ID: 1018308117

View in Genome Browser
Species Human (GRCh38)
Location 6:162479637-162479659
Sequence GGTCCCACTGGAGGGTCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1467
Summary {0: 1, 1: 14, 2: 300, 3: 517, 4: 635}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018308110_1018308117 -4 Left 1018308110 6:162479618-162479640 CCCACCTCCACTCACATCTGGTC 0: 1
1: 0
2: 2
3: 27
4: 254
Right 1018308117 6:162479637-162479659 GGTCCCACTGGAGGGTCTTCAGG 0: 1
1: 14
2: 300
3: 517
4: 635
1018308111_1018308117 -5 Left 1018308111 6:162479619-162479641 CCACCTCCACTCACATCTGGTCC 0: 1
1: 0
2: 1
3: 34
4: 589
Right 1018308117 6:162479637-162479659 GGTCCCACTGGAGGGTCTTCAGG 0: 1
1: 14
2: 300
3: 517
4: 635
1018308112_1018308117 -8 Left 1018308112 6:162479622-162479644 CCTCCACTCACATCTGGTCCCAC 0: 1
1: 0
2: 2
3: 24
4: 286
Right 1018308117 6:162479637-162479659 GGTCCCACTGGAGGGTCTTCAGG 0: 1
1: 14
2: 300
3: 517
4: 635

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018308117 Original CRISPR GGTCCCACTGGAGGGTCTTC AGG Intronic
900574526 1:3376513-3376535 GGTCTCACTGGATGGTTCTCAGG - Intronic
900671132 1:3855696-3855718 GGTACAACTGGAAGGTCTTTGGG - Intronic
901267736 1:7924761-7924783 TGTCCCACTGGAAGATCTTTGGG - Intronic
901865074 1:12100979-12101001 TGTCCCATTGGAAGGTCTTCAGG + Intronic
902554834 1:17240779-17240801 GGTCCTGCTGGGGGGTCTGCGGG + Intronic
903089277 1:20895988-20896010 TGTCTCATTGGAAGGTCTTCCGG - Intronic
904263092 1:29302063-29302085 TGTCCCACTGGGAGGTCTTTAGG - Intronic
904436339 1:30500165-30500187 TATCCCACTGGAAGGTCTTCAGG + Intergenic
904491458 1:30862484-30862506 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
904722252 1:32519082-32519104 TGTCCCACTGGAAGGTCTTCAGG + Intronic
905005304 1:34704884-34704906 GGTCCCAGGTGAGGGTCTCCTGG + Intergenic
905360641 1:37417482-37417504 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
905690798 1:39941236-39941258 GGTCCCAAGAGAGGCTCTTCGGG - Intergenic
905829255 1:41051514-41051536 TGTCCCACTGGAAGGTCTTCAGG - Intronic
905838002 1:41146100-41146122 GAGCCTACTGGAAGGTCTTCAGG - Intronic
906029434 1:42706099-42706121 TGTCCCACTGAAAGGTCTTCAGG + Intergenic
906547489 1:46630827-46630849 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
906784115 1:48599102-48599124 TATCACACTGGAAGGTCTTCAGG + Intronic
907056281 1:51371355-51371377 TGTCCCCCTGGAAGGTCTTTGGG - Intronic
907081967 1:51631972-51631994 TGTCCCACTGGAAGGTCTTTAGG + Intronic
907087667 1:51691860-51691882 TGTCCCGCTGGAAGGTTTTCAGG + Intronic
907117511 1:51982102-51982124 TGTCCCACTGGAAGGTCTTCAGG - Intronic
907222652 1:52918477-52918499 TGTCCCACTGGAAGGTCTTCAGG - Intronic
907500191 1:54873559-54873581 TGTCCCACTGGAAAGTCTTCAGG - Intronic
907624853 1:56020033-56020055 TGTCCCACTAGAAGGTCTTCGGG + Intergenic
907768445 1:57435654-57435676 TGTCCCAGTGGAAGGTCTTCAGG + Intronic
908025054 1:59941628-59941650 TCTCCCACTGGAAGATCTTCAGG - Intergenic
908067147 1:60418556-60418578 TGCCCCACTGCAAGGTCTTCAGG - Intergenic
908309281 1:62860167-62860189 TGTCCCACTAGAAGGTCTCCAGG + Intronic
908500312 1:64736795-64736817 TGTCCCACTGGAAGATCTTCAGG - Intergenic
908617260 1:65936156-65936178 TGCCCCACTGGAGGGTCTTCAGG + Intronic
908700494 1:66894232-66894254 TGTCCCACTGGAAGGTTTTTTGG - Intronic
908771147 1:67597234-67597256 TGTCCCGCTGGAAGATCTTCAGG + Intergenic
908806065 1:67934082-67934104 TGTCCCACTGTAAGGTCTTCAGG - Intergenic
908839870 1:68268354-68268376 TGTCCCACTAAAAGGTCTTCAGG - Intergenic
908925864 1:69254206-69254228 TATCCCACTGGAAGGTCATCAGG - Intergenic
908941555 1:69441066-69441088 GTTCCTACTGGAGGGCCTTAAGG + Intergenic
909004394 1:70257769-70257791 TGTCCCACCGGAAGGTCTTAAGG - Intergenic
909361621 1:74766365-74766387 TGTACCACTGGAAGGTCTTCAGG - Exonic
909400549 1:75224478-75224500 TGTCCCACTGGAAGGTCTTCAGG - Intronic
909418648 1:75436972-75436994 TGACCCACTGGAAGGTCTTCAGG + Intronic
909610286 1:77544655-77544677 TTGCCCACTGGAAGGTCTTCAGG + Intronic
909765173 1:79346875-79346897 TGTCCCACTGGATGGTGTTCAGG + Intergenic
909782863 1:79569471-79569493 TGTCCCACTGGAAAGGCTTCAGG + Intergenic
909886913 1:80953136-80953158 TGTCCCACTGGAAGGTCTTCCGG + Intergenic
910003481 1:82365724-82365746 TGTCCCACTAGAAGGTCTTTAGG + Intergenic
910346541 1:86245374-86245396 TGTCCCAATGGAAGGACTTCAGG + Intergenic
910595564 1:88976714-88976736 TGTCCCACTGGAAGGTCTTCAGG - Intronic
910667124 1:89737909-89737931 TGTCCCACTGGAAGGTCTTCAGG + Intronic
910900969 1:92120329-92120351 TGTCCCACTGGAAGGTCTTCGGG + Intronic
910943832 1:92566708-92566730 TGTCCCACTGGAAGATCTTCAGG - Intronic
910947032 1:92604458-92604480 TGTCCCACTGGAAGGTCTTCAGG + Intronic
911061809 1:93754950-93754972 TGTCCCACTGGAAGGTCTTCAGG - Intronic
911135437 1:94434228-94434250 TGTCCCACTGGAAGGTCTTCAGG + Intronic
911195595 1:94991968-94991990 TGTCCCACTGAAAGGTCTTCAGG + Intronic
911211228 1:95139976-95139998 TGTCCCACTGGAAGGTCTTCAGG + Intronic
911275179 1:95851718-95851740 TGTTCCACTAGAAGGTCTTCAGG + Intergenic
911327525 1:96486001-96486023 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
911476111 1:98374749-98374771 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
911539290 1:99139148-99139170 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
911544123 1:99196053-99196075 GGTCCCACTGGAAGGTCTTCAGG - Intergenic
911545304 1:99209109-99209131 GGTCCCACTAGAAGGTCTTCAGG + Intergenic
911661079 1:100501762-100501784 TGTCCCACTGGAAGGTCTTCAGG - Intronic
912705951 1:111912617-111912639 TGTCCCACTGGAAGGTCATCTGG - Intronic
912909472 1:113743343-113743365 TGTCCTACTGTAGGGTCTTCAGG + Intronic
913136471 1:115894381-115894403 CGTCCCACTGGCAGGTCTTCAGG - Intergenic
913145412 1:115984730-115984752 TGTCCCAATGGAAGGTCTTCAGG - Intronic
913194850 1:116447326-116447348 TGTCCCACTGGAAGGTATTCAGG - Intergenic
913602155 1:120432067-120432089 GGTTCCAGAGGAAGGTCTTCAGG - Intergenic
914084895 1:144444568-144444590 GGTTCCAGAGGAAGGTCTTCAGG + Intronic
914190904 1:145409729-145409751 GGTTCCAGAGGAAGGTCTTCAGG + Intergenic
914380136 1:147108297-147108319 GGTCCCCCTGGAGGGACTGAAGG + Intergenic
914406592 1:147380699-147380721 TGTCCCACTGGGAGGTCTTCAGG + Intergenic
914588710 1:149086578-149086600 GGTTCCAGAGGAAGGTCTTCAGG + Intronic
914778019 1:150756214-150756236 TGTCCCACTGGAAGGTCTTCAGG + Intronic
914937906 1:151996296-151996318 GGTCCCACTGAAAGGTCTCCAGG - Intergenic
915029372 1:152863452-152863474 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
915251798 1:154595373-154595395 TGTCCCACTGTAAGGTGTTCAGG - Intronic
915255690 1:154627190-154627212 GGCCCCACTAGAGGGTAATCCGG - Intronic
915506963 1:156363750-156363772 TGTCACACTGGAAGGTCTTCAGG + Intronic
915621350 1:157087148-157087170 TGTCCCACGGGAAAGTCTTCAGG - Intergenic
915621556 1:157089077-157089099 TGTCCCACGGGAAAGTCTTCAGG - Intergenic
916194031 1:162206761-162206783 GGTCACACTACAAGGTCTTCTGG - Intronic
916325026 1:163546678-163546700 TGTCTCACTGGAAGATCTTCAGG + Intergenic
916410161 1:164539268-164539290 TGTCCCACTGGAAGGTCTCCAGG - Intergenic
916813767 1:168330050-168330072 TATCCCACTGGAAGGTCTTCAGG - Intergenic
916897024 1:169175238-169175260 TGTCCCACTGGAAGGTCTTTAGG + Intronic
917114011 1:171583425-171583447 TGTCCCACTGGGAGGTCTTCAGG + Intronic
917131625 1:171749109-171749131 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
917137568 1:171802425-171802447 GGTCCCTCTGGAGGCTCTGAGGG - Intronic
917260526 1:173162448-173162470 TGCTCCACTGGAAGGTCTTCAGG + Intergenic
917449943 1:175139499-175139521 TGTCCCGCTGGAAGGTCTTCAGG + Intronic
917487949 1:175472233-175472255 TGTCTCGCTGGAAGGTCTTCAGG + Intronic
917588158 1:176449428-176449450 GTTCTTACTGGAAGGTCTTCAGG + Intergenic
918031477 1:180816970-180816992 TCTCCCACTGGAAGGTCTTCGGG - Intronic
918134173 1:181656280-181656302 TGTCCCACTGGAAGGTCTTCAGG - Intronic
918174092 1:182028184-182028206 TGTCCCATTGGAAGGTCTTCAGG + Intergenic
918420922 1:184363582-184363604 GCTCTCACAGGAAGGTCTTCAGG + Intergenic
918817995 1:189214847-189214869 TGTCCCATTGGAAGGTCTTCAGG - Intergenic
918916386 1:190645293-190645315 TGTCCCACTGGAAGGTATTCAGG + Intergenic
918934534 1:190903854-190903876 TGTTCCACTGGATGGTCTTCAGG - Intergenic
918937936 1:190948561-190948583 TGTCCCACTGAAAGGTCTTCAGG - Intergenic
919144481 1:193616283-193616305 TGTTCCACTGGAAGGTCTTCAGG - Intergenic
919295467 1:195693870-195693892 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
919388100 1:196946658-196946680 TGTCCCACTAGAAGATCTTCAGG + Intronic
919405662 1:197179633-197179655 TGTCCCACTGGAAGGTCTTCAGG - Intronic
919649619 1:200133876-200133898 TGTCCCATTGGAAGGTCTTCAGG - Intronic
920324464 1:205151811-205151833 TGTCCCACTGGAAGGTTTTCGGG + Intronic
920680248 1:208066770-208066792 TGTCCCACTGTGAGGTCTTCAGG - Intronic
920717170 1:208350928-208350950 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
920918077 1:210274410-210274432 GGCCCCATTGGAAGGTCTTTGGG + Intergenic
921047118 1:211485413-211485435 GGACCCACTGAAGAGCCTTCTGG - Intronic
921399824 1:214709142-214709164 TTTCCCACTGGAAGGTCTTCAGG + Intergenic
921434509 1:215102216-215102238 TGTCCCACTGGAAGCTGTTCAGG - Intronic
921563850 1:216692226-216692248 AGTCCTACTGGAAGGTCTTCAGG - Intronic
921643636 1:217586479-217586501 TGTCTCACTGGAAGGTCTTCAGG + Intronic
921722186 1:218485016-218485038 TGTCCCAGCGGAAGGTCTTCAGG - Intergenic
921770466 1:219032333-219032355 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
922399930 1:225242524-225242546 TGTCCCACTGGAAGTTCTTCAGG + Intronic
922480098 1:225934298-225934320 TGTCCCAGTAGAAGGTCTTCAGG + Intergenic
923002076 1:230015007-230015029 TGTCCCACTGGAAGTGCTTCAGG - Intergenic
923128164 1:231050569-231050591 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
923312642 1:232750059-232750081 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
923405857 1:233659290-233659312 TGTCCCACTGGAAGGTCTTCAGG + Intronic
923417906 1:233782740-233782762 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
923827319 1:237515183-237515205 GGTCACATTTGAGGGTCATCTGG - Intronic
923925566 1:238623306-238623328 TGTCCCACTGGAAGGTATTCAGG - Intergenic
924297809 1:242606113-242606135 TGTCCCACTGCAAGGTCTTCAGG + Intergenic
924393906 1:243595716-243595738 TGTCCCACTGTAAGGTCTTTCGG + Intronic
924857199 1:247885612-247885634 TGTCCCACTGGAAGGATTTCCGG + Intergenic
1062790786 10:303941-303963 TGTCCAACTGGAGGGTCTTTAGG + Intronic
1062794814 10:336749-336771 TGTCCCACTGGAGGGCCTTCAGG - Intronic
1063283492 10:4658044-4658066 TGCCCCATTGGAAGGTCTTCAGG + Intergenic
1064126631 10:12667120-12667142 GGGCCCACTGAAGTGTCTTCAGG - Intronic
1064249154 10:13693627-13693649 GGTCACACTTAAGTGTCTTCAGG - Intronic
1064767669 10:18691603-18691625 CATCCCACTGGAAGGTCTTCAGG - Intergenic
1065350122 10:24787910-24787932 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1065604404 10:27402092-27402114 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1065631117 10:27682035-27682057 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1065781484 10:29172424-29172446 CGTCCCACTGGAAAGTCTTCTGG + Intergenic
1066678178 10:37910403-37910425 TGTTCCTCTGGAAGGTCTTCAGG + Intergenic
1066801671 10:39199324-39199346 GGTGCAACTGGTGGGTCCTCAGG + Intergenic
1067060208 10:43074541-43074563 GGTCCCCTTGGAGAATCTTCAGG - Intergenic
1067250807 10:44585573-44585595 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1067913420 10:50370835-50370857 TGTCCCACCAGAAGGTCTTCGGG + Intronic
1068065431 10:52124910-52124932 TGTCCCCTTGGAAGGTCTTCAGG + Intronic
1068362984 10:56004193-56004215 TGTCCTACTGGAAGGACTTCAGG + Intergenic
1068441333 10:57058471-57058493 TGTCCCACTGGAAGGTCTTCTGG + Intergenic
1068484416 10:57638901-57638923 TGTCCCACTGGCAGGTCTTCAGG - Intergenic
1068546419 10:58351528-58351550 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1068672746 10:59740465-59740487 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1068795314 10:61072912-61072934 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1068933983 10:62618461-62618483 GGGCACACTGGTGGATCTTCGGG - Intronic
1069051098 10:63795575-63795597 CGTCCCACTGGAAGGTCTCCAGG + Intergenic
1069118733 10:64540830-64540852 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
1069125713 10:64629748-64629770 TGTCCCACTGAAAGTTCTTCAGG - Intergenic
1069211216 10:65761894-65761916 TGTCCCACTGGAAGGTCTTGAGG + Intergenic
1069357461 10:67603475-67603497 TGTCCCACTGAAAGGTCTTCAGG - Intronic
1069418605 10:68225289-68225311 GGTCGCACTGGAAGGTGTTCAGG - Intergenic
1070098711 10:73364626-73364648 CATCCCACTGGAAGGTCTTCAGG + Intergenic
1070701594 10:78605605-78605627 TGTCCCACTGGAAGGGTTTCAGG - Intergenic
1070868450 10:79725667-79725689 TCTCCCATTGGAAGGTCTTCAGG - Intergenic
1071155651 10:82685906-82685928 TGTTCCACTAGAGGGTCTTCAGG + Intronic
1071339611 10:84632278-84632300 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
1071461247 10:85898687-85898709 TGTCTCACTAGAAGGTCTTCAGG + Intronic
1071635365 10:87247873-87247895 TCTCCCATTGGAAGGTCTTCAGG - Intergenic
1071659882 10:87490114-87490136 TCTCCCATTGGAAGGTCTTCAGG + Intergenic
1071701476 10:87942686-87942708 TGTCCCACTGGAAGGTCTTAAGG - Intronic
1071978693 10:90981346-90981368 TGTCCCACTGGAAGGTCTTTGGG - Intergenic
1072061352 10:91814140-91814162 TCTCCCACTGGAAGGTCTTTAGG - Intronic
1072070292 10:91908824-91908846 GGGCCCACTGGCGGCTCCTCGGG - Exonic
1072111082 10:92320496-92320518 TGTCCCACTAGAAGGTCTTCAGG - Intronic
1072386089 10:94929667-94929689 TGTCCCACTGTAAGGTTTTCAGG + Intergenic
1072802392 10:98401783-98401805 TGCCCCACTGCAGGGTCTTCAGG + Intronic
1073274096 10:102293559-102293581 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1073813727 10:107181591-107181613 TGTCCCACTGAAAAGTCTTCAGG + Intergenic
1073906714 10:108289749-108289771 TGTCCCATTGGAAGCTCTTCGGG + Intergenic
1074243212 10:111660215-111660237 TGTTCCACTGGAAGGTCTTCAGG - Intergenic
1074342752 10:112650341-112650363 TGTCCCACTGGAAGATCTGCAGG + Intronic
1074626178 10:115189438-115189460 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1074728729 10:116344957-116344979 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1074914385 10:117941456-117941478 GTTCCTTCTGGAGGGTCTACGGG + Intergenic
1075163562 10:120045848-120045870 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1075422983 10:122317773-122317795 TGTCCCACTGGAAGGCCTTCAGG + Intronic
1075498110 10:122945522-122945544 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1075530378 10:123224213-123224235 TGTCCCACTTGAAGGTATTCAGG - Intergenic
1075770052 10:124926512-124926534 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1076158078 10:128218890-128218912 GGTCCCATTGGAAGGTCTTGAGG - Intergenic
1076165929 10:128282812-128282834 TGTCCCATTGGAAGGTCTTCAGG + Intergenic
1076182002 10:128416762-128416784 TGTCCCACTGGAAGTTCTTGAGG - Intergenic
1076470558 10:130715288-130715310 GGTCCCTCTGCTGGGTCGTCAGG - Intergenic
1076547072 10:131252581-131252603 GCTCACACTGGAGAGTCTTCCGG - Intronic
1076907500 10:133370608-133370630 GGTCCTCCTCGAAGGTCTTCAGG + Exonic
1077133239 11:985428-985450 CCTCGCACTGCAGGGTCTTCTGG - Exonic
1077496647 11:2889943-2889965 GGGCCCACTAGAGAGTCTCCAGG + Intronic
1077751986 11:4981934-4981956 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1077788360 11:5410717-5410739 TGTTCCACTGGAGGATCTTTTGG - Intronic
1077871624 11:6267454-6267476 TGTCCCACTGGAAGGTCATCAGG + Intronic
1078031438 11:7755443-7755465 TGTCCCACTGGAAGGTGTTCAGG - Intergenic
1078062569 11:8057553-8057575 GGCCCCAGAGGAAGGTCTTCAGG - Intronic
1078125004 11:8552699-8552721 TGTTCCTCTGGAAGGTCTTCAGG + Intronic
1078281870 11:9910575-9910597 TGTCTCACTGGAAGTTCTTCAGG - Intronic
1078329101 11:10404199-10404221 TGTCCCACTGGAAGATCTTCAGG - Intronic
1078343459 11:10520458-10520480 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1078644529 11:13127832-13127854 TGTCCCACTGCAAGGTCTTCAGG - Intergenic
1078667285 11:13336577-13336599 GGTCCAACTGGAGAGCCCTCAGG - Intronic
1078749702 11:14149180-14149202 TGTCCCACTGGAAGGTCCTCGGG - Intronic
1078777330 11:14405639-14405661 TGTCCCACTGGAAGGCCTTCAGG - Intergenic
1079112435 11:17612413-17612435 GGTCCCACAGGAGGGGAGTCTGG - Intronic
1079118903 11:17663326-17663348 TGTCCCACTGGAAGGTATTCAGG + Intergenic
1079199450 11:18363097-18363119 TGTCCCACTGAAAAGTCTTCAGG + Intronic
1079352868 11:19707504-19707526 TGTCCCTCTGGAAGGTCTTCAGG + Intronic
1079514169 11:21247530-21247552 TGTCCCGTTAGAGGGTCTTCAGG + Intronic
1079540578 11:21568751-21568773 TGTCCCACTTGAAGGTCTTCAGG + Intronic
1079680930 11:23297406-23297428 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1080090061 11:28336954-28336976 TGTCCCACTGGAAGGTGTTCAGG - Intergenic
1080282461 11:30573554-30573576 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1080369931 11:31624901-31624923 TTTCCCACTGGAAGGTCTTCAGG + Intronic
1080583657 11:33663489-33663511 GATCCCACTGGAGTATCCTCAGG - Intronic
1080589993 11:33714828-33714850 TGTCCCACTGGAAGGTCTTAGGG + Intronic
1080724814 11:34886199-34886221 TGTCTCAGTGGAAGGTCTTCAGG - Intronic
1080974507 11:37321609-37321631 TGTTCCATTGGAAGGTCTTCAGG + Intergenic
1081004230 11:37714154-37714176 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1082908365 11:58339262-58339284 GTTCCCACAGGAGGGTCTAAGGG + Intergenic
1083167047 11:60896331-60896353 TTTCCCACCGGAAGGTCTTCGGG - Intronic
1083514127 11:63240764-63240786 TGTCTCACTAGAAGGTCTTCTGG + Intronic
1083761947 11:64823628-64823650 GGGGCCACTGGAGGGTCTCCGGG - Exonic
1084135561 11:67177582-67177604 TTTCCCACTGGAAGATCTTCAGG + Intronic
1084293216 11:68190527-68190549 TGTCCCACTGGAGCGTCTTCAGG - Intronic
1084753186 11:71217610-71217632 CGTCCCACTGGAAGGTCTTCAGG - Intronic
1085142494 11:74159420-74159442 TGTTCCACTGGAAGGTCTTAGGG - Intronic
1085241051 11:75055976-75055998 TGTCCCACTGGAAGATCTTCAGG - Intergenic
1085282141 11:75338147-75338169 GGTGGCACTGGAGGCCCTTCAGG - Intronic
1085540705 11:77266630-77266652 TGTCCCACTGCAGTGTCTGCAGG - Intronic
1085555467 11:77416437-77416459 TGTCCCACTGGAAGGTCTTTAGG + Intronic
1085677366 11:78536410-78536432 TGTCCTACTGAAAGGTCTTCAGG - Intronic
1086293841 11:85342424-85342446 TGCCCCACTGGAAGGTGTTCAGG + Intronic
1086643548 11:89190305-89190327 TGTCCCACTGGAAAATCTTCAGG - Intronic
1086799877 11:91159751-91159773 TGCCTCACTGGAAGGTCTTCAGG + Intergenic
1087015930 11:93554749-93554771 GCTCCCACTTGAGGGTCTGGGGG + Intergenic
1087156762 11:94912311-94912333 TGTCCCATTGGAAGGTCTTCAGG + Intergenic
1087258465 11:95983153-95983175 TGACCCACTGGAAGGTGTTCAGG - Intronic
1087432451 11:98070700-98070722 TGTCCCACTGGAAGTTCTTTAGG - Intergenic
1087604160 11:100355316-100355338 TGTCTCACTAGAGGGTCTACAGG + Intronic
1087666058 11:101049205-101049227 TATCTCACTGGAAGGTCTTCAGG + Intronic
1087819688 11:102697939-102697961 TGTCCCACTGGAAAGTCTTCAGG + Intronic
1087921628 11:103873330-103873352 TGTCACACTGGAAGGTCTTCAGG - Intergenic
1087976087 11:104548898-104548920 TGTCCTACTGGAAGGTCTTCAGG + Intergenic
1088056236 11:105582997-105583019 TTTCCCACTGGAAGGTCTTTAGG - Intergenic
1088086859 11:105991628-105991650 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1088096781 11:106109627-106109649 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1088118681 11:106341717-106341739 TGTCCCACTGGAAGCTCTTCAGG - Intergenic
1088266164 11:107989860-107989882 GGTCCCACAGGAAGGTCTTCAGG + Intergenic
1088269628 11:108020330-108020352 TGTCCCACTGGAAAGTCTTCGGG - Intronic
1088336496 11:108710525-108710547 CGTCCCACTAGAAGGCCTTCAGG + Intronic
1088453327 11:110006125-110006147 TGTCCCACTGAAAGGTCTTCAGG + Intergenic
1088462653 11:110098124-110098146 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1088744045 11:112790120-112790142 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1088993989 11:114980026-114980048 TGTCCCACTAGTAGGTCTTCAGG - Intergenic
1089995369 11:122901998-122902020 TGTCTCACTGGAAGGTCTTCAGG + Intronic
1090041211 11:123293699-123293721 CGTCCCACTGGAAGGTCTTTAGG + Intergenic
1090361223 11:126174137-126174159 TGTCCCACTGGAAGCTCTTCAGG + Intergenic
1090516711 11:127436393-127436415 TGTCCCAGTGGAAGGTCTTCAGG + Intergenic
1090954391 11:131501525-131501547 GGAGCTACTGGAGGGTCTTCAGG + Intronic
1090970175 11:131635309-131635331 CATCCCACTGGAAGGTTTTCAGG - Intronic
1091361232 11:134979897-134979919 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1091364167 11:135003766-135003788 TGTCCCACTGGAACATCTTCAGG + Intergenic
1091628804 12:2142628-2142650 TGTGCCACTGGAAGGTCTTCGGG - Intronic
1091766919 12:3127237-3127259 TGTCCCGCTGGAAGGTCTTCAGG + Intronic
1091812750 12:3413520-3413542 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1092110297 12:5956384-5956406 TGTTCCACTGGAAAGTCTTCAGG - Intronic
1092499898 12:9034903-9034925 TGTCCCACTGGGAGTTCTTCAGG - Intergenic
1092546483 12:9456368-9456390 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1092665637 12:10793439-10793461 TGTCCCACTGCAAGGTCTTTGGG + Intergenic
1093122665 12:15291645-15291667 TGTCCCATTGGAAGGTCCTCAGG + Intronic
1093407882 12:18827557-18827579 TGTCCCACTGGCAGGTCTTCAGG + Intergenic
1093439050 12:19171917-19171939 TGTCCCACTGTAAGATCTTCAGG + Intronic
1093793014 12:23277273-23277295 GGTCTCACTGGATGATCTTCAGG - Intergenic
1093835041 12:23818901-23818923 TATCTCACTGGAAGGTCTTCAGG + Intronic
1093956399 12:25224306-25224328 TGTCCCACTGGAAGATCTTCAGG - Intronic
1094030055 12:26001666-26001688 TGTCGTACTGGAAGGTCTTCAGG + Intronic
1094416273 12:30218812-30218834 TTTCCCGCTGGAAGGTCTTCAGG - Intergenic
1094446606 12:30537816-30537838 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1094455489 12:30627951-30627973 TGTCCCCCTGGAAGGTCTTAAGG - Intergenic
1094506457 12:31065706-31065728 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1094737207 12:33248553-33248575 CCTCCCACTGGAAGGTCTTCAGG + Intergenic
1095170739 12:39032950-39032972 TGTCCCATAGGAAGGTCTTCAGG - Intergenic
1095222479 12:39633359-39633381 TGTTCCACAGGAAGGTCTTCAGG + Intronic
1095223998 12:39656685-39656707 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1095295900 12:40527095-40527117 GGTACCACTGGAGAATTTTCTGG + Intronic
1095296882 12:40536724-40536746 GGTACCACTGGAGAATCTTCTGG + Intronic
1095436457 12:42193850-42193872 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1095715147 12:45336903-45336925 TGTCTCACTGGAAGGTCTTCAGG - Intronic
1095807160 12:46332162-46332184 TGTCTTACTGGAGGGTCTTCAGG + Intergenic
1096057922 12:48670429-48670451 TGTCCCAGTGGAAGGTCTTCGGG - Intronic
1096245370 12:49982030-49982052 GGTTCCAGAGGAAGGTCTTCAGG + Intronic
1096342665 12:50815235-50815257 TATCCCACTGGAAGGTCTTTAGG - Intronic
1096398234 12:51283390-51283412 TGTCCCACTAGAAGGTCTTCAGG - Intronic
1096474948 12:51902970-51902992 TGTCCCACTGGTAGGTCTTCAGG + Intergenic
1096911928 12:54992825-54992847 TATCCCACTGGAAGGTCTTCAGG + Intergenic
1097003238 12:55896258-55896280 TGTCCCACTGGAAGGTTTTCTGG + Intergenic
1097025560 12:56052737-56052759 TGTCCCACTGGAAGATCTTCAGG + Intergenic
1097272494 12:57785344-57785366 TGTCCTGCTGGAAGGTCTTCAGG + Intronic
1097422484 12:59397431-59397453 AGTCCCACTGGAAGGCCTTCAGG - Intergenic
1097630883 12:62060692-62060714 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1098017150 12:66117728-66117750 TGTCCCACTGCAAGGCCTTCAGG - Exonic
1098108698 12:67098442-67098464 TATACCACTGGAAGGTCTTCAGG - Intergenic
1098159570 12:67636392-67636414 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1098351433 12:69565710-69565732 TGTCCCACTGGAAAGTCTTCAGG + Intronic
1098779325 12:74665132-74665154 CGTCCCATTTGAAGGTCTTCGGG + Intergenic
1098800273 12:74948792-74948814 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1099546099 12:83981913-83981935 TGTCCCACTGGAAGGTCGTCAGG + Intergenic
1099670256 12:85682370-85682392 TGTCCCACTAGAAGATCTTCAGG + Intergenic
1100152370 12:91754988-91755010 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1100314285 12:93429674-93429696 TGTCCTACTCGAAGGTCTTCAGG - Intronic
1100320202 12:93484023-93484045 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1100457003 12:94762049-94762071 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
1100692635 12:97054812-97054834 TGTCCCTCTGGAAGATCTTCAGG - Intergenic
1100807875 12:98306570-98306592 CATTCCACTGGAAGGTCTTCAGG + Intergenic
1100967174 12:100025765-100025787 TGTCCTACTGGAAGGTCTTCAGG + Intergenic
1100999892 12:100346864-100346886 GGACCCACTGGAGAGGTTTCAGG + Intergenic
1101050794 12:100861950-100861972 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1101110752 12:101483344-101483366 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1101177561 12:102171029-102171051 TGTCCCACTGGAAAATCTTCAGG + Intronic
1101555372 12:105803788-105803810 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1101563090 12:105878730-105878752 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1101673011 12:106894246-106894268 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1101989401 12:109472391-109472413 TGTCCCACTAGAAGGTCTTCAGG + Intronic
1102839764 12:116106244-116106266 GGACCAACTGGATGGACTTCTGG + Intronic
1102918006 12:116769439-116769461 TGTCCCACTGGAAGATCTTCAGG - Intronic
1103178663 12:118888154-118888176 TGTCCTACTGGAAGGTCTTCAGG + Intergenic
1105203993 13:18204240-18204262 TGTCCCAGTGAAAGGTCTTCAGG + Intergenic
1105683774 13:22756626-22756648 TGACCCACTGGAAGGTCTTCAGG - Intergenic
1105760326 13:23508088-23508110 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
1105832919 13:24181642-24181664 TGTCCCACTAGAAGGTCTTCAGG + Intronic
1106175403 13:27326321-27326343 TGTCCCACTGGAAGACCTTCAGG + Intergenic
1106406121 13:29475528-29475550 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1106417828 13:29560252-29560274 TGTCCCACCGGAAGGTCTTCAGG + Intronic
1106957723 13:34960102-34960124 TGTCCCACTGAAAAGTCTTCAGG - Intronic
1107268812 13:38589989-38590011 TGTTCCACTGGAAGGTCTGCAGG - Intergenic
1107294750 13:38897121-38897143 TGTCCCGCTGGAAGGTCTTCAGG + Intergenic
1107321925 13:39199009-39199031 TGTCCCACTGGAAGGTCTGCAGG - Intergenic
1107334318 13:39337768-39337790 TGTCCCACTGAAAGGTCTTCAGG - Intergenic
1107445043 13:40462920-40462942 TGTCCCATTGGAAGGTCTTCAGG + Intergenic
1107454720 13:40544428-40544450 TGTCCCACTGGAAGGTCTGCAGG - Intergenic
1108384861 13:49889868-49889890 TGTCCCACTGGAGGGTCTTCAGG - Intergenic
1108387072 13:49908881-49908903 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1108453721 13:50592234-50592256 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1108531041 13:51327440-51327462 GGTCCCACTGGAAGGTCTTCAGG - Intergenic
1108567511 13:51715483-51715505 CGTCCCACTGGAAGGTCTTCGGG + Intronic
1108583417 13:51846683-51846705 TGTCCCACTGGAAGTTCTTCAGG - Intergenic
1108599311 13:51977467-51977489 TCTCCCACTGGAAGGTCTTCAGG + Intronic
1108747161 13:53407873-53407895 TGTCCCATTGAAAGGTCTTCAGG + Intergenic
1108767849 13:53655691-53655713 TGTCCCACTGGGAAGTCTTCAGG + Intergenic
1108812432 13:54244643-54244665 TGTATCACTGGAAGGTCTTCAGG + Intergenic
1108825153 13:54404576-54404598 TGTCCCACTGAAAGGTCTTCAGG + Intergenic
1109104739 13:58236815-58236837 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1109110086 13:58305883-58305905 TATCCCACTGGAAGGTCTTGAGG + Intergenic
1109126784 13:58527891-58527913 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1109385253 13:61621924-61621946 TTTCCCACTGAAGGGTCTTCAGG + Intergenic
1109454178 13:62561899-62561921 TGTCCCTCTGGAGGGTCTTCAGG - Intergenic
1109472103 13:62821456-62821478 TATCCCACTGGAAGGCCTTCAGG - Intergenic
1109505410 13:63294460-63294482 TGTCCCACTGGTAGGTCTTCAGG + Intergenic
1109505941 13:63303662-63303684 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1109591886 13:64495322-64495344 TATTCCACTGGAAGGTCTTCAGG - Intergenic
1109990081 13:70042838-70042860 TGTCCCACTGGAGAGTCTTCAGG - Intronic
1110166726 13:72451148-72451170 TGTGCCACTAGATGGTCTTCAGG - Intergenic
1110232369 13:73180410-73180432 TGTCCCACTGGAAGATCTTCAGG - Intergenic
1110454137 13:75671089-75671111 TGTCCCACTGGAAGGCCCTCAGG + Intronic
1110473378 13:75885761-75885783 TATTCCACTGGAAGGTCTTCAGG + Intergenic
1110758441 13:79203163-79203185 TGTCCCACTGGAAGGACTTCAGG - Intergenic
1110769605 13:79325381-79325403 TGTCCCACTGGAAAGTCTTGAGG - Intronic
1110850829 13:80242462-80242484 TGATCCACTGGAGGATCTTCAGG - Intergenic
1111053508 13:82917499-82917521 TGTCCTACTGGAAGGTCTTCAGG - Intergenic
1111088437 13:83408532-83408554 TGTTTCACTGGATGGTCTTCAGG - Intergenic
1111289960 13:86153275-86153297 TGTCCCACTGGTAGGTCGTCAGG + Intergenic
1111349141 13:87003070-87003092 TTTCCCACTGGCAGGTCTTCAGG - Intergenic
1111421410 13:88016452-88016474 TGTCCCCCTGGAAGGTCTTCAGG - Intergenic
1111509315 13:89240558-89240580 TGCCCCACTGGAAGGTCTTCAGG + Intergenic
1111591909 13:90358760-90358782 TGTCCCATTGGAAGTTCTTCAGG - Intergenic
1111753707 13:92365775-92365797 TGTCCTACTGTGGGGTCTTCAGG + Intronic
1111787048 13:92801639-92801661 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1111861770 13:93716376-93716398 TGTCTCACTGGAAGGTCTTCAGG - Intronic
1112253940 13:97810796-97810818 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1112288884 13:98127482-98127504 TGTCCCACTGGAAGGTTTTTGGG - Intergenic
1112324239 13:98432818-98432840 GGACCCACTGGAGGGTCTGCAGG + Intronic
1112470433 13:99683619-99683641 TGTCCCAGTGGAAGGTCTTTAGG + Intronic
1112584957 13:100710739-100710761 TGTCCCATGGCAGGGTCTTCAGG + Intergenic
1112706535 13:102075768-102075790 TGTCCCACTGGAAAGTTTTCGGG - Intronic
1112942484 13:104881221-104881243 TGTCCTACTGGAAGGTCTTCAGG + Intergenic
1113030528 13:105989363-105989385 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1113125482 13:106973870-106973892 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1113137062 13:107102860-107102882 TGTCCTACTGGAAGGTCTTCAGG - Intergenic
1113444961 13:110358318-110358340 TGTCCCACCAGAAGGTCTTCGGG + Intronic
1113529403 13:111010294-111010316 TGTCCCACTGCAAGATCTTCAGG - Intergenic
1113694443 13:112333911-112333933 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1113866116 13:113526103-113526125 TGTCCCACTGCAAGGTCTTCAGG - Intronic
1113987751 13:114331931-114331953 GGTCTCACCGGCAGGTCTTCAGG + Intergenic
1114382134 14:22218117-22218139 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1114743172 14:25119094-25119116 GGTCACACATCAGGGTCTTCAGG + Intergenic
1114879245 14:26763258-26763280 TGTCCCACTGGAAGGTGTTCAGG + Intergenic
1114951350 14:27758176-27758198 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1115286257 14:31716116-31716138 TGTCCCACTGAAAGGTCTTCAGG + Intronic
1115404961 14:33004942-33004964 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1115916835 14:38324625-38324647 TGTCCCACTTGAAGGTCTTCAGG + Intergenic
1116105631 14:40500398-40500420 TGTCCCACTGGACGGTTTTCAGG - Intergenic
1116106113 14:40508992-40509014 TGTCCCACTGGTAAGTCTTCAGG - Intergenic
1116425919 14:44791118-44791140 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1116700899 14:48240399-48240421 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1116753774 14:48920492-48920514 TGTCCCTCTGAAAGGTCTTCAGG + Intergenic
1117113546 14:52485119-52485141 TGTCCCTTTGGAAGGTCTTCAGG - Intronic
1117149357 14:52869834-52869856 TGTCTCACTGGAAGGTCTTCAGG - Intronic
1117558875 14:56915323-56915345 TGTCCCACTGGAAAGCCTTCAGG + Intergenic
1117732551 14:58737951-58737973 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1117863334 14:60116807-60116829 TGTTCCACTGGAAAGTCTTCAGG - Intronic
1117873796 14:60228871-60228893 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1118307164 14:64664557-64664579 TGTACCACTGGAAGGTCTTTAGG + Intergenic
1118353879 14:64995175-64995197 CATCCCACTGGAAGGCCTTCGGG + Intronic
1118698256 14:68406953-68406975 TGTCTCACTGGAAAGTCTTCAGG + Intronic
1118802067 14:69199725-69199747 TGTCCCACTGGAAAGTCTTCAGG + Intronic
1119314643 14:73682751-73682773 TGTCCCACTGGAAAGTCTTCAGG + Intronic
1119523928 14:75307401-75307423 GCGCCCACTGGAGGGTCCCCTGG - Intergenic
1120065452 14:80035188-80035210 TGTCCCACTGGAAGGCCTTCAGG - Intergenic
1120199556 14:81521893-81521915 TGTCCCATTGGAAGGTCTTCAGG - Intronic
1120266505 14:82257801-82257823 GTTCCCTCTGGAGGGTCTAGGGG - Intergenic
1120712979 14:87812153-87812175 GGTCCCACTGGAAGGTCTTCAGG + Intergenic
1121584451 14:95053544-95053566 TGTTCCACTGGAAGGTCTTCAGG + Intergenic
1121750680 14:96352490-96352512 TGTTCCACTGGAAGGTCTTCAGG - Intronic
1121855305 14:97263837-97263859 TGTCTCCCTGGAAGGTCTTCAGG - Intergenic
1122362085 14:101173570-101173592 GGTCTCTCTGGAGTGTCTGCTGG - Intergenic
1124139261 15:27063233-27063255 GGACACACAGGAGTGTCTTCGGG + Intronic
1124163558 15:27296955-27296977 TGTCCCACTGGAAGGTTTTCAGG - Intronic
1124506917 15:30285405-30285427 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1124545003 15:30618572-30618594 TGTCCTACTGGAAGGTCTTCAGG + Intergenic
1124665899 15:31592464-31592486 TGTCCCACTGGTAGGTCTTCAGG + Intronic
1124736640 15:32253256-32253278 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1124778524 15:32607973-32607995 TGTCCTACTGGAAGGTCTTCAGG + Intergenic
1125064610 15:35467672-35467694 CATCCCACCGGAAGGTCTTCAGG + Intronic
1125147090 15:36483819-36483841 TGTCCCACTAGAAGGTCTTCAGG - Intergenic
1125436768 15:39654036-39654058 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1125456321 15:39862952-39862974 TGTCCCATAGGAAGGTCTTCAGG - Intronic
1125519850 15:40341863-40341885 TGACCCACTGGAAGGTCTTCAGG - Intergenic
1125990679 15:44104068-44104090 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1126196854 15:45941249-45941271 TGTCCCACTGGAAGGTTTTCAGG + Intergenic
1126329675 15:47518777-47518799 TGTCCCACTGGAAAGCCTTCAGG + Intronic
1126494419 15:49274852-49274874 TGTCCTACTGGAAGGTCTTCAGG + Intronic
1126523859 15:49628189-49628211 TGTCCCACTGGAAGCTCTTCAGG + Intronic
1126529463 15:49696923-49696945 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1126702016 15:51376835-51376857 TGTCCTATTGGAGGGTCTCCAGG + Intronic
1126880903 15:53096130-53096152 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1127044529 15:55011746-55011768 GGCTCCATTGGAGGGGCTTCAGG - Intergenic
1127897996 15:63319597-63319619 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1128310297 15:66627104-66627126 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1128494492 15:68186213-68186235 TGTCCCACTGCATGGTCTTCAGG - Intronic
1129490606 15:75921873-75921895 CGTCCCACTGCAAGGTCTTCAGG + Intronic
1129620458 15:77139200-77139222 TGTCCCAGTGGCAGGTCTTCAGG + Intronic
1129961092 15:79685285-79685307 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1130021764 15:80237472-80237494 TATCCCACTGGAAGGGCTTCAGG - Intergenic
1130026265 15:80273115-80273137 GGTGCCCCTGGAGGAGCTTCAGG + Intergenic
1130156253 15:81352705-81352727 TGTCCCACTGGAAGGTCTTCGGG - Intronic
1131412535 15:92222010-92222032 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1131553299 15:93376135-93376157 GTTCCCACTGGAGGCTCTACAGG - Intergenic
1131601990 15:93859044-93859066 TGTCCCATTGGAAAGTCTTCGGG + Intergenic
1132033151 15:98455420-98455442 TGTCCCACTGGAAGGTCTCCAGG - Intronic
1132458860 16:39441-39463 ACACCCACGGGAGGGTCTTCAGG + Intergenic
1132767562 16:1542129-1542151 GGTGCCACAGGAGGGTCCTGAGG + Intronic
1133016556 16:2944947-2944969 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1134789435 16:16975635-16975657 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1137889306 16:52141683-52141705 GGACACACTGGAGGGTCATTGGG + Intergenic
1137956577 16:52837307-52837329 TCTCCCACTAGAAGGTCTTCTGG + Intergenic
1138356858 16:56388802-56388824 TGTCCCACTGGAACGTCTTCAGG + Intronic
1138984323 16:62308847-62308869 TGTCCCACTGGATGGCCTTCAGG - Intergenic
1139002398 16:62528499-62528521 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1139104175 16:63806219-63806241 CGTCTCACTGGAAGGTCTTCAGG - Intergenic
1140274936 16:73500199-73500221 TCTCCCACTGGAAGGTCTTCAGG - Intergenic
1140716581 16:77731750-77731772 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1140997272 16:80273054-80273076 GCTCCCTCTGGAGGCTCTTGGGG - Intergenic
1142587983 17:986559-986581 GGCACCACTGTTGGGTCTTCTGG + Intergenic
1143300552 17:5907112-5907134 TGTCTCACTGGAAGGTCTTCAGG + Intronic
1143339380 17:6197984-6198006 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1143540953 17:7568653-7568675 GCTCCCACAGGATGGTCTCCAGG + Intronic
1143615728 17:8048026-8048048 TGTCCCACTGGAGGGTCAGTGGG - Intronic
1144117769 17:12116708-12116730 TGCCCCACTGGAAGGTCCTCAGG + Intronic
1144312102 17:14023388-14023410 TGTCCCACCGGAAGGTCTTCAGG - Intergenic
1144332658 17:14237931-14237953 TGTCCCACCGGAAGGTCTTCAGG + Intergenic
1144370108 17:14582210-14582232 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1145085524 17:19935727-19935749 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1145735384 17:27226370-27226392 TGTCCCACTGGGAGATCTTCGGG - Intergenic
1145786906 17:27599973-27599995 TGTCCCACCGGAAGGTCTTCGGG + Intronic
1145820889 17:27834387-27834409 TGTCCCACTGGAAGGTCTTTGGG + Intronic
1146643536 17:34559984-34560006 TGTTGCACTGGAAGGTCTTCAGG - Intergenic
1146662098 17:34671576-34671598 GGTCACACTGTAGGGTTTTGTGG - Intergenic
1146702974 17:34978261-34978283 TGTCCTACTGGAAGGCCTTCAGG + Intronic
1147683137 17:42267379-42267401 TGTTCCACTGAAAGGTCTTCAGG - Intronic
1148223197 17:45879592-45879614 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1148824579 17:50383011-50383033 GGACCCACTGGAGGATCTCATGG + Exonic
1148849356 17:50547334-50547356 GGGCCCAGTGGAGGGTCTTCCGG + Intronic
1148911891 17:50947275-50947297 GGACCTCCTGGAGGGTCTGCAGG + Intergenic
1148920528 17:51027940-51027962 TGTCCCACTGGAAAGTTTTCAGG - Intronic
1149889525 17:60374278-60374300 TGTCCCACTGGAAAGTCTTCAGG + Intronic
1150011026 17:61503862-61503884 TGTCCCACTGGAAGGTCCTCAGG + Intergenic
1150120041 17:62593636-62593658 TGTCCCACTGGAAGCTCTTCAGG + Intronic
1150607157 17:66703367-66703389 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1150683099 17:67298911-67298933 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1150867833 17:68872671-68872693 TGTCCCACTGGAAGGTCTTCGGG - Intronic
1151059048 17:71069888-71069910 TGTCCCACTAGAAGGTCTTCAGG + Intergenic
1151141957 17:72001947-72001969 TGTCCCACTGGAAGCTCTTCAGG + Intergenic
1151575083 17:74949143-74949165 GGTGGCACTGGAGGGGCTGCAGG + Intronic
1152195664 17:78916743-78916765 GGTCCCACTGCCGGGCCTCCAGG + Intronic
1153084002 18:1262209-1262231 TGTCTCACTGGAAGGTGTTCAGG + Intergenic
1153198368 18:2625247-2625269 TGGTCCTCTGGAGGGTCTTCTGG - Intergenic
1153198635 18:2627244-2627266 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1153470124 18:5434936-5434958 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1153566557 18:6424745-6424767 TGTCCCACTTGAAGGTCTTCAGG - Intergenic
1153692866 18:7610954-7610976 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1153728532 18:7982401-7982423 TCTCCCACTGGAAGGTCTTCAGG + Intronic
1153885092 18:9457388-9457410 TGGCCCTCTGGGGGGTCTTCTGG + Intergenic
1153955704 18:10093995-10094017 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1154153213 18:11923695-11923717 TGTCTCACTATAGGGTCTTCAGG - Intergenic
1154494062 18:14942995-14943017 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1154969198 18:21390401-21390423 TGTCCTACTGGAAGGTCTTCAGG - Intronic
1155410383 18:25538026-25538048 TGTCCCACAGGAAGGTTTTCAGG + Intergenic
1155623832 18:27812054-27812076 TATTCCACTGGAAGGTCTTCAGG + Intergenic
1155632920 18:27915966-27915988 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1155663980 18:28284816-28284838 TGTCCCAGTGGAAGGTCTTCAGG + Intergenic
1155694075 18:28662753-28662775 TGTCCCACTGGAAAGGCTTCAGG + Intergenic
1155822913 18:30400759-30400781 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
1156249761 18:35341603-35341625 TGTCCCACTGGAAGGTTTTCAGG - Intronic
1156517187 18:37690328-37690350 TGTCCTACTGGGAGGTCTTCAGG - Intergenic
1156615071 18:38773140-38773162 TGTTCCACTGGAAGGTCTTCAGG + Intergenic
1156974526 18:43202762-43202784 TGTCCCACTGGAGGGTCTTCAGG + Intergenic
1157129110 18:44986737-44986759 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1157717387 18:49897311-49897333 TGTTCCACTGGAAGGTCTTCAGG - Intronic
1157890858 18:51416357-51416379 TGTCCCACTAGAAGGTGTTCAGG + Intergenic
1157987947 18:52461258-52461280 CTTCCCATTGGAAGGTCTTCAGG + Intronic
1158158576 18:54453819-54453841 TGTTCCACTGGAAGGTCTTCAGG + Intergenic
1158185909 18:54770984-54771006 TGTTAAACTGGAGGGTCTTCAGG + Intronic
1158889625 18:61860787-61860809 TGTCCCATTGGAAGGTCTTCAGG - Intronic
1159187223 18:64990783-64990805 TGTCCCACTGGAAGGTCTTTGGG - Intergenic
1159273074 18:66178579-66178601 TGTGTCACTGGAAGGTCTTCAGG + Intergenic
1159308153 18:66672576-66672598 TGTCCCACTGGATGGTCTTTTGG - Intergenic
1159389208 18:67766575-67766597 TGTCCCAGTGGAAGGTCTTCAGG + Intergenic
1159394830 18:67842763-67842785 TGTCTCACTGCAGGTTCTTCAGG + Intergenic
1159705233 18:71677948-71677970 CGTCCCAGTGGAGGGTCTTCCGG - Intergenic
1159870272 18:73753503-73753525 TGTCCCACTGGAAAGTCTTCAGG - Intergenic
1159898977 18:74024639-74024661 TGTCCCACAGGAAGGTCTTCAGG + Intergenic
1159932422 18:74327296-74327318 GGCTCCACAGGAAGGTCTTCAGG + Intronic
1159978517 18:74746667-74746689 TGTCTCAGTGGAAGGTCTTCAGG + Intronic
1160097214 18:75885439-75885461 TGTCCCACAGGAAGGTCTTCAGG - Intergenic
1160151386 18:76397124-76397146 GGTGCCTCTGGAGGGGCTTGTGG - Intronic
1160368037 18:78346082-78346104 TGTTCCACTGGAAGGTCTTCAGG + Intergenic
1160368143 18:78347102-78347124 TGTCCCACTGGAAGATCTTCAGG + Intergenic
1160918739 19:1510162-1510184 GCACCCACTGGTAGGTCTTCTGG + Exonic
1161134127 19:2609790-2609812 GGTCCCACTGGATTGTCCTACGG - Intronic
1161957382 19:7504125-7504147 AGTCCCACTTGAGGGTGTTGGGG - Exonic
1162905849 19:13823448-13823470 GTTCACACTGGCGGGTCTCCAGG - Exonic
1163081645 19:14948154-14948176 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1163403665 19:17109635-17109657 GGTCCCTCTGGAGGCTCTGAGGG + Intronic
1163875011 19:19860755-19860777 GGGACCACGGGAGGGTCCTCAGG - Intergenic
1163969297 19:20776716-20776738 GGGACCACCGGAGGGTCTTCAGG + Intronic
1164005268 19:21142475-21142497 GGGACCACGGGAGGGTCTTCAGG + Intronic
1164017940 19:21269463-21269485 GGGACCACGGGAGGGTCATCAGG - Intronic
1164030325 19:21397555-21397577 GGGACCACGGGAGGGTCATCAGG + Intronic
1164070871 19:21767125-21767147 GGGACCACGGGAGGGTCGTCAGG - Intronic
1164077738 19:21835752-21835774 GGGGCCACAGGAGGGTCGTCAGG - Intronic
1164279634 19:23758460-23758482 GGGACCACGGGAGGGTCGTCAGG - Intronic
1164675717 19:30099485-30099507 CATCCCACTGGAAGATCTTCAGG - Intergenic
1165195663 19:34101018-34101040 TGTCTCATTGGAAGGTCTTCAGG - Intergenic
1165200902 19:34144074-34144096 CGGCCCACTAGAAGGTCTTCAGG + Intergenic
1165586414 19:36920088-36920110 GGCCCCACTGGAAGATCTTCAGG - Intronic
1165648266 19:37463742-37463764 TGTTCCACTGGAAGGTCTTCAGG - Intronic
1165699156 19:37924299-37924321 TGTCCCACTGGAAGGTCTTCGGG + Intronic
1166126521 19:40718150-40718172 GGTCCCACTGGCTGGGCCTCAGG - Exonic
1166853975 19:45773259-45773281 GTTCCCACAGGAGGGACTGCTGG - Intronic
1166941635 19:46370418-46370440 TGTCCCACTGGAAGGTCCTCTGG + Intronic
1166985950 19:46660214-46660236 GATCCCAGTGGGGGGTCCTCAGG + Intronic
1167653982 19:50751356-50751378 TATCCCACTGGAAGATCTTCAGG - Intergenic
1167868447 19:52347172-52347194 TGTCCCACTGGAAGGTCCTCAGG - Intronic
1168399161 19:56074078-56074100 TGTCCCCCTAGAAGGTCTTCAGG + Intergenic
1168568824 19:57447346-57447368 TGTCCCACTAGAAGGTTTTCAGG + Intronic
925140584 2:1547315-1547337 GCTCCCTCTGGAGGCTCTTCGGG + Intergenic
925619980 2:5782561-5782583 TGTCCCACTGGAAGGTCTTTAGG - Intergenic
925630078 2:5882929-5882951 TGTCCCATTGGAAGGTTTTCAGG - Intergenic
925669838 2:6299795-6299817 TGTCCCACCAGAAGGTCTTCAGG - Intergenic
925915836 2:8605114-8605136 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
925959320 2:9001078-9001100 TGTCCCACTGAAAGGTCTTCAGG + Intronic
926303880 2:11623482-11623504 TGTCCCACTAGAAGGTCTTCAGG - Intronic
926652384 2:15360778-15360800 TGTCCCACTGGAAGGCCTTCGGG + Intronic
927422283 2:22946042-22946064 TGTCCCATTGGAAGGACTTCAGG + Intergenic
927451783 2:23215082-23215104 GGTCCCATAGGAGGGGCTTGTGG + Intergenic
927585774 2:24303274-24303296 TGTCTCACTGGAAGGTGTTCGGG - Intronic
928221977 2:29411205-29411227 TGTCCCACTGGAAGGTCTTCAGG + Intronic
928736877 2:34301349-34301371 TGTCCCACTGGAAGGTGTTCAGG + Intergenic
928793383 2:34985920-34985942 TGTCCCACTGGAAGGTCTTTAGG + Intergenic
928842455 2:35626531-35626553 TATCCCATTGGAAGGTCTTCAGG + Intergenic
928874501 2:36021709-36021731 TGTCCCACTGGGAGGTGTTCAGG - Intergenic
928956162 2:36870854-36870876 TGTCCCACTAGAAGGTCTTCAGG - Intronic
929240079 2:39645225-39645247 TGTCCCCTTGGAAGGTCTTCAGG + Intergenic
929514322 2:42592706-42592728 TGTCCCACTGGAAGGTCTTCAGG + Intronic
929792176 2:45031439-45031461 GGTCCCACTGGAGGCTGGTGAGG - Intergenic
930144575 2:47988570-47988592 TGTCTCCCTGGAAGGTCTTCAGG - Intergenic
930181468 2:48363146-48363168 TGTCCCACTGGAAGGTCTTTAGG - Intronic
930182816 2:48381804-48381826 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
930535452 2:52640228-52640250 TGTCCCACTGAAAGGTCTTCGGG - Intergenic
930892796 2:56410732-56410754 TGTCCCAGTGGAAGGGCTTCAGG + Intergenic
931024749 2:58098002-58098024 CATCCCCCTGGAAGGTCTTCAGG - Intronic
931193304 2:60026395-60026417 TGTCCCACCGGAAAGTCTTCAGG + Intergenic
931423256 2:62147432-62147454 TGTCCCACTGGACGGTCTCCAGG - Intergenic
931898406 2:66760217-66760239 TGTCCCATTGGAAGGTCTTCAGG - Intergenic
932444817 2:71772301-71772323 TGTCCCACTGGAAGGTCTACAGG - Intergenic
932585738 2:73027175-73027197 TTTCCCACTGGAAAGTCTTCAGG - Intronic
932690722 2:73911032-73911054 TGGCCCACTGGAAGGTCTTCAGG + Intronic
933120783 2:78534885-78534907 TGTCCCACTGGAAGGTCCTCAGG - Intergenic
933410110 2:81914913-81914935 TGTCCCACTGGTAGATCTTCAGG + Intergenic
933433636 2:82216276-82216298 TGCCCCACTAGAAGGTCTTCAGG + Intergenic
934029624 2:88031200-88031222 TGTCCCACTGGGGGGTCTTCAGG - Intronic
934300193 2:91772285-91772307 GGGCTCACTGGAGGGGCTTGTGG + Intergenic
934486002 2:94711525-94711547 CGTCCCACTGGAAGGTCTTCAGG + Intergenic
934864804 2:97798019-97798041 GGACCAGCTGAAGGGTCTTCAGG + Intronic
934962784 2:98691809-98691831 TGTCCCACTGGAAGGCCTTCAGG - Intronic
935080481 2:99788345-99788367 TGTCCCACTGGGAGGTCTTCAGG - Intronic
935178041 2:100666397-100666419 TGTCCCACTGAAACGTCTTCAGG - Intergenic
935423603 2:102896122-102896144 TGTTCCACTGGAGGGTCTTCAGG - Intergenic
935441346 2:103100418-103100440 TGTCCCATTAAAGGGTCTTCAGG + Intergenic
935611917 2:105034818-105034840 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
935644410 2:105322054-105322076 TGTCCCACTGGAAGGTCTTCGGG - Intronic
935716239 2:105941584-105941606 TGTCCCACTGGAAGGTCTTGAGG + Intergenic
935818666 2:106871725-106871747 TGTCCCACTGGAAGGTCTTCAGG + Intronic
935866291 2:107391265-107391287 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
936000559 2:108824478-108824500 TGTTCCACTGGAAGGTCTTCGGG + Intronic
936143538 2:109962673-109962695 CATCCCACTGGAAGGTCTTCAGG + Intergenic
936180221 2:110260636-110260658 CGTCCCACTGGAAGGTCTTCAGG + Intergenic
936201150 2:110408793-110408815 CATCCCACTGGAAGGTCTTCAGG - Intronic
936233999 2:110727714-110727736 TGTCTCACTAGAGGGTCTTTGGG + Intergenic
936289090 2:111205314-111205336 CGTCCCACTGGAGGGTCTTCAGG - Intergenic
936579559 2:113685983-113686005 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
936933662 2:117816499-117816521 TGTCCCACTGGAAGATCTTCAGG + Intronic
937580196 2:123475685-123475707 TGTCCCACTGATAGGTCTTCAGG - Intergenic
937733813 2:125265357-125265379 TCTCCCACTGGAAGGTCTTCAGG - Intergenic
937824219 2:126347728-126347750 GTCCCCGCTGGAAGGTCTTCAGG + Intergenic
938119134 2:128621535-128621557 GCTCCAGCTGAAGGGTCTTCAGG + Intergenic
938813546 2:134876538-134876560 TGTCCCACTGGAAGGTCTTCGGG + Intronic
939042528 2:137208226-137208248 GGCTCCAGTGGAAGGTCTTCAGG - Intronic
939075768 2:137600859-137600881 TGTCCTACTAGAAGGTCTTCAGG - Intronic
939144199 2:138392664-138392686 TGTCTCACTGGAAGGTCTTCAGG - Intergenic
939330215 2:140749613-140749635 TGTCCCACTGGAAGGTCTTCAGG + Intronic
939464138 2:142535514-142535536 TGTCCCAGTGGAAGGTCTTCAGG - Intergenic
939975541 2:148713235-148713257 TGTCCCACTGGAAGCTCTTTAGG - Intronic
940023003 2:149175839-149175861 TGTCCCACTGGAAGGTCTTCAGG + Intronic
940038607 2:149335247-149335269 TGTCCCACTGGAAGGTCTTCAGG - Intronic
940202856 2:151170344-151170366 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
940697576 2:156998714-156998736 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
941074873 2:160995516-160995538 TGGCCCATTGGAAGGTCTTCAGG - Intergenic
941250741 2:163158701-163158723 TGTCCCATTGGAAGGTCCTCAGG + Intergenic
941416722 2:165230501-165230523 GGACCCAGTGGAGGGTTCTCAGG - Intergenic
941549424 2:166896362-166896384 TGTCCCACTGGAAGGTTTTCAGG - Intronic
942049161 2:172122614-172122636 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
942151441 2:173079772-173079794 TGGCTCACTGGAAGGTCTTCAGG + Intronic
942264819 2:174212805-174212827 TGTCCCACTGGAAGGTCTTCAGG + Intronic
942266915 2:174237290-174237312 TGTCCCACAGGAAGGTTTTCAGG + Intronic
942493497 2:176513708-176513730 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
942819163 2:180090593-180090615 TATCCCACTGGAAGGTCTTCAGG - Intergenic
942872738 2:180754987-180755009 TGTTCCACTGGAAGGTTTTCAGG + Intergenic
942913355 2:181272757-181272779 TGTCCCCCTGGAAGGTCTTCAGG - Intergenic
943292268 2:186089196-186089218 TGTTCCACTGGAAGGTCTTTAGG + Intergenic
943346184 2:186739600-186739622 TGTCCTACTGGAAGGTCTTCAGG + Intronic
943404047 2:187457029-187457051 TGTCCTACTGGAAGGTCTTCAGG + Intergenic
943563277 2:189488598-189488620 AGTCCCCCTGGAAGGTCTTCAGG - Intergenic
943741979 2:191419664-191419686 TGTCCCACTGGAAAGTCTTCAGG - Intronic
943769305 2:191697885-191697907 TGTCCCACTGGAAGGTCTTGAGG + Intergenic
944009894 2:194962049-194962071 TCTCCCACTGGAAGGTCTTCAGG - Intergenic
944034462 2:195277042-195277064 TGTCCCACTGGTAGATCTTCAGG - Intergenic
944037958 2:195319673-195319695 TGTCCCAGTGGAAGGTCTTCAGG + Intergenic
944317516 2:198299083-198299105 TCTCCCACTGGAAGGTCTTCAGG - Intronic
944329567 2:198449573-198449595 TGTCCCACTGGAAGGTCTACAGG - Intronic
944879433 2:203996547-203996569 TGTCCCACCGGAAGGTCTTCAGG + Intergenic
944986109 2:205179012-205179034 TATCCCACTGGAAGGTCTTCAGG - Intronic
945197248 2:207248434-207248456 TATCCCACTGAAAGGTCTTCAGG - Intergenic
945433081 2:209787958-209787980 TGTCCCAAAGGAAGGTCTTCAGG - Intronic
945758010 2:213874509-213874531 TGTCCCACTGGAAGTTCTTCAGG + Intronic
946050171 2:216855788-216855810 GGTCCCACCCAAGGGTCATCCGG + Intergenic
946175304 2:217918859-217918881 GAGCCCAGTGGAGGGTCATCTGG - Intronic
946385136 2:219379348-219379370 TGTCTCACTGGAAGGTCTTCAGG - Intronic
946816409 2:223582974-223582996 TGTACCACTGGAAGGTCTTCAGG - Intergenic
947038135 2:225883393-225883415 TATCCCACTGGAAGGTCTTCAGG - Intergenic
947410008 2:229827593-229827615 TGTCCCACTGGAAGGTCTTCAGG + Intronic
947550785 2:231044779-231044801 TGTCCCACTGGAAGGTCTTCAGG + Intronic
947861648 2:233363206-233363228 TATCCCACTGGAAGGTCTTCAGG - Intronic
947980772 2:234407488-234407510 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
948259329 2:236591189-236591211 GGTTCTTCTGGAGGGTCTGCGGG + Intergenic
948336848 2:237215550-237215572 TGTTCCATTGGAAGGTCTTCAGG - Intergenic
948627536 2:239278244-239278266 ACTGCCACTGGAGGGTCCTCAGG - Intronic
948724638 2:239926723-239926745 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1168792375 20:588051-588073 CGTTCCACTGGAAGGTTTTCAGG + Intergenic
1168936064 20:1666001-1666023 TGTCCCACTGGAAGGCCTTCAGG - Intergenic
1169057884 20:2638601-2638623 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1169685258 20:8264256-8264278 TGTCCCACTGGAAGGTCTGCAGG + Intronic
1170120337 20:12904758-12904780 TGTCCTGCTGGAAGGTCTTCAGG - Intergenic
1170334844 20:15257916-15257938 TGTCCCACTGGGAGGTCTTCAGG - Intronic
1170381794 20:15768934-15768956 TGTCTCACTGGAAGGTCTTCAGG + Intronic
1170454409 20:16518954-16518976 GATGCCACTGGAAGGTCTTAAGG - Intronic
1170515454 20:17125116-17125138 TGTCCCACTGGAAGGTTTTTAGG + Intergenic
1172738300 20:37145693-37145715 TGCCCCACTGGAAGGTATTCAGG + Intronic
1173288505 20:41693825-41693847 GTTACCAGTGGAGGGTGTTCAGG + Intergenic
1173713920 20:45184680-45184702 TGCCACACTGGAAGGTCTTCGGG + Intergenic
1174320696 20:49739395-49739417 GGGCCCACTGGAGCGGCATCTGG + Intergenic
1174491126 20:50896683-50896705 TGTCCCACTGGAGGGTCTTCAGG + Intronic
1174491456 20:50899667-50899689 TGTCTCACTGGAAGGTTTTCAGG - Intronic
1174884488 20:54317444-54317466 TGTCCCACTAGAAGGTCTTCAGG + Intergenic
1174943404 20:54957185-54957207 TGTCCCACAGGAAGGTCTTCAGG + Intergenic
1175283857 20:57823813-57823835 TGTCTCACTAGAAGGTCTTCTGG + Intergenic
1175301288 20:57944811-57944833 TGTCCCACTGGAAGGTCTTCGGG + Intergenic
1175436699 20:58957290-58957312 TGTCTCACTGGAAGGTCTTTGGG + Intergenic
1175549417 20:59807385-59807407 TGTCCCACTGGAAGATCTTCAGG + Intronic
1175652979 20:60744211-60744233 TGTCCCATTGGAAGGTTTTCAGG - Intergenic
1176068008 20:63209809-63209831 TGCCCCACTGGAAGGTATTCAGG + Intronic
1176119544 20:63448008-63448030 GTTCCCGCGGCAGGGTCTTCGGG - Intronic
1176204619 20:63881564-63881586 GGTCCCAATGATGGGCCTTCCGG - Intronic
1176307831 21:5133445-5133467 GGTGCCGCTGGATGCTCTTCTGG + Exonic
1176675033 21:9769879-9769901 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1176713979 21:10333840-10333862 TGTCCCAGTGAAAGGTCTTCAGG - Intergenic
1177443446 21:21158994-21159016 TACCCCACTGAAGGGTCTTCAGG - Intronic
1177447767 21:21219809-21219831 TGTCCCACTGGAAAGTCTTCAGG - Intronic
1177572271 21:22902606-22902628 TGTCCCACTGCAAGATCTTCAGG - Intergenic
1177664381 21:24134832-24134854 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1178458240 21:32776093-32776115 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1179115220 21:38485119-38485141 TGTGCCACTGGAAGGTCTGCAGG - Intronic
1179196915 21:39172640-39172662 TGTCCCGCTAGAAGGTCTTCAGG + Intergenic
1179410325 21:41157475-41157497 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1179580688 21:42341968-42341990 CGTCCCACTGGAAGGTCTTCAGG + Intergenic
1179594853 21:42436672-42436694 GGTTTCAGTGGAGGCTCTTCTGG - Intronic
1179849230 21:44128585-44128607 GGTGCCGCTGGATGCTCTTCTGG - Exonic
1179891157 21:44335682-44335704 GGTCCCACTGGAGGGACGTGAGG + Intronic
1180129307 21:45816625-45816647 TGTCCCGCTGGAAGGTCCTCAGG + Intronic
1180174044 21:46078932-46078954 GGTCCCACAGCAGGGTCACCCGG + Intergenic
1180176885 21:46095142-46095164 GCGGCCACTGGATGGTCTTCTGG + Intergenic
1180918675 22:19506984-19507006 GGTCCCAGTGGAGGGCTCTCCGG + Intronic
1182163632 22:28149642-28149664 TGTCCCACCAGATGGTCTTCAGG + Intronic
1182620288 22:31614993-31615015 GGTCCCAGAGGAGGGTCCTGTGG + Intronic
1182675761 22:32038240-32038262 TGCCCCACTGAAAGGTCTTCAGG - Intergenic
1182869221 22:33631564-33631586 TGTCCCACTGGAAGGTCCTCAGG + Intronic
1183593057 22:38792701-38792723 TGTCCCGCTGGACGGTCTTCAGG + Intronic
1184082222 22:42230717-42230739 TGGCCCACTGGAAGGTCTTTAGG - Intronic
1184172852 22:42769661-42769683 GGTCCCACAGGAGCGTCCACTGG + Intergenic
1184803765 22:46778567-46778589 TGCCCCAGTGGAAGGTCTTCGGG + Intronic
1184824389 22:46937704-46937726 TGTCCCACTGGAAGGTCTTCAGG - Intronic
949132220 3:517401-517423 TGCCCCACTGGAAGGTCTCCCGG - Intergenic
949252173 3:1998632-1998654 TATCCCACTGGAAGGTCTTCAGG + Intergenic
949255750 3:2043930-2043952 TGTCCTACTGGAAGGTCTTCGGG + Intergenic
950245692 3:11415670-11415692 TGACCCACTGGAAGGTCTTCAGG + Intronic
950271528 3:11619938-11619960 GGTCACACTGGAGACTTTTCAGG + Intronic
950277892 3:11679239-11679261 TGTCCCACTGGAAGGTCTTCAGG - Intronic
950679187 3:14573370-14573392 GGTCCCGCGGGATGGTCATCTGG + Intergenic
950759487 3:15207742-15207764 TGTCCCACTGGGAGGTCTTCAGG + Intronic
950973348 3:17212613-17212635 TGTCCCCCTGGAGGGTCTTTGGG - Intronic
951213652 3:20003295-20003317 TGTCCCACTGGAAGGTCTTCAGG - Intronic
951244700 3:20327164-20327186 TGTCTCACTGGAAGGTCTTTTGG + Intergenic
951475157 3:23097217-23097239 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
951527381 3:23666685-23666707 CGTCCCACTGGAAGGTTTTCAGG + Intergenic
951561694 3:23973952-23973974 TGTTCTACTGGAAGGTCTTCAGG + Intronic
951825592 3:26864894-26864916 TTTCTCACTGGAGGGTTTTCAGG - Intergenic
951999072 3:28764137-28764159 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
952084772 3:29805516-29805538 TGTCCAACTGGAAGATCTTCAGG - Intronic
952114280 3:30160380-30160402 TCTTCCACTGGAAGGTCTTCAGG - Intergenic
952178918 3:30897041-30897063 TGTCGCGCTGGAAGGTCTTCAGG + Intergenic
952975376 3:38689996-38690018 CGTCCCACTGGAAGGTCTTAGGG - Intergenic
953066560 3:39477721-39477743 CATCCCACTGGAAGTTCTTCAGG - Intronic
953223383 3:40995148-40995170 TGTTCCACTGGTAGGTCTTCGGG + Intergenic
953412826 3:42699800-42699822 GGGCCCACAGGAAGGCCTTCCGG - Exonic
953687759 3:45091470-45091492 GGTCCCAGTTGGGGGTCCTCAGG + Exonic
953819799 3:46196780-46196802 TTTCCCACTGGAAGGCCTTCAGG - Intronic
953993240 3:47499861-47499883 GGTCCCACTGCAGCTTCTCCTGG - Intronic
954174172 3:48830325-48830347 TGTACCACTGGAAGGTCTTTAGG + Intronic
954585037 3:51726535-51726557 TGTCCCACTGGAAGGTCGTCAGG - Intergenic
954772716 3:52987096-52987118 TGTCCCACTGGAAGATCTTCGGG + Intronic
954975847 3:54693665-54693687 TGTCCCACTGGAAGGTCTTCAGG - Intronic
955070316 3:55567461-55567483 GATTCCACTGGAGGGTTTTTAGG + Intronic
955138448 3:56244503-56244525 GATCCCACTGGAAGGTCTTCAGG - Intronic
955232905 3:57114610-57114632 GGTCCCACATGATGGTCTCCAGG - Intronic
955308259 3:57856546-57856568 TATCCCACTGAAAGGTCTTCAGG + Intronic
955371715 3:58357377-58357399 TGTCCCACTGGAAGGTCTTCTGG + Intronic
955540148 3:59967132-59967154 TGTCCCACTGAAAGGCCTTCAGG + Intronic
955578307 3:60390605-60390627 TGTCCCACTGGAAGGTCTTTAGG - Intronic
956247079 3:67195915-67195937 TGTCCCACTGGAAGGCCTTCAGG - Intergenic
956896055 3:73661091-73661113 CGTCTCACTGGAAGGTCTTCAGG + Intergenic
956996745 3:74834503-74834525 TGTCCCACTGGAAGGTCCTCAGG + Intergenic
957268409 3:77997656-77997678 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
957275587 3:78087029-78087051 TGTCCCACTGGAAGGTATTCAGG + Intergenic
957439624 3:80226989-80227011 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
957460487 3:80512078-80512100 TGTCCCACTGGAAGCTCTTCAGG - Intergenic
957474705 3:80708408-80708430 TGTCCCACTGGAAGGTCTCCAGG + Intergenic
957552506 3:81725398-81725420 TGTCCCACTGGAAGGTCTTCAGG + Intronic
957592148 3:82213156-82213178 TGTCCCATTGGAAGATCTTCAGG - Intergenic
957638126 3:82814078-82814100 TGTCCCAAGGGAAGGTCTTCAGG + Intergenic
957701526 3:83721699-83721721 TGTCCCACTGGAAGTTCTTCAGG + Intergenic
957820743 3:85370813-85370835 TGTCCCAGTGGAAAGTCTTCAGG - Intronic
958168041 3:89902467-89902489 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
958437198 3:94111702-94111724 TATCCCACTGGAAGGTCTTCAGG + Intronic
958596132 3:96226188-96226210 TTTCTCACTGGAAGGTCTTCAGG - Intergenic
958647826 3:96895158-96895180 TGTCCCACTGAAAGGTCTTCAGG - Intronic
958693611 3:97500200-97500222 TGTCACACTGGAAGGTCTTTTGG + Intronic
958761542 3:98315016-98315038 TGTGCCACTGGAAGGTCTTTAGG - Intergenic
958882941 3:99693421-99693443 TGTCCCACTGGAAGAACTTCAGG - Intronic
958982644 3:100741277-100741299 TGTCCCACTGGAAGGTCTTCAGG - Intronic
959184041 3:103021576-103021598 TGTCTCACTGGAAGGTCTTCAGG - Intergenic
959204661 3:103290558-103290580 TGTCCCACTGGAAGATCGTCAGG - Intergenic
959272011 3:104223682-104223704 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
959340198 3:105119475-105119497 TGTCCAACTGGAAGGTTTTCAGG - Intergenic
959386841 3:105719845-105719867 TGTCCCACTGGAAGGTCTTCAGG - Intronic
959569931 3:107872429-107872451 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
959636005 3:108571086-108571108 TGTCCCACTGGAAGGTCTTCAGG + Intronic
959652581 3:108765648-108765670 TATCCCACTGGAAGGTCTTCAGG + Intergenic
960129496 3:114039613-114039635 TGTCTCACTAGAAGGTCTTCAGG - Intronic
960135922 3:114104920-114104942 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
960206646 3:114909151-114909173 TGTCCCACTGGAAGGTCTTCTGG - Intronic
960458814 3:117907411-117907433 TGTCCCACTGGAAAGTCTTCAGG - Intergenic
960601735 3:119465620-119465642 TGTCCCTCTGGAAGATCTTCAGG - Intronic
961035342 3:123637985-123638007 GGTTCCACAGGAGGGTCCCCAGG - Intronic
961098652 3:124179383-124179405 TGTCTCACTGGAAGGTCTTCAGG + Intronic
962089180 3:132224983-132225005 TGTCCCACTGGAAAGTCTTCAGG - Intronic
962208395 3:133455000-133455022 TGTCCCACTGAAAGGTCTTCAGG + Intronic
962290975 3:134136098-134136120 GGACCCACTGCAGGCTCCTCAGG - Intronic
962441409 3:135421293-135421315 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
962567482 3:136676972-136676994 TGTCCCACTGGAAATTCTTCAGG + Intronic
962700193 3:137990539-137990561 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
962828013 3:139116580-139116602 TGTCCCACTGGAAGGTCTTCAGG + Intronic
962885592 3:139623321-139623343 TGTCCCACTAGAAGGTCTGCAGG + Intronic
962914703 3:139889684-139889706 TGTTCCACTAGAAGGTCTTCAGG - Intergenic
963024335 3:140903806-140903828 TGTCCCACAGGAAGGTGTTCAGG + Intergenic
963134992 3:141894679-141894701 TGCCCCACTGGAAGGTCTTCAGG + Intronic
963144552 3:141979501-141979523 TGTCCTACTGGAAGGTCTTCAGG - Intronic
963216035 3:142749489-142749511 TGTCCCAATGGAAGGTCTTCAGG - Intronic
963493909 3:146035856-146035878 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
963886533 3:150588978-150589000 TGTCTCACTGGAAGGTGTTCAGG - Intronic
964127726 3:153253558-153253580 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
964147160 3:153478406-153478428 TGTCCCACTGGAAGGTTTTCAGG + Intergenic
964201940 3:154127485-154127507 TGTCCCACAAGAAGGTCTTCAGG + Intronic
964368992 3:155979824-155979846 TTTCCCACTGGAAGGTCTTCAGG + Intergenic
964592611 3:158382191-158382213 TGTCCCATTGGAAGATCTTCAGG + Intronic
964593986 3:158400524-158400546 TGTCCCACTGGAAGGTCTTCAGG - Intronic
964780647 3:160333654-160333676 TGTCCCACTGGAAGGTCTTCAGG + Intronic
964849861 3:161083735-161083757 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
965011973 3:163106140-163106162 CATCCCACTGAAAGGTCTTCAGG + Intergenic
965055175 3:163702046-163702068 GGTCCCACTGGAAGGTCTTCAGG - Intergenic
965258457 3:166446898-166446920 TGTGTCACTGGAAGGTCTTCAGG + Intergenic
965364986 3:167787160-167787182 TATCCCACTAGATGGTCTTCAGG + Intronic
965555510 3:170014193-170014215 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
965990602 3:174812667-174812689 TGTCTCACTGGAATGTCTTCAGG - Intronic
966025035 3:175268815-175268837 TGTCCCACTGGAAGTTTTTCAGG + Intronic
966110428 3:176394608-176394630 TGTCCCACTGGGAGGTTTTCAGG + Intergenic
966161465 3:176973271-176973293 TGTCCCATTGGAAGGTCTTCGGG + Intergenic
966343239 3:178949140-178949162 TTTCCCACTGAAAGGTCTTCAGG + Intergenic
966418266 3:179711671-179711693 TGTCCCACTGGAAAGTCTTCTGG + Intronic
966438485 3:179917217-179917239 TGTCCCACTGGAAAGTCTTCTGG + Intronic
966499073 3:180617496-180617518 TGTCCCACTTGAAGGTCTTCAGG - Intronic
967127705 3:186439912-186439934 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
967250984 3:187537862-187537884 TGTCCCGCTGGAAGGTCTTCAGG + Intergenic
968057055 3:195699776-195699798 TGTCTCTCTGGAAGGTCTTCAGG + Intergenic
969057538 4:4411393-4411415 TGTCCCACTGGAAGGTCTTCAGG + Intronic
969925395 4:10580509-10580531 TGTCCTACTAGAAGGTCTTCAGG - Intronic
969928325 4:10606311-10606333 TGTCCCACTGGAAGGTCGTCAGG + Intronic
970424120 4:15930725-15930747 GTACCCACAGGAGGGTCTCCAGG + Intergenic
970634903 4:17998553-17998575 TGTCCCACTGGAAAATCTTCAGG + Intronic
970673282 4:18419472-18419494 TGTCCAAATGGAAGGTCTTCAGG + Intergenic
970845896 4:20536974-20536996 TGTCCCAGTGGAAGGTCTTCAGG + Intronic
970984266 4:22137516-22137538 TGTTCCACTGGAAGATCTTCAGG + Intergenic
971001990 4:22333650-22333672 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
971047677 4:22823598-22823620 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
971383675 4:26123823-26123845 TGTTCCACTGGAAGGTCTTCAGG + Intergenic
971653110 4:29305071-29305093 TGTCCCACTAGAGGGTCTTTAGG - Intergenic
971822969 4:31583068-31583090 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
971965232 4:33545899-33545921 TGTCCCACTGGAAAGTCTTCAGG - Intergenic
972001369 4:34039554-34039576 TGTCCTACTGGAAGGTCTTCAGG + Intergenic
972030320 4:34448552-34448574 TCACCCACTGGAAGGTCTTCAGG - Intergenic
972187683 4:36551400-36551422 GGCTCCAGAGGAGGGTCTTCAGG - Intergenic
972680032 4:41296499-41296521 TGTCTCACTGGAAGGTCTTCAGG - Intergenic
972748624 4:41966615-41966637 GGTTCCACTGGAAGGTCTTCAGG - Intergenic
973086680 4:46071612-46071634 TGTCCCACTAGAAGGTCTTCAGG - Intronic
973286892 4:48428523-48428545 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
973561981 4:52146094-52146116 TGTCCTACTGGAAGGTTTTCAGG - Intergenic
973576345 4:52293525-52293547 GGTCTCACTGGAAGGTCTTCAGG + Intergenic
973900856 4:55469506-55469528 TGTCCCATTGGAGGGTCTTCAGG - Intronic
974191172 4:58505457-58505479 TTTCTCACTGGAAGGTCTTCAGG + Intergenic
974195128 4:58564373-58564395 TGACCCACTGGAGGGTCTTCAGG + Intergenic
974204681 4:58686060-58686082 TGTCCCAGTGGAAGGTCTTCAGG - Intergenic
974362803 4:60903813-60903835 TGTCCCACTGGACAGTCTTCAGG - Intergenic
974516352 4:62918238-62918260 TGTCCCATTGGAAGGTCTTCAGG + Intergenic
974858006 4:67483659-67483681 TGTCCCACTGTAAGGTCTTTGGG - Intronic
975200781 4:71585876-71585898 TGTCCCACTAGAAGATCTTCAGG - Intergenic
975545110 4:75552366-75552388 TGTTCCACTGGAAGATCTTCAGG + Intergenic
975564710 4:75741988-75742010 TGTTCCACTGGAAGGTCTTCAGG + Intronic
975601883 4:76109359-76109381 TGTTCCACTGGAAGGTCTTCAGG + Intronic
975663782 4:76713445-76713467 TGTCCCTCTGGAAGGTCTGCAGG + Intronic
975725086 4:77284120-77284142 GGTCCTACTCTAGGGTCTTCTGG + Intronic
976002905 4:80393007-80393029 CATCCCACTGGAAAGTCTTCAGG - Intronic
976394562 4:84542291-84542313 TGTCCCACTGGAAGGATTTCAGG + Intergenic
976423753 4:84875819-84875841 TGTCTCACTGGAAGGTCTTCAGG + Intronic
976459882 4:85297924-85297946 TGTCCCAGTGGAAGTTCTTCAGG + Intergenic
976834352 4:89353657-89353679 TGTCCCACCAGAAGGTCTTCAGG + Intergenic
976896141 4:90114671-90114693 TCTCCCACTGGAAGGTCTTCAGG + Intergenic
977263821 4:94831110-94831132 TGTCCCACTAGAAGGTCTTCAGG - Intronic
977661528 4:99592662-99592684 TGTCTCACTGAAAGGTCTTCAGG + Intronic
977676347 4:99752196-99752218 TGTCCCACTGGAAGGTCTTTGGG + Intergenic
977841003 4:101704621-101704643 TGTCTCACTGGAAGGTCTTCAGG + Intronic
977991142 4:103443996-103444018 TGTCCCACTGTATGGTCTTCAGG - Intergenic
978292316 4:107156227-107156249 TGTTTCACTGGAAGGTCTTCAGG - Intronic
978484797 4:109239994-109240016 TGTCTCACTGGAAGGTCTTCAGG + Intronic
978509395 4:109499974-109499996 TGTCTCACTGGAAGGTCTTAAGG - Intronic
978562585 4:110048985-110049007 GGACCCATTGGAGGCTCATCTGG - Exonic
978715471 4:111837528-111837550 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
978824471 4:113004489-113004511 TGCTCCACTGGAAGGTCTTCAGG + Intronic
978854376 4:113376911-113376933 TGTCCCACTGGAAGGTATTCAGG + Intronic
979504037 4:121474261-121474283 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
979681108 4:123460856-123460878 TGTTCCACTGGAAGGTCTTCAGG - Intergenic
979765152 4:124455590-124455612 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
979844034 4:125485532-125485554 TGTCCCAGTGGAAGGTCTTCAGG + Intronic
980139959 4:128902953-128902975 TGTCCCACTGGAAGGTCTTCAGG + Intronic
980158210 4:129132010-129132032 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
980199074 4:129631033-129631055 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
980251765 4:130324942-130324964 TGTCCTACTGGAAGGTTTTCAGG + Intergenic
980408802 4:132388109-132388131 TGTCCTACTGGAATGTCTTCAGG - Intergenic
980515583 4:133854258-133854280 TATCCCTCTGGAAGGTCTTCAGG - Intergenic
980867606 4:138571799-138571821 TGTCCCACTGAAAGGTCTTCAGG + Intergenic
981037014 4:140182198-140182220 TGTCCCACCGGAAGGTCTTCAGG - Intergenic
981125476 4:141101418-141101440 TGTCCCATTGGAAGGTCTTCAGG + Intronic
981186095 4:141805497-141805519 TGTCCCACTAGAAGGTTTTCAGG - Intergenic
981202785 4:142001283-142001305 TGTCCCCCTGGAAGGTCTCCAGG + Intergenic
981296040 4:143132689-143132711 TGTCCCACTGGAAGGTGTTTAGG - Intergenic
981556889 4:146004733-146004755 GGGCCCAGTGGAAGGTCTTTGGG + Intergenic
981674716 4:147328559-147328581 TGTCCAACTGGAAGGTCTCCAGG - Intergenic
981798873 4:148633060-148633082 TGTCCCACTGAAAGGTCTTCAGG + Intergenic
981811312 4:148778880-148778902 TGTTCCACTGGAAGGTCTTCAGG + Intergenic
981914616 4:150020618-150020640 TGTCCCGCTGGAAGGTCTTTAGG + Intergenic
981943184 4:150308627-150308649 TGTCCCACTGGAAGGTCTTCAGG - Intronic
981974011 4:150701183-150701205 TGTCTCACTGGAGGGTCTTTGGG + Intronic
982027869 4:151269941-151269963 TGTCCCACTGGAAGGTGTTCAGG + Intronic
982065547 4:151651421-151651443 GGGACCACTGGATGGTGTTCAGG + Intronic
982082322 4:151802558-151802580 TGTCCCACTGGCAGGTCTTCAGG - Intergenic
982153205 4:152486584-152486606 TGTCTCACTGGAAGGTCTTCAGG + Intronic
982252126 4:153417699-153417721 TGTCCCACAGGAAGGTCTTCAGG + Intergenic
982561602 4:156934864-156934886 TATCCCACTGGAAGGTTTTCAGG + Intronic
982665028 4:158251268-158251290 GGTCCCAAGGGTGGGTCATCAGG - Intronic
982802429 4:159721880-159721902 TGTCCCACTGGAAGTTCTTCCGG + Intergenic
983014006 4:162586859-162586881 TGTCCCACTGGAAGATCTTCAGG + Intergenic
983282084 4:165693766-165693788 TGTCCCATTGGAAGGTCTTTAGG - Intergenic
983366753 4:166800472-166800494 TGTCCCACTGGAAGCTCTTCAGG - Intronic
983474857 4:168201473-168201495 TGTCCCACTGGAAGGTTTTCAGG + Intergenic
983483464 4:168304236-168304258 TGTCCCACTGGAAAGTCTTCAGG - Intronic
984276870 4:177621415-177621437 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
984470404 4:180164075-180164097 TGCCCAACTGGAGGGCCTTCAGG + Intergenic
984787091 4:183577476-183577498 TGTGCCACTGGAAGGTCTTCAGG - Intergenic
984868630 4:184307841-184307863 TGTCCAACTGGAAGGTCTTCAGG + Intergenic
985060686 4:186074911-186074933 TGTCCCACTGGAAGCTCTTTAGG + Intronic
985138066 4:186809238-186809260 TGTCCCACTGGGAGGGCTTCAGG + Intergenic
985235944 4:187874408-187874430 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
985294009 4:188415213-188415235 TGTCCCACGGGAAGGGCTTCAGG - Intergenic
985379156 4:189374016-189374038 GCTCCCACTGGGCGGTCTTAGGG + Intergenic
985385206 4:189438963-189438985 TGTCCCACTGGAGGGTCTTCAGG + Intergenic
985400521 4:189588813-189588835 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
985511048 5:314087-314109 GCTTCCACGGGACGGTCTTCAGG + Intronic
985527220 5:412354-412376 GCCCGCACTAGAGGGTCTTCAGG + Intronic
985796414 5:1965415-1965437 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
986422908 5:7601943-7601965 GTTCCCTCTGGAGGCTCTACGGG + Intronic
986457544 5:7934259-7934281 GTTCCCACTGGAGTGTCTGGTGG + Intergenic
987040023 5:14053594-14053616 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
987725031 5:21687219-21687241 TGTCCCATTGGAAGGTCTTCAGG - Intergenic
987766388 5:22236844-22236866 TGGTCCACTGGAAGGTCTTCAGG + Intronic
987775054 5:22354593-22354615 GGTCATACTGGAGGATCTGCTGG + Intronic
987802466 5:22716707-22716729 TGTCCCACTGGAAGGTCTTCAGG - Intronic
988102853 5:26704723-26704745 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
988135380 5:27164042-27164064 TGGCCCACAGGAAGGTCTTCAGG - Intergenic
988226339 5:28416651-28416673 TGGTCCACTGGAAGGTCTTCAGG + Intergenic
988661493 5:33274830-33274852 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
988791641 5:34613788-34613810 TGCCCCACTGGAAGGTCTTCGGG - Intergenic
988960090 5:36361595-36361617 TGTCCCACTGGAAGGTCATCAGG + Intergenic
989175298 5:38518840-38518862 TGTCCCACTGGAAGGTCTTCGGG - Intronic
989761046 5:45017103-45017125 TGTACCACTGGAAGGTCTTCAGG - Intergenic
989791488 5:45407862-45407884 TGTCCCACTGGAATGTCTTCAGG - Intronic
990053146 5:51533499-51533521 TGCCCCACTGAAAGGTCTTCAGG - Intergenic
990091017 5:52049074-52049096 TGTCCCACTGGAAGGTCTTCAGG - Intronic
990203752 5:53407150-53407172 TGTGCCACTGGAAGGTCTTCAGG - Intergenic
990313541 5:54562864-54562886 TGCCCCACTGGAAGGTCCTCAGG - Intergenic
990480737 5:56208170-56208192 TGTCCCACTGGAAGCTCTTCAGG + Intronic
990520584 5:56575530-56575552 TGTCCCACTGGAAGGCCTTTGGG - Intronic
990667495 5:58090189-58090211 TGTCCCACTGGAAGGTCCTCGGG - Intergenic
990813925 5:59761659-59761681 TGTCCCACTGGAAGCTCTTCTGG + Intronic
990847473 5:60159190-60159212 TGTCCCACTGGAAGGTCTTTAGG + Intronic
991065420 5:62419540-62419562 TGTCTCACTGGAAGGTCTTCGGG + Intronic
991072489 5:62499927-62499949 TGTCCCACTAGAAGGTCTTCTGG + Intronic
991279963 5:64901958-64901980 TGTTCCACTGATGGGTCTTCAGG + Intronic
991375914 5:65966807-65966829 TGTCTGACTGGAAGGTCTTCAGG - Intronic
992057952 5:73011576-73011598 TGTACTACTGGAAGGTCTTCAGG + Intronic
992065389 5:73103064-73103086 TATCCCACTGGAAGGTCCTCAGG + Intergenic
992501012 5:77343990-77344012 TGTCCCACTGGAAGGTCCTCAGG + Intronic
992671460 5:79065151-79065173 TGTCCCACTGGAAGGTCTTCAGG + Intronic
992730395 5:79660869-79660891 TGTCCCACTGGAAGATCTTTGGG - Intronic
992901783 5:81303537-81303559 TGTCCTACTGGAAGGTTTTCAGG + Exonic
992943125 5:81782682-81782704 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
993088549 5:83395367-83395389 TTGCCCACTGGAAGGTCTTCAGG + Intergenic
993089509 5:83407789-83407811 TGTCCCACTGGAAGGCCTTCAGG + Intergenic
993297887 5:86166583-86166605 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
993461239 5:88184984-88185006 TATACCACTGGAAGGTCTTCAGG + Intergenic
993469790 5:88293397-88293419 TGTCCCACTGGAAGTTCTTCAGG - Intergenic
993522913 5:88926684-88926706 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
993853398 5:93039476-93039498 TGTTTCACTGGAAGGTCTTCAGG - Intergenic
993943221 5:94087016-94087038 TGTCCCGCTGGAAGATCTTCAGG - Intronic
993954894 5:94220245-94220267 TATCCCACTGGAAGTTCTTCTGG + Intronic
994053219 5:95385727-95385749 TGTCCCACTGGAAAATCTTCAGG - Intergenic
994111797 5:96014265-96014287 TGTCCCACTGGAAGGTTATCAGG + Intergenic
994299471 5:98129808-98129830 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
994588802 5:101747835-101747857 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
994638108 5:102367740-102367762 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
994678739 5:102859256-102859278 TGTCCCACCAGAAGGTCTTCTGG - Intronic
994819974 5:104636987-104637009 TTTCCCATTGGAAGGTCTTCAGG - Intergenic
994909476 5:105884192-105884214 TGTCCCACTGGAAGGTCTTTAGG - Intergenic
995353132 5:111205346-111205368 GGTCCCTCTGGAGGAGCTGCTGG - Intergenic
995433251 5:112105800-112105822 TGTCCCACTAGAAGGTCTTCAGG - Intergenic
995720564 5:115127916-115127938 TGTCCCACTGGAAGGTCTTCTGG - Intronic
995757153 5:115518669-115518691 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
995900251 5:117057269-117057291 TGTCCCACTGGAAGATTTTCAGG - Intergenic
996225759 5:120993984-120994006 TCTCCCACTGGAAGGTCTTCAGG + Intergenic
996419822 5:123250283-123250305 TGTCCCATTGGAAAGTCTTCAGG - Intergenic
996436635 5:123440616-123440638 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
996504104 5:124249977-124249999 TATCCCACTGGAAGGTCTTCAGG + Intergenic
996583250 5:125055154-125055176 TGTCCCACAGGAAGGTCTCCAGG + Intergenic
997173421 5:131748894-131748916 TGTCCCACTGTAAGGTCTTTAGG - Intronic
998067006 5:139167370-139167392 AGTCCCACTGGAAGGTCTTCAGG - Intronic
998258278 5:140606861-140606883 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
998281631 5:140814323-140814345 TGTCCCACTGGAAGGTCTTCTGG + Intronic
998541370 5:142985023-142985045 TGTCCCACTGTAAGGTCTTCAGG - Intronic
998578008 5:143338454-143338476 TATCCCACTGGAAGGCCTTCAGG - Intronic
998615843 5:143739622-143739644 TGTCCGACTGGAAGGTCTTCAGG + Intergenic
998791512 5:145770609-145770631 TGTCCCATTGGAAAGTCTTCAGG - Intronic
998794714 5:145806416-145806438 TATCCCACTGGAAAGTCTTCAGG + Intronic
998927669 5:147144225-147144247 TGTCCCACTAGAAGGTCTTCAGG - Intergenic
998981161 5:147704031-147704053 TGTCCCACTAGAAGGTCTTCAGG + Intronic
999215206 5:149927947-149927969 TGTCCCCCTGGAACGTCTTCAGG + Intronic
999393900 5:151214342-151214364 GGCCCCACTCCAGGGCCTTCGGG + Intronic
999433370 5:151543004-151543026 GACCCCTCTGGAAGGTCTTCAGG + Exonic
999927042 5:156390320-156390342 TGTCCCACTGGAAGATCTTCAGG - Intronic
1000358082 5:160420173-160420195 GGTCCCTCTGGAGGGTTCTGAGG + Intronic
1000425816 5:161090142-161090164 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
1000695166 5:164371676-164371698 TGTCCCACTGGAAGGTCCTTAGG - Intergenic
1000709281 5:164550657-164550679 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1001081595 5:168671510-168671532 GGTGGCAGGGGAGGGTCTTCAGG - Intronic
1001395219 5:171414393-171414415 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
1001471913 5:172020342-172020364 TGTACCACTGGAAGGTCTTCAGG - Intergenic
1002385575 5:178863747-178863769 TGCCCCACTGGAAGGTCTTCAGG - Intronic
1002868270 6:1143280-1143302 TGTCCCACTAGATGGTCTTTGGG - Intergenic
1003678137 6:8226036-8226058 TGTCCCACTGGCCGGTCTTCAGG + Intergenic
1004540910 6:16549036-16549058 TGTCCCACTGAGAGGTCTTCAGG + Intronic
1004578632 6:16925247-16925269 TGTTGCACTGGAAGGTCTTCAGG + Intergenic
1004591016 6:17051761-17051783 TGTCCCACTGGAAGCTCTTCAGG - Intergenic
1004745180 6:18502241-18502263 GGTCCCCATGGAAGGTCTGCAGG + Intergenic
1004948861 6:20645920-20645942 TGTCCCACTGGAAGATCTTCAGG + Intronic
1005105078 6:22215239-22215261 TGTCCCAGTAGAAGGTCTTCAGG - Intergenic
1005124993 6:22436839-22436861 TGTCCCACTGGGAGGTCTTCAGG + Intergenic
1005308694 6:24538572-24538594 TGCCCCGCTGGAAGGTCTTCAGG + Intergenic
1005776758 6:29141450-29141472 TGTCCCACTGGAAGGTTTTCAGG + Intergenic
1005920891 6:30400284-30400306 TGTCCCACTGGAAGATTTTCAGG + Intergenic
1006003678 6:30986504-30986526 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003687 6:30986549-30986571 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003712 6:30986684-30986706 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003728 6:30986774-30986796 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003755 6:30986909-30986931 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003781 6:30987044-30987066 GGCCCCACTGGAGGGTGTGCTGG - Exonic
1006003800 6:30987134-30987156 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003818 6:30987224-30987246 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006003863 6:30987449-30987471 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006064023 6:31448549-31448571 TGTCCCACTGGAAGATTTTCAGG + Intergenic
1006332415 6:33401622-33401644 TGTCTCACTGGAAGATCTTCAGG + Intronic
1006490934 6:34387323-34387345 TATCCCACTGGGAGGTCTTCAGG - Intronic
1006660654 6:35640869-35640891 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1006672706 6:35739390-35739412 GGCTCCAGTGGAAGGTCTTCAGG - Intronic
1006960325 6:37923382-37923404 TTTCCCACTGGAAGGTCTTCAGG + Intronic
1006965747 6:37982852-37982874 TTTCCTACTGGAAGGTCTTCAGG - Intronic
1007020036 6:38510810-38510832 TGTCCCACTGGAAGGCCTCCAGG + Intronic
1007127396 6:39438421-39438443 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1007741851 6:44015899-44015921 TGTCCCACTGGAAGTTCTTCAGG - Intergenic
1007802686 6:44410600-44410622 GGTAGCACTGCAAGGTCTTCTGG + Intronic
1008067560 6:47066030-47066052 CGTCCCACTGGAAGGTCTTAGGG - Intergenic
1008238751 6:49083254-49083276 TGTCCCACTGGAAGGTCTTTAGG + Intergenic
1008593904 6:53021905-53021927 TGTCCCACTGGAAGGTTTTGAGG - Intronic
1008627368 6:53330912-53330934 TGTCCCACTGGAAGGCCTTCAGG + Intronic
1008772071 6:54991625-54991647 TGTCCCATTGGAAGGTCTTCAGG - Intergenic
1009319661 6:62271607-62271629 TGTCCTACTGGGAGGTCTTCAGG - Intronic
1009557887 6:65198215-65198237 TGTCCCACTGGAAGGTGTGCAGG + Intronic
1010026997 6:71230407-71230429 TGTCCCACTGGAAGATCTTCAGG - Intergenic
1010052074 6:71517508-71517530 TGTCCTACTGGAAGGTCTTGAGG + Intergenic
1010487878 6:76437297-76437319 TGTCCCACTGGAAGTTCTTCAGG + Intergenic
1010588034 6:77678821-77678843 TGTCCCACCGGAAGGTCTTCAGG - Intergenic
1011249156 6:85352691-85352713 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1011401160 6:86963087-86963109 TGTCCCACAGGAAGGTCTTTGGG - Intronic
1011456773 6:87558952-87558974 TGTCCCACTGGAAAGTCTTCAGG - Intronic
1011885929 6:92095664-92095686 TGTCCCTCTGGAAGGTCTTCAGG - Intergenic
1011934629 6:92759951-92759973 TGTCCTGCTGGAAGGTCTTCAGG - Intergenic
1012055514 6:94403587-94403609 TGTCCCACTGGAAGGTCTGCAGG - Intergenic
1012114850 6:95283966-95283988 TGTCCCACTGAAAGGTCTTCAGG - Intergenic
1012146475 6:95690111-95690133 TGTTTCACTGGAAGGTCTTCAGG - Intergenic
1012178350 6:96118753-96118775 TGTCTCACTGGGAGGTCTTCAGG - Intronic
1012236538 6:96823304-96823326 TGTCCCACCGGAAGGTCTTCAGG - Intronic
1012415813 6:99012178-99012200 TGTTCCACTGGAAGGTCTTCAGG - Intergenic
1012919628 6:105208001-105208023 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1012919662 6:105208470-105208492 TATCCCACTGGAAGGTCTTTGGG + Intergenic
1013385595 6:109627217-109627239 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1013637824 6:112045990-112046012 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1013755127 6:113452579-113452601 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1013759827 6:113504927-113504949 TGTCCCATTGGAAGGTCTTCAGG + Intergenic
1013807120 6:114008395-114008417 GTTACCAGTGGAGGGTGTTCAGG + Intronic
1013811611 6:114050758-114050780 TGTTCCACGGGAAGGTCTTCAGG - Intergenic
1013887839 6:114991555-114991577 TGTCCCACTGGAAAGTCTTCAGG - Intergenic
1014158645 6:118140714-118140736 TGTCCCACTGGAAGGTCTTTAGG - Intronic
1014218020 6:118771885-118771907 TGTCCCACTGGAAAGTCTTCAGG + Intergenic
1014322464 6:119947328-119947350 TGTCCCCCTGGAAGGTCTCCAGG + Intergenic
1014579418 6:123118046-123118068 TGTGCCACTGGAAGGTCTTAAGG - Intergenic
1014843980 6:126253252-126253274 TGTCCCACAGGAAGGTCTTCAGG + Intergenic
1015424338 6:133048475-133048497 TGTCCTACTGGAAGGTCTTCAGG - Intergenic
1015520115 6:134121549-134121571 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1015696109 6:135981646-135981668 TTTCCCACAGGAAGGTCTTCAGG + Intronic
1015840197 6:137468464-137468486 TGTCCCACTGGAAGGTCCTCGGG - Intergenic
1015914066 6:138197252-138197274 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1016474693 6:144414240-144414262 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1016592296 6:145759946-145759968 TGTCCCACTGGAAGGCCTTTAGG - Intergenic
1016716771 6:147242065-147242087 TGTCCCACTAGAAGGTCTTCAGG - Intronic
1016747337 6:147594786-147594808 GGTCCAACCTGATGGTCTTCAGG + Intronic
1017072197 6:150585370-150585392 TGTCCCACTGGAGGGTCCTCAGG - Intergenic
1017204815 6:151793289-151793311 TGTCCCACTGGAAAGTCCTCAGG + Intronic
1017460012 6:154640287-154640309 CGTCCCACTGGAAGATCTTCAGG - Intergenic
1017599547 6:156065546-156065568 TGTCCCACTGAAAGTTCTTCAGG - Intergenic
1017600916 6:156080145-156080167 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1017637279 6:156455926-156455948 GTTCCCTCTGGAGGATCTGCAGG + Intergenic
1017655885 6:156629266-156629288 TGTCCCACTGGAAGGTGTTTAGG - Intergenic
1017669277 6:156754760-156754782 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1017833175 6:158151129-158151151 TGTCCCACTGTGAGGTCTTCAGG - Intronic
1017862998 6:158416338-158416360 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1018041615 6:159928955-159928977 TGTCCCACTGGGAGGTCCTCAGG - Intergenic
1018140665 6:160831166-160831188 AGTCTCACTGCAGTGTCTTCCGG + Intergenic
1018191900 6:161316330-161316352 GGTCCCACTGGGAGGTCTTCAGG - Intergenic
1018256136 6:161921256-161921278 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1018308117 6:162479637-162479659 GGTCCCACTGGAGGGTCTTCAGG + Intronic
1018355615 6:163011917-163011939 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1018527770 6:164733087-164733109 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
1018539097 6:164857880-164857902 TGTCCCAGTAGAAGGTCTTCAGG + Intergenic
1018631114 6:165823375-165823397 TGTCCCATTGGAAGGTCTTCAGG + Intronic
1018859755 6:167703035-167703057 GGTCCCACTGGAAGGTCTGCAGG + Intergenic
1018886776 6:167945284-167945306 GGTCCCACGGGAAGGTCTTCAGG + Intronic
1019098949 6:169611782-169611804 GGTCCCACTGGAAGGTCTTCAGG + Intronic
1019164121 6:170087606-170087628 CCTCCCACTGCAGGGTCTCCGGG - Intergenic
1019193109 6:170265487-170265509 GGTCTCACTGGAAGGTCTCTGGG + Intergenic
1020505795 7:8986416-8986438 TGTCCCACTGGAAGATCTTCAGG + Intergenic
1020516604 7:9128900-9128922 TGTCCCACTGAAAGGTGTTCAGG + Intergenic
1020636656 7:10703746-10703768 TGTCCCAGTGAAAGGTCTTCAGG - Intergenic
1020740794 7:12014626-12014648 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1020832234 7:13107070-13107092 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1021165330 7:17332437-17332459 TGTCCCACTGGAAGGTCTGCGGG - Intronic
1021354603 7:19638515-19638537 TGTTGCACTGGAGGGTCTTGGGG + Intergenic
1021384048 7:20006367-20006389 TGTCCTACAGGAGGGTCTTCAGG - Intergenic
1021612244 7:22469101-22469123 TGTCCCACTGAAAGGTCTTCAGG - Intronic
1021696551 7:23281860-23281882 TGTCCCAGTGGGTGGTCTTCAGG - Intergenic
1021743556 7:23713705-23713727 TGTCCTACTAGAAGGTCTTCAGG + Intronic
1021760391 7:23897792-23897814 TGTCCCACTGGAAAGCCTTCAGG - Intergenic
1021830261 7:24599936-24599958 TGTCCCACTGGAAAGTCTTCAGG + Intronic
1022510252 7:30930769-30930791 GGCCCAGCTGCAGGGTCTTCTGG + Intergenic
1022971774 7:35524995-35525017 TGTCCAACTGGGTGGTCTTCAGG + Intergenic
1023281087 7:38570812-38570834 TGTCCTACTGGAAGGTTTTCAGG - Intronic
1023527926 7:41124265-41124287 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
1023656405 7:42426067-42426089 TTTCCCACTGGAAGATCTTCGGG + Intergenic
1023670476 7:42571036-42571058 GCTCCCACTGCAGGGCCTCCTGG + Intergenic
1024184402 7:46934983-46935005 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
1024277159 7:47687336-47687358 TGTCCCACAGGAAGGTCTTCAGG + Intergenic
1024345387 7:48308234-48308256 TGTCCCACTGGGCGGTCTTCAGG + Intronic
1024401666 7:48930740-48930762 TGTCCCACTGGGAGGTCTTCCGG + Intergenic
1024784851 7:52895550-52895572 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1024923455 7:54586720-54586742 TGTCCCACTGGAGAGTCTTCAGG + Intergenic
1024949702 7:54847166-54847188 TGTCCCACTGGAAGGCCTTCAGG + Intergenic
1025270722 7:57511213-57511235 TGACCCACTGGAAGGTCTTCAGG + Intergenic
1025825293 7:65006228-65006250 GGGACCACTGGACGGTCGTCAGG - Intronic
1026147084 7:67756497-67756519 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
1026248931 7:68650039-68650061 TGTCCCACTGGAGTGACTTTGGG + Intergenic
1026419898 7:70223750-70223772 TGTCACACTGCAAGGTCTTCAGG - Intronic
1026549568 7:71356683-71356705 GGGCCCACTGGAAGGTGTTTGGG - Intronic
1026565169 7:71483977-71483999 TGTCCCACTGGTAGGTCTTCAGG + Intronic
1027329920 7:77081380-77081402 TGTCCCACTGAAAGGCCTTCAGG - Intergenic
1027475441 7:78625023-78625045 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1027545790 7:79525921-79525943 TGTCCCACTGGAGGATCTTCAGG + Intergenic
1027839022 7:83283490-83283512 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1027892852 7:83998898-83998920 TGTCCTACTGGAAGGACTTCAGG + Intronic
1028239464 7:88402031-88402053 TGTCCCACTGGAGGATCTTCAGG + Intergenic
1028368647 7:90065032-90065054 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
1028402632 7:90441106-90441128 TGTCCCGCTGGAAGTTCTTCAGG + Intronic
1028438903 7:90836470-90836492 TGTCCCACTGAAAGGACTTCAGG + Intronic
1028601323 7:92603556-92603578 TGTCCCACGGGAAGGACTTCAGG - Intergenic
1028740872 7:94273631-94273653 GGTCCCAGTGGAGGCTCTAAGGG + Intergenic
1028776151 7:94679231-94679253 TGTCCCACTGGAAGGTCATTAGG + Intergenic
1028786702 7:94802628-94802650 TGTCCCATTGGAATGTCTTCAGG - Intergenic
1028878835 7:95856265-95856287 TGTCCCCCTGGACGGTCTTCAGG + Intronic
1028977249 7:96927642-96927664 TGTCCCACTGGAAGGAATTCAGG - Intergenic
1029676384 7:102072058-102072080 GTTACCACTGGAGGGTGTCCAGG + Intronic
1029785846 7:102789961-102789983 TGTCCCACTGAAAGGCCTTCAGG + Intronic
1029980346 7:104872712-104872734 GGTCCCACTGGAAGGTCCTTGGG + Intronic
1030102586 7:105959609-105959631 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1030123362 7:106132168-106132190 TGTCCCAGTGGAAGGTCTTCAGG - Intergenic
1030149879 7:106393377-106393399 CTTCTCACTGGAAGGTCTTCGGG - Intergenic
1030276889 7:107731043-107731065 TGTCCCACTGGAAGGTCATCAGG + Intergenic
1030493039 7:110263396-110263418 TATCCCACTGGAATGTCTTCAGG - Intergenic
1030573722 7:111259949-111259971 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1030707654 7:112711258-112711280 TGTCCCACTGGAAGGTCTTCGGG - Intergenic
1030767315 7:113426656-113426678 TGTTCCACTGGAAGGTCTTCAGG - Intergenic
1031002359 7:116431314-116431336 TGTCCTATTGGAAGGTCTTCAGG - Intronic
1031226535 7:119045871-119045893 TGTCCCACTAGACGGTCTTCAGG + Intergenic
1031413655 7:121469797-121469819 TGAGCCACTGGAAGGTCTTCGGG + Intergenic
1031634719 7:124088441-124088463 TGTCCCACTGGAAAATCTTCAGG + Intergenic
1031674510 7:124592365-124592387 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1031716245 7:125112263-125112285 TGTCTCACTGGAAGGTCTTCAGG + Intergenic
1031891950 7:127304770-127304792 TGCCCCACTAGAAGGTCTTCAGG - Intergenic
1031948908 7:127871108-127871130 TGTCCCACTGGAAGGTTTTCAGG + Intronic
1032539526 7:132691805-132691827 GGTCACAGCAGAGGGTCTTCAGG + Intronic
1032627148 7:133604123-133604145 TGTCCCACTGGAAGATCTTCAGG + Intronic
1032631326 7:133655671-133655693 TGTCCCACCAGAAGGTCTTCAGG + Intronic
1032735086 7:134685061-134685083 TGTCCCACTGGAGGGTCTTCAGG + Intergenic
1032857907 7:135851540-135851562 TGTCCCACTGGAGGGTCTTCAGG + Intergenic
1032908623 7:136403106-136403128 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1032929558 7:136651006-136651028 TGTCCCATTGGAGAGTTTTCAGG + Intergenic
1032977847 7:137245708-137245730 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1033059617 7:138093550-138093572 CGTCCCACTGGAGGTTCTTCCGG + Intronic
1033429619 7:141277420-141277442 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1033784076 7:144708866-144708888 TATCCCACTAGAAGGTCTTCAGG - Intronic
1033981476 7:147170745-147170767 TGTTCCACTGGAGTGTGTTCTGG - Intronic
1034092084 7:148373025-148373047 TGTCACACTGGGAGGTCTTCAGG + Intronic
1034196770 7:149254346-149254368 GCTCCCGCTGGTGGATCTTCTGG - Exonic
1034635620 7:152565193-152565215 GGTACCACTGCATGGTCTTAAGG + Intergenic
1034709103 7:153175069-153175091 TGTCCCATGGGAAGGTCTTCAGG + Intergenic
1035064152 7:156093333-156093355 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1035112456 7:156494708-156494730 GCTGCCACTGGAGGATTTTCTGG - Intergenic
1035358386 7:158293849-158293871 TGTCCCACAGGAAGGTCTTCAGG + Intronic
1035416938 7:158697183-158697205 TGTCCCAGTGGAAGGTCTTCAGG - Intronic
1035719055 8:1777719-1777741 TGTCCCACTGGAGAGACTTCAGG + Intronic
1035899408 8:3441952-3441974 TGTCCCACTGGAAAGTCTTCGGG - Intronic
1035914779 8:3607249-3607271 TGTCCCACTGGGAAGTCTTCAGG + Intronic
1035917047 8:3636193-3636215 TGTCCCATTGGAAGGTCTTCAGG + Intronic
1035936376 8:3845943-3845965 TGTCCCACTGCAGGCTCCTCAGG + Intronic
1035952259 8:4035504-4035526 TGTCCCACCAGAAGGTCTTCGGG - Intronic
1036021245 8:4849050-4849072 TGTCCCACTAGAAGGTCTTCAGG - Intronic
1036113549 8:5933140-5933162 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1036444985 8:8813457-8813479 TGTCGCACTGGAAGATCTTCAGG - Intronic
1036630281 8:10508679-10508701 TGTCCCACTGGGAGGTCTTCAGG + Intergenic
1036734083 8:11293115-11293137 TGCCCCACTGGAAGGTCTTCAGG - Intronic
1037149494 8:15618524-15618546 TGTCCCACTGGGGGGTCTTCAGG + Intronic
1037414614 8:18636109-18636131 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1037459000 8:19090323-19090345 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1037538647 8:19851242-19851264 GCTGCCTCTGGAGGGTCTGCTGG + Intronic
1037560550 8:20070449-20070471 TGTTCCACTGGAAGGTCTTCAGG + Intergenic
1037867159 8:22454321-22454343 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1037870731 8:22493662-22493684 TGTCCCACTGGAAGGCCTTCAGG + Intronic
1037955637 8:23055814-23055836 GGCTCCACAGGAAGGTCTTCAGG + Intronic
1038371926 8:27002761-27002783 TGCCCCACTGGAAGGCCTTCAGG - Intergenic
1038415808 8:27394949-27394971 CGTCCCACTGGAAGCTCTTCAGG + Intronic
1038628140 8:29214476-29214498 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1038710158 8:29936342-29936364 TGTCCCACTGGGAGGTCTTCAGG - Intergenic
1038813174 8:30872622-30872644 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1038922890 8:32104791-32104813 TGTCCTACTGGAAGGTCTTCAGG + Intronic
1039116642 8:34098648-34098670 TGTCCCTCTGGAAGGTCCTCAGG - Intergenic
1039125960 8:34202161-34202183 TGTCCCACTGGGAGGTCTTCAGG + Intergenic
1039269315 8:35863570-35863592 GCTCCCACTGGACGGCTTTCTGG + Intergenic
1039305930 8:36262796-36262818 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1039496207 8:37982392-37982414 TGTCCTACTGGAAGGTCTTTAGG - Intergenic
1039715614 8:40105249-40105271 TGTCCCACGGGAAGGTCTTTAGG + Intergenic
1040597518 8:48853669-48853691 TGTCCCCCTGGAAGGTCTTCAGG - Intergenic
1040695927 8:49998687-49998709 TGTCCCCCTGGAAGGTCTTCAGG + Intronic
1040724142 8:50361246-50361268 TGTCCCACTGGAAAGTCTTCAGG + Intronic
1040750738 8:50703411-50703433 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1040789891 8:51215944-51215966 TATCCCACTGGAAGGTCTTTAGG - Intergenic
1040837754 8:51750302-51750324 TATCCCACTGGAAGGTCCTCAGG + Intronic
1040896271 8:52372092-52372114 TGTCTCACTGGAAGGTGTTCAGG - Intronic
1040902872 8:52434966-52434988 TGTCCCACTGGAAGGTCTTGCGG - Intronic
1041148547 8:54906753-54906775 TGTCCCAGTGGAAGGTTTTCGGG - Intergenic
1041369677 8:57145566-57145588 TGTCCCACTGAAAGGTTTTCAGG - Intergenic
1041440480 8:57890662-57890684 TGTCCCACTGGAAAGTCTTCAGG + Intergenic
1041610927 8:59847925-59847947 TGTCCCACTAGAAAGTCTTCAGG - Intergenic
1041861814 8:62522572-62522594 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1041994228 8:64033874-64033896 TGTCCCACTGGCAGGTCTTCAGG - Intergenic
1041995922 8:64057891-64057913 TATCCCACTGGAAGGTCTTCAGG - Intergenic
1042156842 8:65853395-65853417 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1042164075 8:65928466-65928488 TGTCCCACTGGAAAGTCTTTGGG + Intergenic
1042310745 8:67377150-67377172 TGTCCTACTGGAAGGTTTTCAGG + Intergenic
1042406326 8:68409333-68409355 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1042462776 8:69090546-69090568 TGTCTCACTGGAAGGTCTCCAGG + Intergenic
1042660258 8:71146904-71146926 TGTCCCTCTGGAGGGTCATCAGG - Intergenic
1042849977 8:73207152-73207174 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1043061485 8:75510057-75510079 TGTCCCATTGGAAGGTTTTCAGG - Intronic
1043106379 8:76117501-76117523 TGTCCTACTGGAAAGTCTTCCGG + Intergenic
1043307219 8:78810198-78810220 TGTCCCACTGGAAGGTGTTCAGG + Intergenic
1043428889 8:80175280-80175302 GCGCCCAGTGGAGGGGCTTCAGG + Intronic
1043759172 8:84044537-84044559 TGTCCCACTGGAAGGTCTGCAGG - Intergenic
1043981912 8:86652695-86652717 TGCCCCACTGGAAGGTCTTCAGG + Intronic
1043997360 8:86834785-86834807 TGTCCCACTGGAAGGGCTTCAGG + Intergenic
1044003366 8:86912816-86912838 TGTCCCCCTGGAAGGTCTTCAGG - Intronic
1044117399 8:88351480-88351502 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1044246757 8:89957207-89957229 TGTCCCACTGGAAAGTCTTCTGG - Intronic
1044280801 8:90353581-90353603 TGTCCCACCCGAAGGTCTTCAGG + Intergenic
1044414682 8:91923999-91924021 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1044518004 8:93162171-93162193 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1044538060 8:93380336-93380358 TGTCCCAGTGGAAGGTCTTCGGG - Intergenic
1044546256 8:93463565-93463587 TGTCCCACTAGAAGGTATTCAGG + Intergenic
1044807042 8:96019000-96019022 TGTCCCACTGGAAAGTCTTCAGG - Intergenic
1044872773 8:96636396-96636418 TGTCCCACTGGAAGGTCCTCAGG - Intergenic
1045334537 8:101187444-101187466 TGTCCCACTGGAGGGACTCCAGG - Intronic
1045444361 8:102244707-102244729 TGTCCCACTGGAAGGTCTCCAGG - Intergenic
1045544789 8:103118828-103118850 GGAGCCACTGAAGGGTCTTCAGG + Intergenic
1045858153 8:106788294-106788316 TGTCCCACTGGAAGGTGTTCAGG + Intergenic
1046013647 8:108579874-108579896 TGCCCCACTGGAAGGTCTTTAGG + Intergenic
1046021993 8:108676294-108676316 GGTCCCATTGGAGGGATTTTTGG - Intronic
1046116342 8:109788775-109788797 TGTCCCACTGGAAGCTCTTTAGG - Intergenic
1046385320 8:113501608-113501630 GGGCCCAGAGGAAGGTCTTCAGG - Intergenic
1046663106 8:116970251-116970273 TGTCCCACTGGAAGGACTTTAGG + Intronic
1046838882 8:118835382-118835404 TGTCCCACTGGAAAGTCTTCAGG - Intergenic
1046890008 8:119412557-119412579 TGTCCCACTGGAAGGTTGTCAGG - Intergenic
1047136621 8:122086020-122086042 TGTCCCACTGGAAGGTCTTTGGG - Intergenic
1047142581 8:122158026-122158048 TGTCCCACTGGAAGGCCTTCAGG - Intergenic
1047254741 8:123206862-123206884 GGTCCCCCAGGAGGATCTTGGGG + Intronic
1047430610 8:124788317-124788339 TGTCCCACTGGAAGGGCTTCAGG - Intergenic
1047850778 8:128855025-128855047 TGGCCCACTGGTGGGTCTCCAGG + Intergenic
1047932190 8:129739926-129739948 GGTCCCACTGGAAGGTCTTCAGG - Intergenic
1048227802 8:132606337-132606359 TGTCCCATGGGAAGGTCTTCAGG - Intronic
1048602814 8:135936498-135936520 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1048789674 8:138088542-138088564 CGTCCCACTGGAAGGTCTTCAGG + Intergenic
1049127188 8:140802192-140802214 TGTCCCACTGGGAGGTCTTCAGG - Intronic
1049141265 8:140956648-140956670 TGTCCCACTGGAAAGTCTTTAGG - Intronic
1049579685 8:143405622-143405644 GGTCCCAGTGAGGGGTCCTCGGG - Intergenic
1050271648 9:3952343-3952365 GGTGCCTCTGGGGGGGCTTCTGG - Intronic
1050285055 9:4092647-4092669 CATCCCACTGGAGGGTCTTCAGG + Intronic
1050499296 9:6278461-6278483 TGTCCCACTGGAATTTCTTCAGG + Intergenic
1050757297 9:9021643-9021665 TGTCCCACTAGAAGATCTTCAGG - Intronic
1050848609 9:10256290-10256312 TGTCCCACTGGAAGGTCTTCGGG + Intronic
1050889072 9:10800366-10800388 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1050892305 9:10838842-10838864 TGTCCCACTAGAAGCTCTTCAGG - Intergenic
1051034447 9:12726156-12726178 TGTCCCACTGGAAGTTCTTTAGG - Intergenic
1051046233 9:12877559-12877581 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
1051128258 9:13830299-13830321 TGTCCCACTGAAATGTCTTCAGG + Intergenic
1051181475 9:14416396-14416418 TGTCTCACTGGAAGGTCTTCAGG - Intergenic
1051474909 9:17495339-17495361 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1051643074 9:19241632-19241654 TGTCCTACTGGAAGGTCTTCAGG + Intronic
1051647497 9:19283279-19283301 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1051710927 9:19929784-19929806 TGTCCCACTGGAAGTTCTTCAGG - Intergenic
1051943757 9:22540766-22540788 TGTCCCAGGGGAAGGTCTTCAGG + Intergenic
1052073393 9:24110741-24110763 GGTTGCACTGATGGGTCTTCAGG + Intergenic
1052361748 9:27568945-27568967 TGTCCCACTGGAAGGTTTTTAGG - Intronic
1052729527 9:32268984-32269006 TGTCCCCCTGGAAGGTCTTCAGG - Intergenic
1052744643 9:32428375-32428397 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1053218016 9:36288885-36288907 GCTCCCTCTGGAGGCTCTTGGGG + Intronic
1053671793 9:40372802-40372824 CATCCCACTGGAAGGTCTTCAGG - Intergenic
1053921606 9:42999160-42999182 CATCCCACTGGAAGGTCTTCAGG - Intergenic
1054382908 9:64512846-64512868 CATCCCACTGGAAGGTCTTCAGG - Intergenic
1054512825 9:66003508-66003530 CATCCCACTGGAAGGTCTTCAGG + Intergenic
1054978511 9:71176259-71176281 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1055179789 9:73371252-73371274 TGACCCACTGGAAGGTCTTCAGG - Intergenic
1055287828 9:74748481-74748503 TGTCCCACTGGAAGGTGTTCAGG - Intronic
1055342375 9:75297624-75297646 TGTCCCACTGGAAGGTCTTTAGG - Intergenic
1055393781 9:75851704-75851726 TGTCCCAGTGGAAGGCCTTCAGG + Intergenic
1055630402 9:78217764-78217786 TGTCCTAATGGAAGGTCTTCAGG + Intergenic
1055991230 9:82108176-82108198 TGTCCCACTGGAAGGTTTTCAGG - Intergenic
1056116866 9:83449088-83449110 GGTCTCACTGGAGGCTCTCAGGG + Intronic
1056139697 9:83663996-83664018 GGAAGCACTGGAGGCTCTTCGGG - Exonic
1056242517 9:84662464-84662486 TGTCCCACTGGAAGATCTTCAGG + Intergenic
1056432043 9:86537466-86537488 TGTCCCACTGGAAGGCCTTCCGG - Intergenic
1056443949 9:86646507-86646529 TCTCCCACTGGAAGGTCTTCAGG - Intergenic
1056748604 9:89327672-89327694 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1056961425 9:91127404-91127426 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1057019739 9:91687675-91687697 TGTCCCTCTGGAAGATCTTCAGG + Intronic
1057020054 9:91690275-91690297 TGTCCCTCTGGAAGATCTTCAGG - Intronic
1057023271 9:91717482-91717504 GGCCCCACGGCAGGCTCTTCTGG - Intronic
1057032883 9:91790746-91790768 TGTCCCACTGCAGGGTCTCAAGG - Intronic
1057051466 9:91927422-91927444 GGTCCCCCTTCAGGGTCCTCTGG - Intronic
1057452809 9:95180208-95180230 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1057494419 9:95549280-95549302 TGTCCCACTAGAAGGTCTTCAGG - Intergenic
1057762132 9:97884806-97884828 TGTTCCACTGGAAGGTTTTCAGG + Intergenic
1057861449 9:98644046-98644068 GGTGGCACTGGATGGTATTCTGG - Intronic
1057977306 9:99619935-99619957 GCTCCCTCTGGAGGGTCTTGGGG - Intergenic
1058281250 9:103117663-103117685 TGTCCTACTGGACAGTCTTCAGG - Intergenic
1058511742 9:105726504-105726526 TGTCCCACTTGAAGGTCTTAGGG + Intronic
1059028555 9:110664542-110664564 TGTCCTACTGGAAGGTCCTCAGG + Intergenic
1059183286 9:112240765-112240787 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1059526673 9:114997802-114997824 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1059714617 9:116902182-116902204 TTTCCCACTGGAAAGTCTTCTGG - Intronic
1059718969 9:116940420-116940442 TGTCCCACTGGAAGGTCTTCAGG - Intronic
1059872246 9:118590780-118590802 TGTCCCACTGGAAAGTCTTCAGG - Intergenic
1059951522 9:119467607-119467629 TGTCCCACTGGAAGGTCTACAGG - Intergenic
1060011553 9:120047716-120047738 TATCCCACTGGAAGGTCTTTAGG + Intergenic
1060081797 9:120654770-120654792 CATCCCACTAGAAGGTCTTCGGG - Intronic
1060413595 9:123415631-123415653 GCTCCCACCGCAGGGTCTCCAGG + Intronic
1060868304 9:127017863-127017885 TGTCCCACTGGAAGGTTTTCAGG + Intronic
1060870500 9:127036008-127036030 GCTCCCAGAGGAGGGTCTGCTGG + Intronic
1060924024 9:127442989-127443011 TGTCCAACTGGAAGATCTTCAGG + Intronic
1061225490 9:129278755-129278777 GGACCCACAGGAGGGTGGTCAGG - Intergenic
1061311385 9:129765205-129765227 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1061643333 9:131977596-131977618 GGTCTCTCTGGAGGGGGTTCTGG + Intronic
1203785695 EBV:126266-126288 GGTCCCAGAGGGGGGTCTTTAGG - Intergenic
1185943829 X:4352441-4352463 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1185951213 X:4436371-4436393 GGCCCCAGAGGAGGGTCTCCAGG + Intergenic
1186033825 X:5398955-5398977 TGTCCCACTGGAAGGTATTCAGG - Intergenic
1186286665 X:8051490-8051512 TATTCCACTGGAAGGTCTTCTGG - Intergenic
1186296323 X:8153031-8153053 GGTCCCACTGGAAGGTCTTCAGG + Intergenic
1186697306 X:12049760-12049782 TGTCCCACTGGCAGGTTTTCAGG - Intergenic
1186791297 X:13001743-13001765 TGTCCCACTGGAAGGTCCTCAGG - Intergenic
1187209906 X:17219191-17219213 TGTGCCACTGGAAGATCTTCAGG - Intergenic
1187234285 X:17452416-17452438 GGCCCCACTGCAGGGTCACCGGG - Intronic
1187395264 X:18913859-18913881 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1187762288 X:22601150-22601172 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1188442473 X:30226239-30226261 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1188850104 X:35121671-35121693 TGTCCCACTGGAAGGTCCTCAGG + Intergenic
1189022278 X:37353134-37353156 TGTTCCACTGGAAGGTTTTCAGG - Intronic
1189028325 X:37423052-37423074 TATCCCACTTGAAGGTCTTCAGG - Intronic
1189132290 X:38512559-38512581 TGTCCCACTGGAAGGTCTTCAGG + Intronic
1189158239 X:38782250-38782272 TGTCCCACTGAAAGGTCTTCAGG + Intergenic
1189621201 X:42840122-42840144 TGTTCCACTGGAAGGTCTTCAGG - Intergenic
1189765451 X:44367739-44367761 TGTCCCACTGGAAGATCTTCAGG - Intergenic
1190239095 X:48643273-48643295 TTTCCCACTGGAAGGTCTTCAGG + Intergenic
1190245272 X:48686774-48686796 GGACCCACTGGAGGGCCTGTGGG - Exonic
1190398582 X:50009477-50009499 GATCACACTTGAGGGTCTGCAGG - Intronic
1190427021 X:50343139-50343161 TGTCCCATTGGAAGTTCTTCAGG - Intronic
1190574075 X:51815335-51815357 TGTCCCACCGGAAGTTCTTCAGG - Intronic
1191014750 X:55797110-55797132 TGTCCCATTGGAAGATCTTCAGG + Intergenic
1191056566 X:56247710-56247732 TGTCCCACTGGAAGATCTTCAGG + Intronic
1191801820 X:65089879-65089901 TTTCCCACTGGAAGGTCTTCAGG + Intergenic
1192127489 X:68515553-68515575 TGTCCTATTGGAAGGTCTTCTGG + Intronic
1192344887 X:70294235-70294257 TGTCCTACTGGAAAGTCTTCAGG + Intronic
1192385100 X:70660592-70660614 TGTCCCACTGGAAAGTCCTCAGG + Intronic
1192407701 X:70903057-70903079 TGTCCCACTGGAAGTTCTTCAGG + Intronic
1193145427 X:78071178-78071200 GGTTCCAGAGGAAGGTCTTCAGG - Intronic
1193145662 X:78073053-78073075 TGTCCCACTGGAAGGTCTTTGGG + Intronic
1193237643 X:79128844-79128866 TGTCCCACTGGAAGATCTTTAGG - Intergenic
1193372935 X:80720302-80720324 TGTCCCACTGGAAGGTCTTCCGG - Intronic
1193973153 X:88083156-88083178 TGTCCCACCGAATGGTCTTCAGG + Intergenic
1194413834 X:93586407-93586429 TGTCCCCCTGGAAGGTCTTCAGG + Intergenic
1194473631 X:94331436-94331458 TGTCCCACTGGAAGGTCTTCAGG - Intergenic
1194587003 X:95747590-95747612 TGTCCCACTAGAAGGTCTTCAGG - Intergenic
1194588076 X:95762156-95762178 TGTCCCACTGGAAGGCCTTTGGG + Intergenic
1194640304 X:96396112-96396134 CGTCCCACTGGAAGGTCTTCAGG - Intergenic
1194918704 X:99736376-99736398 TATCCCACTGGAAGATCTTCAGG - Intergenic
1195040754 X:101011911-101011933 TGTCCCACTAGAAGGTCTTCAGG + Intronic
1195143745 X:101991565-101991587 TGTGCCACTGGAAGGTCTTCAGG + Intergenic
1195289304 X:103416417-103416439 TGTCCCACTGGGAGGTCTTAAGG + Intergenic
1195542881 X:106083321-106083343 GTTTCCACTGAAGGGTCTGCTGG + Intergenic
1195551117 X:106172571-106172593 CGTCCCACTGGAAGGTCTTCAGG + Intronic
1195571811 X:106405448-106405470 TGTCCCACTGGAAAGTCTTCAGG + Intergenic
1195580778 X:106499222-106499244 TGTACCACTGGAAAGTCTTCAGG - Intergenic
1195781696 X:108473407-108473429 TGTCCCACTGGAAGGTCTTTGGG - Intronic
1196265376 X:113638171-113638193 TGTCACACTGGAAGGTCTTCAGG + Intergenic
1196284986 X:113869317-113869339 TGTCCCACTCGAAGATCTTCAGG - Intergenic
1196641459 X:118067727-118067749 CATCCCACTGGAAGGTCTTCAGG + Intronic
1196641672 X:118069291-118069313 TATCTCACTGGAAGGTCTTCAGG - Intronic
1196894062 X:120316342-120316364 TGTTCCACTGGAAGGTCTTCAGG - Intergenic
1196960739 X:120997949-120997971 TGTCCCATTGGAAGGTCTTCAGG + Intergenic
1197230718 X:124000787-124000809 TGTCCTACTGGAAGGTCTTCAGG - Intronic
1197265418 X:124364181-124364203 TATCCCACTGCAGGATCTTCAGG - Intronic
1197444338 X:126530967-126530989 TGTCCCACTGGTAGGTCTTCAGG + Intergenic
1197675588 X:129326467-129326489 GGTCCCAGTGGAGAGTCTGTGGG - Intergenic
1197877951 X:131131441-131131463 TGTCCCACTGGAAGGTCTTCAGG + Intergenic
1198193444 X:134334737-134334759 TGTCTCACTGGGAGGTCTTCAGG + Intergenic
1199020697 X:142874210-142874232 TGTCCCAATGGAAGGTCTTCAGG + Intergenic
1199270385 X:145875499-145875521 TGTCTCACTGGAAGGTCTTCGGG - Intergenic
1199335350 X:146613108-146613130 TGTCCCACTGGAAGGTCCTCAGG + Intergenic
1199940622 X:152623300-152623322 TGTCCCACTGGAAGGTCTCCAGG - Intergenic
1201068650 Y:10124309-10124331 GGTCCCACTGCATGTTGTTCTGG - Intergenic
1201638488 Y:16152204-16152226 TGTTCCACTGGAAGGTATTCAGG + Intergenic
1202025101 Y:20513187-20513209 TGTTCCACTGGATGGTCTACAGG - Intergenic