ID: 1018309606

View in Genome Browser
Species Human (GRCh38)
Location 6:162494202-162494224
Sequence CTGTGTAAGCTGCAGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 240}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018309606_1018309611 13 Left 1018309606 6:162494202-162494224 CCTTCATTCTGCAGCTTACACAG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1018309611 6:162494238-162494260 ACAGCCTGGGCGTTGGCATCAGG 0: 1
1: 0
2: 0
3: 9
4: 142
1018309606_1018309609 0 Left 1018309606 6:162494202-162494224 CCTTCATTCTGCAGCTTACACAG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1018309609 6:162494225-162494247 GCTGTTGTCATCTACAGCCTGGG 0: 1
1: 0
2: 2
3: 11
4: 149
1018309606_1018309608 -1 Left 1018309606 6:162494202-162494224 CCTTCATTCTGCAGCTTACACAG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1018309608 6:162494224-162494246 GGCTGTTGTCATCTACAGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 135
1018309606_1018309614 24 Left 1018309606 6:162494202-162494224 CCTTCATTCTGCAGCTTACACAG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1018309614 6:162494249-162494271 GTTGGCATCAGGCAACAGCTGGG 0: 1
1: 0
2: 3
3: 15
4: 160
1018309606_1018309610 6 Left 1018309606 6:162494202-162494224 CCTTCATTCTGCAGCTTACACAG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1018309610 6:162494231-162494253 GTCATCTACAGCCTGGGCGTTGG No data
1018309606_1018309613 23 Left 1018309606 6:162494202-162494224 CCTTCATTCTGCAGCTTACACAG 0: 1
1: 0
2: 0
3: 18
4: 240
Right 1018309613 6:162494248-162494270 CGTTGGCATCAGGCAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018309606 Original CRISPR CTGTGTAAGCTGCAGAATGA AGG (reversed) Intronic
902195931 1:14798127-14798149 CTGTGTAAGCGGCAGCAACAGGG - Intronic
904408989 1:30313520-30313542 CGGCGAAAGCTGCAGAATGAGGG - Intergenic
905249350 1:36638064-36638086 CTTTCTGAGCTGCAGAATCAGGG - Intergenic
907684420 1:56595898-56595920 CTGTGTCAGCTTGAGAATGACGG + Intronic
911085198 1:93971163-93971185 CTTTCTAAGCTGTAGAAGGAAGG + Intergenic
911247700 1:95536735-95536757 CTTTGAAAGCTCCAGAGTGATGG - Intergenic
912797003 1:112699494-112699516 CTGTGGAAGCTGAAACATGAAGG - Intronic
913139426 1:115925969-115925991 CTTTCTTACCTGCAGAATGAAGG - Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
915001059 1:152592097-152592119 TTGTGTATGCTGCAAAATAAAGG + Intronic
915718864 1:157968906-157968928 CTGTGCAAGCTGATGAAGGAGGG - Intergenic
916648039 1:166807493-166807515 CTCTGAAGGTTGCAGAATGAAGG - Intergenic
918474409 1:184907847-184907869 CAGGGTAGGCTGCAGAATCAAGG - Intronic
919608932 1:199721036-199721058 CTTTGTATGCTACAAAATGATGG - Intergenic
919656024 1:200197964-200197986 CTGTGAAAAATGCAGAATGTTGG - Intergenic
919965537 1:202520091-202520113 CTGAGCAAGCTGAAGAATGGAGG + Intronic
920494401 1:206444392-206444414 CTGTGGAAGATGAAGAATGTTGG - Intronic
920503634 1:206501230-206501252 CTGTCTCCGCTGAAGAATGAAGG - Intergenic
922493281 1:226035966-226035988 CTCTGTGAGCAGCAGAAAGAAGG - Intergenic
922788975 1:228299423-228299445 GTGTGTGAGCTGCAGATTCATGG + Exonic
924070846 1:240276676-240276698 CTGTGTAGTCTGCACCATGAGGG - Intronic
1062909257 10:1201927-1201949 CTGTGGAATCTGTGGAATGAAGG - Intronic
1063039179 10:2319328-2319350 GTGTTTTACCTGCAGAATGAGGG - Intergenic
1063250485 10:4268545-4268567 CTGGGGAAGCTTCAGAATCATGG + Intergenic
1067033962 10:42899356-42899378 GTGTGTGTGCTGCAGAAGGAAGG - Intergenic
1067400098 10:45964674-45964696 ATGTGTAAGTGGCAAAATGAAGG - Intergenic
1067767019 10:49094517-49094539 CTGTGTAAGATGCTGCCTGAGGG - Intronic
1067868426 10:49933966-49933988 ATGTGTAAGTGGCAAAATGAAGG - Exonic
1069274857 10:66576966-66576988 CTGTTTAAGCTGCAGAGAAAAGG - Intronic
1070945094 10:80384165-80384187 CTCTGTAAGCTCCAGAGGGATGG - Intergenic
1071284911 10:84135566-84135588 CTGTATAGCCTGCAGAATCATGG + Intergenic
1072075253 10:91965255-91965277 CTCTTTAAGCTGCAAGATGAAGG + Intronic
1072528130 10:96292817-96292839 CTGTGTAAACTACAGAATTTGGG - Intergenic
1072577358 10:96712391-96712413 CTGTGTAAGCTTTGGAATCAGGG - Intronic
1072837301 10:98729320-98729342 CTATGTAGGCTGCAGCATGGTGG + Intronic
1075320212 10:121485434-121485456 CTTTTTAAGCTGCTGAAGGAAGG - Exonic
1076716920 10:132370781-132370803 CTGTGTAGGCAGCAGAAAAAGGG - Intronic
1076742403 10:132493227-132493249 CTGTGTGAGATGGAGACTGAGGG - Intergenic
1078576251 11:12505059-12505081 CTGTGTAATTTCCACAATGAGGG + Intronic
1080176879 11:29374274-29374296 CTGTGTAAGCTGAAGAACAGTGG - Intergenic
1081665757 11:44916245-44916267 CTGTGGATGCTGAAGAATCAGGG + Intronic
1082742810 11:56929557-56929579 CTGTGTAATCTGAAGAAAGTTGG + Intergenic
1084804957 11:71572386-71572408 CTGTGGGGGCTGCAGAATCAGGG + Intergenic
1085179524 11:74521791-74521813 CTGTTTCATCTGCAGAATGAGGG + Intronic
1085524908 11:77158409-77158431 CTGGGCAACCTGCAGTATGAGGG + Exonic
1086545177 11:87959288-87959310 CTGTGTAGGTTTTAGAATGATGG - Intergenic
1086901611 11:92373905-92373927 ATCTGTAAGCTGGAGAAGGAGGG + Intronic
1087971635 11:104491490-104491512 CTCTGGAAGCTGCAGAAAAAGGG + Intergenic
1088879568 11:113962926-113962948 CTGTGCAAGCAACAGAAGGAAGG + Intergenic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1095684304 12:45014949-45014971 GTGAGTAAGCTGCATAATGATGG - Exonic
1097184886 12:57191217-57191239 CTCTGACAGCTACAGAATGAGGG - Intronic
1098498887 12:71167403-71167425 CTGAGTATGCTGGAGAAAGAAGG + Intronic
1100385202 12:94099666-94099688 GTGTGCAAGTTGCAGAAAGAAGG + Intergenic
1104619767 12:130302213-130302235 CTGTAAGAGCTGCTGAATGAGGG + Intergenic
1104722011 12:131049711-131049733 CCGTGTAGGCTGCAGAGTGAGGG + Intronic
1104894755 12:132158711-132158733 CTGTGAAGGCTGCGGGATGAGGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106848401 13:33762389-33762411 GTTTGTAAGCTGCAGAACCATGG + Intergenic
1107390916 13:39963125-39963147 TTGGGGAAGCTGCAGAATGCAGG - Intergenic
1107979683 13:45722623-45722645 CTGTGGAAGCTACATAATGAAGG - Intergenic
1109490831 13:63097985-63098007 CAGTGAAATCTGCACAATGATGG - Intergenic
1109614040 13:64807889-64807911 CTGTGGAGGCTTCAGAATCATGG - Intergenic
1112495866 13:99904246-99904268 CTTTTTAATCTGCAAAATGAGGG - Intergenic
1112766623 13:102752491-102752513 TTGTGTCAACTGAAGAATGATGG - Intronic
1113461687 13:110486359-110486381 CTCCCTCAGCTGCAGAATGAAGG + Intronic
1114713785 14:24804174-24804196 CTGTGGAAACAGCAGAAGGAAGG - Intergenic
1115186618 14:30696098-30696120 CTATTTAAGCTGCATAATTATGG + Intronic
1115779279 14:36751336-36751358 CTGTTTGAGCTGAAGAATGTAGG + Intronic
1116276076 14:42833649-42833671 CTGGGTAAGCTTCATAATCATGG + Intergenic
1117062898 14:51981084-51981106 CTGTGCAGGCTGCAGAAGCAGGG + Intergenic
1118210048 14:63757551-63757573 CTGTGTAAGCAACAGAAAGAGGG - Intergenic
1118316600 14:64729713-64729735 CTGTGTAAGCTGGAGAAGTCTGG + Intronic
1118679614 14:68226627-68226649 CTGGGGAAGCTGCACAATCATGG - Intronic
1119064025 14:71507868-71507890 GTGAGTCCGCTGCAGAATGATGG - Intronic
1119751741 14:77083520-77083542 CGGTGTAAACTGCAGCATAAAGG + Intergenic
1120100435 14:80438636-80438658 CTGTATAGCCTGCAGAATCATGG + Intergenic
1122509628 14:102256002-102256024 CACTGTAGCCTGCAGAATGACGG + Intronic
1123978753 15:25579111-25579133 CTGTGTAAGGTGCTGTATTAGGG + Intergenic
1124015585 15:25871993-25872015 CTCTGCAAGCTGGAGAACGAAGG + Intergenic
1126210576 15:46097060-46097082 CTGTGTATGCTGCAGTAGAAGGG - Intergenic
1128520134 15:68369725-68369747 CCCTGTAAGATGAAGAATGAGGG - Intronic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1128982580 15:72197914-72197936 CTGGGGAAGCTGGGGAATGAGGG - Intergenic
1129440432 15:75578039-75578061 CAATGTAAGCTTCAGAAAGATGG + Intronic
1131329209 15:91480661-91480683 CTGTGTAAGCAGGAGACAGAAGG + Intergenic
1132088594 15:98928484-98928506 CCTTTTAATCTGCAGAATGAGGG + Intronic
1136750235 16:32628929-32628951 ATGAGTAATCTGCAGAATGGAGG - Intergenic
1137559360 16:49492967-49492989 CTGTGTCTGGTGCAGAATGCGGG - Intronic
1138249161 16:55489207-55489229 CTGTGTATGCTGCACAAAGCAGG - Intronic
1139198777 16:64951010-64951032 CTGTGTTATCTGCAGAAAGAGGG + Exonic
1139240250 16:65384072-65384094 CTGGGGAAGCTTCAGAATCATGG - Intergenic
1140565981 16:76043024-76043046 CTATGTAAGTTGCAGAAAGCTGG - Intergenic
1203052366 16_KI270728v1_random:888134-888156 ATGAGTAATCTGCAGAATGGAGG - Intergenic
1145838672 17:27975230-27975252 CTTTCTCATCTGCAGAATGAAGG - Intergenic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148434415 17:47671415-47671437 CTGTCAATGCTGCAAAATGAAGG - Intronic
1149414229 17:56442194-56442216 ATGTGTATGCAGCTGAATGAAGG + Intronic
1149457722 17:56801859-56801881 CTGTGGAAGCAGCACACTGAAGG + Intronic
1149777786 17:59371512-59371534 TTGTGTGAGCTGGAGAATGCAGG + Intronic
1151428909 17:74049512-74049534 TAGCGTAAGCTGCAGGATGAGGG - Intergenic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1153141694 18:1979940-1979962 TTGTGTAAGATGTAAAATGAGGG + Intergenic
1155694345 18:28667165-28667187 CTAGTTAAGCTGCAGCATGATGG - Intergenic
1157407692 18:47437173-47437195 CAGTGTAAGCTGCAGTTTGGAGG + Intergenic
1158380386 18:56923539-56923561 CTGTGTTAGATGCAGAAGAAAGG + Intronic
1160398345 18:78588652-78588674 CAGAGCAAGCTGGAGAATGAGGG + Intergenic
1162602607 19:11680449-11680471 CTGTGCAGTCTGCAGAATCATGG - Intergenic
1162838378 19:13336952-13336974 CTGTGACACCTGCAGAATGCAGG + Intronic
1163179467 19:15588722-15588744 CTCTGTAAGCTGGAGAACTAGGG + Intergenic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1164927858 19:32144235-32144257 CTGTGCGAGCTGCAGAAGGTTGG - Intergenic
1165996733 19:39848942-39848964 CTGTGTAAGCTTCAGACCTAGGG - Intergenic
1166794732 19:45419621-45419643 CTGTGACAGCTGCAGACTGCTGG - Intronic
1166864437 19:45827460-45827482 CTCTGCAAGCTGCAGGCTGAGGG + Intronic
1168415668 19:56166591-56166613 CTGTGTGAGCTACAATATGAAGG + Intergenic
925367622 2:3321788-3321810 CTTTTTAAGCTGTAGAAAGAAGG - Intronic
925628749 2:5867660-5867682 GTGTCAAAGATGCAGAATGAAGG - Intergenic
926349841 2:11984644-11984666 CTTTGTCAGCGGCAGCATGAGGG - Intergenic
930496180 2:52147251-52147273 CTGTATATGCTCCAGAATTATGG - Intergenic
931494777 2:62792236-62792258 TTATGTGAGCTACAGAATGATGG + Intronic
932403092 2:71495741-71495763 CGGTTTAAGCTGAAGAATGTGGG - Intronic
935427068 2:102931049-102931071 TTATGTAAACTGCACAATGAAGG + Intergenic
938673500 2:133607000-133607022 CTGTGGGAGCTTGAGAATGAAGG + Intergenic
939455204 2:142425396-142425418 CAGAGTAAGGTGAAGAATGATGG - Intergenic
940288622 2:152056532-152056554 CCGTGTGAGCAGCAGAAGGAAGG - Intronic
942957177 2:181787145-181787167 ATGTGTTAGCCTCAGAATGAAGG - Intergenic
943269718 2:185783624-185783646 CTGTAAAAGATGCAGAAGGAAGG + Intronic
944965199 2:204924036-204924058 CTGTAAAAGCTGTAAAATGAAGG + Intronic
947914092 2:233820586-233820608 CTGTGTGTGCTACAGCATGATGG + Intronic
1168737680 20:157272-157294 CTGTGTAGGCTGTAGACTGCTGG - Intergenic
1170018305 20:11808053-11808075 CTCTGTATGCTGGAGAATGTGGG - Intergenic
1172024665 20:31939803-31939825 CTATGTAACTTGCTGAATGAAGG + Intronic
1173113840 20:40221504-40221526 CAGTGTGGGCTGCAGTATGATGG + Intergenic
1173289087 20:41698702-41698724 CTGTGTCACCAGCAGAATGCAGG + Intergenic
1176034140 20:63028206-63028228 CTGATGAAGCTGCAGAAAGAAGG - Intergenic
1178247097 21:30963819-30963841 CTATGTAAGCAGCAAAGTGAAGG + Intergenic
1179036877 21:37766103-37766125 TTGTGTGGGATGCAGAATGAGGG - Intronic
1180213637 21:46311526-46311548 CTGAGGGAGCTGCTGAATGATGG + Exonic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1183040108 22:35171594-35171616 CTGTGTGAGCTACAGATGGAAGG + Intergenic
1183527851 22:38334667-38334689 CTGGGCAAGCTTCAGAGTGAGGG - Intronic
1184078048 22:42196099-42196121 CTGTGTAACCTGCAAAGGGAAGG + Intronic
950365907 3:12484043-12484065 CTGTGTACGCTGCAGCATGCGGG - Intergenic
951494244 3:23308774-23308796 ATCTGCAAGCTGGAGAATGATGG + Intronic
951576505 3:24120143-24120165 CTCTGTCAGCTTCAGAAGGAAGG + Exonic
951931489 3:27972247-27972269 CTGTAGAAGCTGCAGAGTGGAGG + Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
954369906 3:50164746-50164768 CTGTGGAAGCAGCATCATGAGGG + Intronic
955216978 3:56992284-56992306 CTGTGAAATCTGAAGAATGAAGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
957061969 3:75489611-75489633 CTGTGTAAGCATCATAATAACGG - Intergenic
957317759 3:78589643-78589665 CTGTTTTAGTTGGAGAATGATGG + Intergenic
960476424 3:118135071-118135093 GTGAGGAAGCTGCAGAAGGAAGG + Intergenic
961765330 3:129205931-129205953 TTGTGTACGTGGCAGAATGATGG + Intergenic
962405183 3:135094386-135094408 GTGTGTAGGCTCCAGAATGTCGG + Intronic
964507313 3:157413564-157413586 CTGTGTCACCTGAAGAAGGAGGG - Intronic
964870433 3:161307969-161307991 GTGAGGAAGCTGCAGAAGGAAGG + Intergenic
968000510 3:195202572-195202594 CAGTGAAAGCTGAAGAAAGATGG - Intronic
968361701 3:198151858-198151880 CTGTGTGAGCAACAGAAGGAAGG - Intergenic
969174199 4:5386269-5386291 CTGGGTAAGCTCCAGAAGGCAGG + Intronic
971142402 4:23938520-23938542 CTGTTTAAGATGTACAATGATGG + Intergenic
971743781 4:30552470-30552492 CTGGGGAAGCTTCAGAATCATGG - Intergenic
972649157 4:40999533-40999555 AACTGTAAGCTGCAGAAAGAAGG - Intronic
976120393 4:81774289-81774311 CTGTTTAAGCTTCAGAGTTAGGG + Intronic
976429743 4:84948614-84948636 CTATCTAATCTGCAGTATGAAGG - Intronic
976946486 4:90775996-90776018 CTGTGTAAGCTGCTGTCTCAAGG - Intronic
977130199 4:93226580-93226602 CTGTGAAAGCTGCAGAAGCTGGG - Intronic
977809244 4:101340061-101340083 CTGTGAAACCGGAAGAATGATGG - Intronic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978217327 4:106220353-106220375 CTGGGGAAGCCCCAGAATGATGG - Intronic
981085114 4:140675732-140675754 CATTGTAAGCAGCAGCATGATGG + Intronic
981594020 4:146398905-146398927 CTGTGTAAGCAGCAGGAGAACGG + Intronic
982121370 4:152146561-152146583 CTGGGGAAGCTTCAGAATCATGG + Intergenic
983124642 4:163935535-163935557 CTGAGGAAGCTGCAGAAGAAAGG - Intronic
983433960 4:167688093-167688115 ATGTGTAGGCTGGAGCATGAAGG - Intergenic
984797271 4:183673895-183673917 CTATGTAAGTTATAGAATGATGG + Intronic
985817861 5:2139786-2139808 CTGAGTAAGCTGCAGATGCAGGG - Intergenic
986909663 5:12539352-12539374 ATATGTAACCTCCAGAATGAGGG + Intergenic
987221983 5:15800193-15800215 TTTTGTCTGCTGCAGAATGATGG + Intronic
988305646 5:29491129-29491151 CTGGGAAAGCTTCAGAATCATGG + Intergenic
988897534 5:35693579-35693601 CTGTGTGCTCTGCAGAATGAAGG - Intronic
989003990 5:36789450-36789472 CTGTGAGAGCTGGAAAATGAAGG - Intergenic
989253338 5:39340687-39340709 CTGGGTCAGCTCCAGAATGCTGG + Intronic
989373655 5:40736297-40736319 GTGAGTAATCTGCAGAATGTGGG + Intronic
989403456 5:41034084-41034106 ATGAGTAAGCTGCAGAAGGCAGG + Intronic
991452336 5:66766105-66766127 GTGAGGAAGCTGCAGAATGAAGG + Intronic
992552280 5:77870207-77870229 CTAGGAAGGCTGCAGAATGAAGG - Intergenic
992986253 5:82233657-82233679 CTATGTTAACTGCAAAATGATGG - Intronic
999031499 5:148298012-148298034 CTGTGCAAGAGACAGAATGATGG - Intergenic
999817598 5:155193004-155193026 GTGTGTAAGATGCAGAATTTGGG - Intergenic
1001845184 5:174916000-174916022 CAGTGTAAGCAACAGAATGGAGG - Intergenic
1002310874 5:178313030-178313052 CTGCGCACGCTGCAGCATGATGG + Intronic
1003062429 6:2874217-2874239 ATTTGTAAGTGGCAGAATGAGGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003660014 6:8051371-8051393 GTGAGGAAGCTGCAGAAGGAAGG + Intronic
1005180018 6:23094261-23094283 CTATATAAGCTGAAGAGTGAGGG + Intergenic
1006143133 6:31943046-31943068 CTTTGTGTCCTGCAGAATGAAGG - Exonic
1006338452 6:33432856-33432878 CTGTGTGAGATGCAGAGGGAGGG + Intronic
1006926299 6:37657353-37657375 CTGTGGAAGGGGCAGAATGATGG - Intronic
1009281262 6:61754596-61754618 CTATGTAAGGTGGAGAATCAAGG - Intronic
1009399573 6:63238245-63238267 CTATGTAGGCTACAAAATGATGG + Intergenic
1009518770 6:64655488-64655510 CTGTGAATGCTCCACAATGAAGG - Intronic
1009900526 6:69803255-69803277 CTGTGGAAGCTGCGGAGAGATGG + Intergenic
1010606739 6:77899051-77899073 CTTTGTAAGCTTGAGAATGAGGG - Intronic
1012773177 6:103467604-103467626 CTGGGTAAGATGGAGAATAATGG - Intergenic
1012826486 6:104152587-104152609 CTGTGGAGGCTTCAGAATCATGG + Intergenic
1014302304 6:119696990-119697012 CGTTGATAGCTGCAGAATGAGGG + Intergenic
1015100633 6:129475573-129475595 GTGGGTAAGCAGCAGAATGTCGG - Intronic
1015430811 6:133128746-133128768 CTGTGTAAGTTTGATAATGAGGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1018309606 6:162494202-162494224 CTGTGTAAGCTGCAGAATGAAGG - Intronic
1018786513 6:167112591-167112613 CTGTGGCTGCTGCAGAATGGGGG + Intergenic
1019516814 7:1443837-1443859 CTGTGTAAGCCGCCCAGTGAGGG + Intronic
1021880920 7:25094463-25094485 CTGAGTCAGCTGCAGGCTGAGGG - Intergenic
1022549869 7:31228344-31228366 CTGAGGAGGCTGCAGAATCATGG - Intergenic
1023486997 7:40698215-40698237 CTATGTAATCTGCATAATGCAGG + Intronic
1028061257 7:86319626-86319648 GTGTGAATGCTGCAGAATGATGG - Intergenic
1028511681 7:91632242-91632264 CTGTAAAAACTGCAGAATGAAGG - Intergenic
1028630764 7:92931480-92931502 CTGTAGAAGCAGCAGAATGGTGG + Intergenic
1030206835 7:106959572-106959594 CTGTGTAAGCTGATGAGTTATGG - Intergenic
1032513100 7:132487628-132487650 AGCTGGAAGCTGCAGAATGAGGG + Intronic
1032769681 7:135038569-135038591 CTGTTTAAGCTGCAGAGTGGTGG - Intronic
1033588020 7:142788544-142788566 CTAGGTAAGTTGCAGAATCAGGG + Intergenic
1033597883 7:142869402-142869424 CTGTGTAATCTCCACAATGGGGG - Intronic
1037149366 8:15617029-15617051 CTGTGTAATCAGCAGACAGAGGG + Intronic
1040818354 8:51532078-51532100 CTGTCTACGGTGCAGAATGCAGG + Intronic
1042645928 8:70986892-70986914 CTGTGGAAGCTTCACAATCATGG + Intergenic
1046708425 8:117481290-117481312 TTGTGAAAGTTGCAAAATGAGGG + Intergenic
1048370805 8:133774524-133774546 CTCTGGAAGCTGCAGAAGCAAGG + Intergenic
1048412935 8:134194422-134194444 CTGTGAAAGATGCAAAAGGAGGG - Intergenic
1048495132 8:134928840-134928862 CAGTGGAGGCTGCAGAATTAAGG + Intergenic
1050286211 9:4104813-4104835 GAGTGTAAGCTCCAGAAGGATGG + Intronic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1051578237 9:18642127-18642149 CTGTGTAAGCACCACACTGATGG - Intronic
1052602391 9:30651769-30651791 CAGTGTAAACTCCAGAAAGAAGG - Intergenic
1053307758 9:36995990-36996012 AGGTGTCGGCTGCAGAATGAAGG - Intronic
1055568266 9:77590594-77590616 CAGTGTCTGCTTCAGAATGAAGG + Intronic
1056118640 9:83465119-83465141 GTGTGTAAAATACAGAATGAAGG - Intronic
1056782051 9:89557774-89557796 CTGTGGGAGCTGCAGCAAGAAGG - Intergenic
1056785029 9:89585659-89585681 CTGTGGAGGCTGCAGAGTAAAGG + Intergenic
1057425916 9:94949545-94949567 CTGTGTCTGCTGCAGGCTGATGG + Intronic
1058795511 9:108494317-108494339 CTGAGTAGGATGCAGAATAAGGG + Intergenic
1058989732 9:110243231-110243253 CTGAGTAAGCAGGAAAATGATGG - Intergenic
1059236415 9:112764139-112764161 ATGTTTGAGCTGGAGAATGAAGG + Intronic
1062529911 9:136995284-136995306 CTGGGGAAGCTGCGGGATGAGGG + Exonic
1186102983 X:6176383-6176405 CTGTGTGGTCTGCAGAATAACGG + Intronic
1186629299 X:11331650-11331672 CCCTGTAAGCTGCAAAGTGAAGG + Intronic
1187704510 X:21996168-21996190 CTGTGTAAGATATAAAATGATGG + Intergenic
1189611982 X:42746738-42746760 CTGTCTCAGCTGCAGAATTGTGG + Intergenic
1191199505 X:57763989-57764011 CTCTGGAAGATGCAGCATGAAGG + Intergenic
1191641673 X:63433857-63433879 CAGTATAAGCTGGACAATGATGG - Intergenic
1196619190 X:117803151-117803173 TTGTGTAAGTTGCAGAGTGTAGG + Intergenic
1196718165 X:118829058-118829080 CTATGCAAGCTGGAGAATGTTGG - Intergenic
1199837866 X:151611490-151611512 CTGTGTAGGAGGCAGAATAATGG + Intronic
1200166873 X:154042001-154042023 CAGTATTAGCTGCAGAATTACGG + Intronic
1201961684 Y:19687885-19687907 CTGTGTAAGTAACAAAATGAAGG - Intergenic
1202301153 Y:23415892-23415914 CTGAGCAAGCTGAAGAATGGAGG + Intergenic
1202569658 Y:26254706-26254728 CTGAGCAAGCTGAAGAATGGAGG - Intergenic