCATGTGATCATAGATAACCAGG - Intergenic
964101524 3:152993275-152993297 TCATGAGAACCCAAATAACAAGG - Intergenic
966484049 3:180448100-180448122 TCATGAAATCCTACAGAGAGAGG - Intergenic
969406848 4:6999173-6999195 TAATGAGATCTTACCTAACTGGG + Exonic
972184014 4:36506174-36506196 ACATGATATCCTACAGAAGGAGG - Intergenic
974874397 4:67685625-67685647 CCATTAGGTCCTACGTAACGGGG - Intronic
979643367 4:123036168-123036190 TAATGAGTTGATACATAACGAGG - Intronic
980260852 4:130445350-130445372 TCATGAGATCCTGGCTAACATGG - Intergenic
983262452 4:165471688-165471710 TCTTGAGGTCCTAAATAACCTGG + Intronic
986931460 5:12827833-12827855 TAATGAGATCCAAAATAAAGTGG - Intergenic
995100320 5:108292886-108292908 TCAGGAGATCCTAGCTAACATGG + Intronic
996972886 5:129394587-129394609 TCAGGAGATCCTGGATAACACGG + Intergenic
998993556 5:147845902-147845924 TCATGAGGTCCCAAATAACAAGG - Intergenic
1001358348 5:171054968-171054990 TCTTGAGATCCGACAGAAGGTGG + Intronic
1015408992 6:132870557-132870579 CTATAAGATCCTACATAACCCGG + Intergenic
1018299902 6:162390140-162390162 TCATGAGATCCTACATAACGTGG + Intronic
1043669648 8:82866234-82866256 TTTTGAGATCCTACAGAACTAGG + Intergenic
1055989039 9:82085427-82085449 TCATGAGATAATAGATAACAAGG + Intergenic
1185534101 X:846017-846039 ACATGAGATCCTACCTGACCGGG + Intergenic
1196349821 X:114715185-114715207 TCAAGACATCCTATATAAAGGGG - Intronic
1196695111 X:118603016-118603038 TAATGAGATCCAACATGACCAGG + Intronic