ID: 1018311364

View in Genome Browser
Species Human (GRCh38)
Location 6:162513150-162513172
Sequence CAGAGGAAGCAGCATGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 548
Summary {0: 1, 1: 0, 2: 7, 3: 59, 4: 481}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018311360_1018311364 9 Left 1018311360 6:162513118-162513140 CCTGAAAGGAAAGGTGGAAATTA 0: 1
1: 0
2: 6
3: 48
4: 392
Right 1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG 0: 1
1: 0
2: 7
3: 59
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018311364 Original CRISPR CAGAGGAAGCAGCATGACCA AGG Intronic
900196799 1:1380767-1380789 CACAGGCAGCTGCATGAACAGGG - Intergenic
900390087 1:2430047-2430069 CAGAGGAAGCCAGAAGACCAGGG - Intronic
900929322 1:5726358-5726380 CAGAGGCAGCTGCAGGAGCAAGG + Intergenic
900929435 1:5726926-5726948 CAGAGGCAGCTGCAGGAGCAAGG - Intergenic
901491810 1:9600592-9600614 CTGGGGAAGCAACATGCCCATGG - Intronic
902178621 1:14670442-14670464 CAGTGGCAGCAGCATCACCTAGG - Intronic
902408139 1:16197601-16197623 CAGAGAAGGCAGTGTGACCACGG + Intergenic
902575996 1:17377995-17378017 CAGAAGCAGCAGGATGACCCAGG - Intronic
902690280 1:18106803-18106825 CAGAAAAACCAGCACGACCAGGG - Intergenic
902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG + Intergenic
902839376 1:19065556-19065578 CTGGGGAAGCAGCTTGTCCAAGG + Intergenic
903219529 1:21861328-21861350 CAGAGGGAACAGCATAAGCAAGG + Intronic
904261193 1:29288750-29288772 CAGAGGAAGTTCCAGGACCAGGG + Intronic
904419406 1:30381974-30381996 CAGAGGAGGAAGCATGGGCAGGG + Intergenic
904480239 1:30788771-30788793 CAGAGGGAACAGCATGTACAAGG + Intergenic
904810617 1:33161292-33161314 CAGAGGGAGCCGCATGAGGAAGG + Intronic
904819805 1:33234631-33234653 GAGAGGAAGCAGGAGGAACAGGG + Intergenic
905013786 1:34763479-34763501 CAGAGGAAATAGCATGACAAAGG - Exonic
905101154 1:35523169-35523191 TAGAGGAGGCAGCATGTCAAAGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906612507 1:47213207-47213229 GAGGGGAAGCAGCTTGACTAAGG - Intergenic
906616164 1:47234267-47234289 CTGAGGAAACAGCTGGACCAAGG + Intergenic
906819615 1:48915613-48915635 CAGCGGAATCAGCATCACCTGGG + Intronic
907184320 1:52598197-52598219 TAGAGGAAGCAGCAAGTACAAGG - Intergenic
907472594 1:54683671-54683693 CAAAGCAAGCAGGAGGACCATGG - Intronic
907913297 1:58846101-58846123 CAGAGGAAACAGCATGGGGAAGG - Intergenic
907927914 1:58972053-58972075 CAGAGGGAACAGCATCACCAGGG - Intergenic
908060283 1:60340828-60340850 CAGAGGAAGCTGCACCAGCAAGG + Intergenic
908393624 1:63705457-63705479 CTGAGGAAGCAGTATGAACAAGG - Intergenic
908499961 1:64733333-64733355 CAGAGAAGGCAGCAGGACAAAGG - Intergenic
909498312 1:76304516-76304538 CAGGAGGAGCAGCATGAACAAGG + Intronic
910066495 1:83158765-83158787 CAGAGGTAGGGGCATGGCCAGGG - Intergenic
910136527 1:83978354-83978376 TAGAGGAAACAGCCTAACCAAGG + Intronic
910146386 1:84085521-84085543 CACAGGAAGCAGCAAGATGAGGG + Intronic
910214576 1:84830248-84830270 CAGAGGAAGTATAATTACCAAGG - Intronic
911137621 1:94458079-94458101 GAGAGTAAGCAGTATGCCCAAGG - Intronic
912251198 1:108014212-108014234 CAGAGGAAACAGCATGTACAAGG - Intergenic
912330895 1:108819167-108819189 GAGATGATGCAGCTTGACCAAGG - Intronic
912809041 1:112779934-112779956 CAGAGTCAGGAGCATGACTATGG - Intergenic
912839585 1:113027253-113027275 CAGGCCAAGCAGCATGTCCAAGG - Intergenic
913234854 1:116770972-116770994 TAGAGGCAACAGCATGAGCAAGG + Intergenic
913968834 1:143398533-143398555 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914063213 1:144224132-144224154 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
914115937 1:144742222-144742244 AAGAGGAAGCAGCAAGTGCAAGG + Intergenic
914675304 1:149903621-149903643 CACTGGACGCAGCATGACGAAGG + Exonic
916662352 1:166934523-166934545 CAGAGGTGGCACCATGACAAAGG - Intronic
917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG + Intergenic
917809339 1:178642338-178642360 CAGTGGAAACAGCAAGACCCCGG - Intergenic
918499331 1:185176426-185176448 CAGAGGGAGCTACATGAGCAGGG + Intronic
918543666 1:185658693-185658715 CAGAGAAAACAGCATGGCAAAGG - Intergenic
919659006 1:200225000-200225022 CAGTGGGAGGAGGATGACCAAGG - Intergenic
919711969 1:200738129-200738151 CAGAGGAACCACCCTGAGCAAGG + Intergenic
920630996 1:207651453-207651475 CTGAGGCAGGACCATGACCAGGG + Intronic
921046850 1:211483966-211483988 CAGAGGGAGGAACATGACAAAGG - Intronic
921558912 1:216633273-216633295 CGGAGGAGACAGCATGAGCAAGG + Intronic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923247699 1:232148823-232148845 CAAAGGAAGCAGCATGTCTAGGG - Intergenic
924580734 1:245321851-245321873 CATAGAAAGCAGCATCACCTTGG + Intronic
1062848552 10:726266-726288 CAGGGTAAGCAGCTTCACCAGGG - Intergenic
1064055222 10:12091515-12091537 CACAGAAAGAAGCATCACCATGG - Exonic
1065172241 10:23043062-23043084 CAAAGCAAGCAGCATGAGCCAGG + Intergenic
1065232441 10:23612230-23612252 CTGGGGAAGGGGCATGACCATGG + Intergenic
1065944401 10:30593708-30593730 CAGAGAAGGCAGAGTGACCAAGG - Intergenic
1066391602 10:34981270-34981292 CAGAGGAAAGAGTAAGACCATGG + Intergenic
1066662237 10:37747994-37748016 GAGAGGAAGCAGCGTACCCACGG - Intergenic
1067528794 10:47055548-47055570 CAGAAGCAGCAGCCTGGCCAAGG + Intergenic
1068391650 10:56405712-56405734 CAGAGGAAAGAGGATAACCATGG - Intergenic
1068558627 10:58486566-58486588 AAGGGGAAGCAACATAACCAAGG - Intergenic
1069021192 10:63490202-63490224 TAAAGGAAGCAGCATGTGCAAGG - Intergenic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070680467 10:78445571-78445593 CAGAGGCAGGGGGATGACCAGGG - Intergenic
1071170749 10:82860916-82860938 CAAAGCAAGCAGTATGCCCAGGG - Intronic
1072432432 10:95384948-95384970 CAGAGGAAGCCGTTTGACGATGG - Intronic
1073066062 10:100759850-100759872 AAGAGGGAGCACCAAGACCAGGG - Intronic
1073308182 10:102519641-102519663 CAGAAGCAGCAGCATGACCATGG - Intronic
1073310377 10:102535770-102535792 CAGAGGAAGGGGCCTGACCTTGG + Intronic
1073467898 10:103704871-103704893 CTGAGCAGGCAGCATGACCTGGG + Intronic
1074120295 10:110489068-110489090 CAGTAGAATCAGCATGACCAGGG + Intergenic
1074158430 10:110817785-110817807 CAGAGGAAGCAGCATGCACAAGG + Intronic
1074361844 10:112830067-112830089 GAGAGGTGGCAGCTTGACCAGGG - Intergenic
1075285719 10:121184210-121184232 CACAAGAAGCAGCATGCCCAAGG + Intergenic
1075715147 10:124551430-124551452 CAGAGCAGGCAGCGTGAGCAAGG - Intronic
1076049094 10:127318487-127318509 GAGAGGCAGCAGCATGTGCAAGG + Intronic
1076429705 10:130393200-130393222 CCAAGGAATCAGGATGACCAAGG + Intergenic
1078006353 11:7535320-7535342 TTGAGGAAACAGCATGACAAAGG + Intronic
1078864885 11:15288337-15288359 AAGAGGAAACAGCATAATCAAGG + Intergenic
1079289029 11:19169675-19169697 CACAGGAAGCAGCAGAAACAAGG - Intronic
1079787077 11:24686850-24686872 TCGGGGAAGCAGCATGAGCAGGG - Intronic
1080132216 11:28809895-28809917 CAGAGGAAACTGCATAACAAGGG + Intergenic
1080635619 11:34120955-34120977 CAGAGGAAGCAGCATGTGCATGG + Intronic
1082821690 11:57548288-57548310 CAGAGGAAACAGCAGGTGCAAGG - Intronic
1083280969 11:61627138-61627160 CAGAGGCAGGAGCAGGCCCAGGG - Intergenic
1083294891 11:61709982-61710004 GAGAGGAGGCAGCAGGACCAGGG + Intronic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083831082 11:65233990-65234012 CTGAGCAGGCAGCATGTCCAAGG + Intergenic
1084149915 11:67283244-67283266 CACAGCCAGCAGCATGCCCAAGG - Intronic
1084900149 11:72303503-72303525 AAGGGGAGGCAGCATGTCCAAGG - Intronic
1085136081 11:74090029-74090051 CAGAGAAAACAGCAAGACAAAGG + Intronic
1085217740 11:74847491-74847513 CAGAGGAAACAGCATGAAACAGG - Intronic
1085267920 11:75248277-75248299 CAGAGGAAGAAGCATCACGCAGG + Intergenic
1086575889 11:88338516-88338538 GAGAGGAAGCGGCTTGCCCAGGG + Intergenic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1087069926 11:94068189-94068211 TTGAGGAAGCAGCATGAACTGGG + Intronic
1088134462 11:106537450-106537472 CAGAGGGAACAGTATGAGCAGGG - Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089060043 11:115618920-115618942 CAGAGGCAGCAGCAGCACCCAGG - Intergenic
1089399481 11:118156224-118156246 GAGAGGAATCAGCATGCCCCAGG + Intergenic
1089402126 11:118170429-118170451 CAGAGGGAGCAGAATGACCGAGG + Intronic
1089560631 11:119341456-119341478 CAAAGGAAGGAGCATCAGCAGGG - Exonic
1090257744 11:125297736-125297758 CAGAGGAAACAGCATTTTCAAGG - Intronic
1091001956 11:131917305-131917327 CTGAGGAAGTAACATGCCCAAGG - Intronic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1093158836 12:15720785-15720807 CAGAGGGAGCAACATGCCCAGGG - Intronic
1096182709 12:49559410-49559432 CAGAGGAAGCAGCCTAAGAAGGG + Intronic
1096193199 12:49633203-49633225 CAGAGGAACCATCATGAATATGG - Intronic
1096995029 12:55833088-55833110 CAGAGGAGTCATGATGACCACGG - Intergenic
1097100369 12:56584064-56584086 CAGTGGCAGCAGCATCACCTGGG - Intronic
1097122959 12:56750073-56750095 CAGTGGAAACAGCTTGAGCAAGG + Intronic
1099743578 12:86672274-86672296 CAGAGAAAGCAGTATTAACAGGG + Intronic
1100887483 12:99087398-99087420 CGGAGGAAGCAGAATGATCCAGG + Intronic
1101421405 12:104554318-104554340 CAGAGGGAACAGCATGTGCAAGG + Intronic
1101732371 12:107437338-107437360 GAGAGGAGGCAGTGTGACCATGG - Intronic
1102009451 12:109609242-109609264 GACAGGAAGCAGCATGCCTAAGG + Intergenic
1102059492 12:109922143-109922165 CACAGGAAGCAGCCTTCCCAGGG + Intronic
1103244225 12:119441496-119441518 CAGAAGAAGGAACATTACCAAGG + Intronic
1104367762 12:128193278-128193300 CAGAGGAAGGAGCCTGGCCCCGG + Intergenic
1104757176 12:131276605-131276627 CAGAGGCAGCCTCCTGACCACGG - Intergenic
1104970111 12:132527281-132527303 CAGAGGAGGCAGGAAGACCTGGG - Intronic
1106141869 13:27018628-27018650 CAGAGGTCACAGCATGACAAGGG - Intergenic
1107636060 13:42393805-42393827 CAGAGGAAGCCACGTGACCCAGG + Intergenic
1108774759 13:53751965-53751987 AAGAGGAAGCAGCAAGACAAAGG + Intergenic
1108935321 13:55874817-55874839 CAGAGGAAGGGGGATGACAAAGG + Intergenic
1109247367 13:59971826-59971848 CAGAGGGACCAGCATGTACAAGG - Intronic
1110593490 13:77292257-77292279 CAGAGCAAGCAGCAGGAAAAAGG - Intronic
1110616842 13:77551138-77551160 GAGAGGATGCAACATGTCCAAGG - Intronic
1111030558 13:82592235-82592257 CAGAGGCAGCAGCATGGCTGGGG - Intergenic
1112462241 13:99613392-99613414 GTGAGGAAGCAGCAGGGCCATGG + Intronic
1112475640 13:99729039-99729061 CAGAGAAAGCAGAATGGCCAGGG + Intronic
1112914965 13:104536979-104537001 GAGAGAAAGCAACATGACAAAGG + Intergenic
1113625997 13:111846937-111846959 GACAGGAAGCAGCTTGCCCAGGG + Intergenic
1114483753 14:23050845-23050867 CTGAGGATGCAGCATGGGCAGGG + Intronic
1115415391 14:33126562-33126584 CAGAGCAAGAGGCATGAACATGG + Intronic
1116996774 14:51332989-51333011 CAGAGGAGGCAGCAGGGCCAGGG - Intergenic
1117341143 14:54792606-54792628 CTGGGGAAGCAGCCTGACCAAGG + Exonic
1118495602 14:66305382-66305404 CTGAAGAAGCAGCAAGGCCAAGG - Intergenic
1119601750 14:75981325-75981347 AAGAAGAAGCAGAAGGACCATGG + Intronic
1120853963 14:89196779-89196801 CAGAGGAAGCGGAATGAACATGG - Intronic
1120927374 14:89811127-89811149 CAGAGGGAACAGCATGTGCAAGG + Intronic
1121414609 14:93770484-93770506 CAGAGGAAACAGCATGTGCAAGG - Intronic
1121585206 14:95058595-95058617 CAGAGGAAGCTGCATGTCAAAGG + Intergenic
1122147051 14:99697710-99697732 CAGAGGAAGCAGCAAGGCACTGG + Intronic
1123443360 15:20305200-20305222 CCAAGGCAGCGGCATGACCAGGG + Intergenic
1124135611 15:27033269-27033291 CAGAGGCAGCAGGCTCACCATGG - Intronic
1125748558 15:42013442-42013464 CCGAGGGAACAGCATGAACAAGG + Intronic
1126244295 15:46486139-46486161 GAGAGGAAGCAGGATGTGCAAGG - Intergenic
1126475221 15:49058792-49058814 CAGTGGAAGCAGCAAGGCCAAGG - Intergenic
1126807558 15:52367164-52367186 CAGAGGAAGCCTGATGACCAAGG + Intronic
1126903877 15:53343742-53343764 CATGGTGAGCAGCATGACCAGGG - Intergenic
1126953559 15:53909893-53909915 CAGAGGAAGCAGTGTTACCTCGG + Intergenic
1127278922 15:57472230-57472252 CAGAGGAAATAGCATGTGCAAGG + Intronic
1127650957 15:61006600-61006622 CAGAGGAAGGAGCAACAGCATGG - Intronic
1127716174 15:61651374-61651396 CTGATGAAGCAGCATAGCCACGG + Intergenic
1127761331 15:62142374-62142396 CAGAGGAAGCTACAAGAACAAGG - Intergenic
1128515745 15:68340829-68340851 AAGAGGAAGGAAAATGACCAGGG + Intronic
1129322156 15:74781501-74781523 CAGAGGGAACAGCATGCACAAGG - Intergenic
1129452693 15:75659668-75659690 CAGAGCAGGAAGCATGAGCAGGG - Exonic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129931235 15:79412620-79412642 CAGTGGAGGCAGCATGACATGGG - Intronic
1130145156 15:81268492-81268514 CAGAGGAAGCAGCAGGGCATGGG - Intronic
1130926235 15:88387934-88387956 CAGGGGAGCCAGGATGACCAGGG + Intergenic
1131546862 15:93322826-93322848 CAGCGGAAGTAGCATGGCCCAGG - Intergenic
1132359463 15:101200798-101200820 CCCAGCAAGCAACATGACCAGGG - Intronic
1133639650 16:7704550-7704572 GAGAGGAGGCAGCAAGACAAAGG - Intronic
1133778389 16:8916985-8917007 AAGAGGAAGCAGAATGGCAAAGG + Intronic
1133830106 16:9315069-9315091 CAGAGGACAAAGGATGACCAGGG + Intergenic
1134254456 16:12600262-12600284 CAGAGGCGGCAGCATGGCCAGGG + Intergenic
1134628082 16:15737184-15737206 AAGAGGCAGCAGCAACACCATGG + Intronic
1135571085 16:23549779-23549801 CATAGTGAGCAGAATGACCAGGG - Intronic
1135651131 16:24207855-24207877 CAGAGGAGGCAGCCTGTGCAAGG + Intronic
1136050541 16:27646932-27646954 CAGAGGAAGCTGCAGGGCCTGGG + Intronic
1136079572 16:27842853-27842875 CAGAGGGAACAGCAGGTCCAAGG - Intronic
1136377158 16:29872456-29872478 TAGAGGCAGCAGGATGGCCAGGG + Exonic
1136521964 16:30802607-30802629 CAGAGCCAGCAGCATGGCCAAGG + Intergenic
1137918173 16:52455741-52455763 CAGAGGGAACAGCATGTGCAAGG + Intronic
1137983826 16:53091303-53091325 CAGAGAGAGCAGCTTGCCCAAGG - Intronic
1138248758 16:55486293-55486315 CAGAGGCAGCATCAGGACCAAGG - Intronic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138688491 16:58747073-58747095 CAGAGGCAGCAGCCTGTCCTGGG + Intergenic
1138789546 16:59887152-59887174 CAAAGGAAAGAGCATGACTATGG - Intergenic
1139002093 16:62524443-62524465 CAGAGGGAGTTGCATGAGCATGG + Intergenic
1140043316 16:71423985-71424007 GAGGGGAGGCAGCAGGACCAGGG - Intergenic
1140275235 16:73502964-73502986 CAGTGGATGCACCATGAACAGGG - Intergenic
1140350464 16:74257579-74257601 CAGAGACAACAGCATGAGCAAGG + Intergenic
1140738054 16:77916267-77916289 TAGAGGAGGCAGCATTTCCAAGG - Intronic
1140863972 16:79043703-79043725 CAGAGGAAGATTCATAACCAGGG + Intronic
1140955420 16:79860474-79860496 CAGAGGCAGCTGCATGACAGAGG + Intergenic
1141743592 16:85910941-85910963 CTGAGGAAGCGGCATGAGAAGGG + Intronic
1141939605 16:87266030-87266052 CAGAGGAAGCAGGAGAGCCAGGG - Intronic
1143861783 17:9896689-9896711 GACAGGAAGCAGCTTGCCCAAGG - Exonic
1144854524 17:18260689-18260711 CGGAGGAGGCAGCGGGACCACGG - Intronic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145900698 17:28488860-28488882 CAGAAGAAGGAGCAGGACCTGGG - Intronic
1146257534 17:31400343-31400365 CAGAGGCAGGAGCCTGCCCAGGG + Intronic
1146520379 17:33521493-33521515 CAGAAGTAGCCACATGACCAAGG + Intronic
1146555238 17:33817380-33817402 CAGAGGGAGTAGCATGACAAAGG - Intronic
1147119941 17:38330013-38330035 CAGAGGCAGGAGGATGACCCAGG - Exonic
1147523033 17:41192781-41192803 CAGAGGACGCAGCAGTACGAAGG + Intronic
1147575037 17:41594091-41594113 CAGGGGAAGGAACATGTCCAAGG + Intergenic
1147632343 17:41940210-41940232 CAGGGGAAGCAGCAGGACTCAGG - Intronic
1147987427 17:44314693-44314715 CAGAGGATGCAGCAGGCCCCTGG - Intronic
1148805376 17:50261217-50261239 CAGAGGGAGCAGCATTTGCAAGG + Intergenic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1148999476 17:51742210-51742232 TAGAGGGAGCAGCTTCACCATGG + Intronic
1149321204 17:55483130-55483152 CATAGGAAGCAGCAGAACCAGGG + Intergenic
1150611853 17:66739687-66739709 CAGAGGCAGAAGCAAGTCCAGGG + Intronic
1150859567 17:68787280-68787302 CAAATGAAGCAGCCTCACCAAGG - Intergenic
1151402765 17:73866696-73866718 GAGAGGAGGCAGCATCACCCGGG + Intergenic
1151573530 17:74939385-74939407 CAAGGGCAGCAGCAGGACCAAGG + Intronic
1151803402 17:76390910-76390932 CAGAGGAAAGAGCATCACCGTGG - Exonic
1152095067 17:78267944-78267966 AGGAGGAAGCAGCGTGACCTTGG + Intergenic
1152602317 17:81270598-81270620 CAGAGGTGGCAGCAGGTCCATGG + Intronic
1153176184 18:2376381-2376403 CAGAGGGAGCAACATGACCCTGG + Intergenic
1155044350 18:22090705-22090727 CAGAGGAAGCAGAATAAACCAGG + Intronic
1155224091 18:23713281-23713303 TAGAGGAACCAGCACGAGCAAGG - Intronic
1157108081 18:44793468-44793490 CAGAAGCAGCAGCATTACCTGGG + Intronic
1157313867 18:46572456-46572478 CAGAGGAAGCAACATATCCTGGG + Intronic
1157738436 18:50071166-50071188 CAGAGGAACCAGCATGAGCAAGG - Intronic
1157991115 18:52497759-52497781 CAGTAGCAGCAGCATCACCACGG + Intronic
1158673038 18:59494062-59494084 CTCAGGAAGCAGCATGAAAATGG + Intronic
1160162161 18:76481490-76481512 CAGGGTAACAAGCATGACCAGGG + Intronic
1160394459 18:78561719-78561741 CAGGGGGAGCTGCATGGCCAGGG - Intergenic
1160394465 18:78561737-78561759 CAGGGGGAGCTGCATGGCCAGGG - Intergenic
1160394471 18:78561755-78561777 CAGGGGGAGCTGCATGGCCAGGG - Intergenic
1160571259 18:79819114-79819136 CAGAGGAGGCAGCAGCTCCACGG + Intergenic
1160908778 19:1465304-1465326 CAGATTACGCAGCATGCCCACGG - Exonic
1161003495 19:1923117-1923139 GGCTGGAAGCAGCATGACCACGG - Exonic
1161384624 19:3984422-3984444 CAAACGAACCAGCATGCCCAAGG + Intronic
1161569988 19:5025280-5025302 CAGAGGAAGCTGGGAGACCAGGG - Intronic
1161570174 19:5026205-5026227 CAGAGGAAGCTGGGAGACCAGGG - Intronic
1162858994 19:13491434-13491456 AAGAGGAAGCACCATGTCCCAGG - Intronic
1163177736 19:15576256-15576278 CAGAGGAAGCAAGGAGACCATGG + Intergenic
1164676269 19:30103848-30103870 CAGAGGCAGCAGGAACACCAGGG - Intergenic
1164764360 19:30752465-30752487 CCCAGGAAGAAGCATGACCTTGG + Intergenic
1164794596 19:31015607-31015629 CAGAAGGGGCAACATGACCAGGG + Intergenic
1165137883 19:33681831-33681853 CAGTGGAAGCAGCTTGAACAAGG - Intronic
1165432726 19:35781709-35781731 CAGAGGGAGCAGCAGGGCAAAGG + Intronic
1166051506 19:40263512-40263534 AAGAGGAAGCAGCAGAACCAGGG + Intronic
1166567538 19:43774395-43774417 GAGACGCAGCAGCATGGCCAGGG + Exonic
1167120232 19:47512355-47512377 CAGAGGAAGCAGCGTGAACCAGG - Intronic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1167736227 19:51296085-51296107 CAGAGCAAGCAGCATTTCTAGGG + Intergenic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
1202702625 1_KI270712v1_random:176003-176025 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
925173815 2:1768517-1768539 CAGAGGGAGCAGCATGAAATAGG - Intergenic
925998331 2:9310023-9310045 CAGAGGCTGCAGCATTAACAAGG - Intronic
926935748 2:18085379-18085401 CAGAGGAAGGAGGATGCCAAGGG + Intronic
927339499 2:21966331-21966353 CTGAGCAAGCAGCAGGAACAAGG + Intergenic
927701914 2:25274501-25274523 CAGAGGAAACAGCACCAGCAAGG - Intronic
928360007 2:30655132-30655154 CAGGGGAAGCAACTTGGCCAAGG - Intergenic
929245496 2:39697737-39697759 CAGAGGAAGCAGGAGAACCCTGG + Intronic
930186270 2:48415214-48415236 CAAGGGAAGCAGCATGCACAGGG + Intergenic
930841235 2:55848192-55848214 CACAGGAAGAAGTATGTCCAAGG + Intergenic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
932238238 2:70138290-70138312 CAGGAGCAGCAGCCTGACCAAGG + Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934165300 2:89288813-89288835 CAGAGACAGCAGCATGACCATGG - Intergenic
934173535 2:89559456-89559478 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
934201974 2:89893649-89893671 CAGAGACAGCAGCATGACCATGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
934283849 2:91633809-91633831 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
936151011 2:110022547-110022569 CAGAAGCAGCAGCAGGGCCAGGG - Intergenic
936193666 2:110348822-110348844 CAGAAGCAGCAGCAGGGCCAGGG + Intergenic
937214027 2:120299215-120299237 CAGATGGAGCAGCAGAACCACGG - Intergenic
937224560 2:120360807-120360829 CAGAGGAAGCGACTTGCCCAGGG + Intergenic
937549365 2:123067911-123067933 GAGATCAAGCAACATGACCAAGG - Intergenic
938081820 2:128374243-128374265 CAGAGGCAGCAGGAGCACCAAGG + Intergenic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939076552 2:137609469-137609491 CAGAGGGAACAGCAAGATCAAGG + Intronic
939427810 2:142062333-142062355 TGGAGGCAGGAGCATGACCAAGG + Intronic
943936906 2:193930419-193930441 CAGAGATAGCAGCATGGACAAGG + Intergenic
944465727 2:199997708-199997730 CTGAGGAATCTGCAGGACCAAGG + Intronic
944634107 2:201657841-201657863 GAGAGTAAGGAGCATGAGCAGGG - Intronic
944869636 2:203896934-203896956 CAGAGGAAGGAGCTTGAGAAAGG + Intergenic
945177153 2:207054212-207054234 AAGAGGAGGCAGGATGACCATGG + Intergenic
946134526 2:217634886-217634908 CAGAGGGAGCACCAGGACAAAGG + Intronic
946877294 2:224142085-224142107 CAGGGGAAGCACAATGACTAGGG + Intergenic
947327647 2:228995167-228995189 GAGAGTAAGAAGCATGAACAAGG + Intronic
947506405 2:230711578-230711600 CAGAGGGAATAGCAGGACCAAGG - Intergenic
947882899 2:233535523-233535545 AAGAGGAAGGACCATGACCCAGG + Intronic
948282800 2:236760912-236760934 CAGAAGACTCAGCATGACAAAGG + Intergenic
948844559 2:240676907-240676929 CAGAGAGAGGGGCATGACCAGGG - Intronic
948849301 2:240697972-240697994 CAGAGAGAGGGGCATGACCAGGG + Intronic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1170356318 20:15495939-15495961 AAGAGGAAAGAGCATGAGCAAGG + Intronic
1170367256 20:15611366-15611388 CAGAGGAAGCTGGATGCCAATGG - Intronic
1170383756 20:15793338-15793360 CAGAGGCAGCAGTATCACCTGGG - Intronic
1170457192 20:16544243-16544265 CAGAAGGACCAGCATGAGCAAGG - Intronic
1170651379 20:18245596-18245618 CAGAGGGACCAGCATGTTCAAGG - Intergenic
1171154505 20:22859778-22859800 CAGAAGAAACAGCATGTGCAAGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1172014123 20:31862891-31862913 CAGAGGGAACAGCATGGCAAAGG - Intronic
1172459349 20:35104251-35104273 CAGAGGCAACAGCATTACCAAGG - Intergenic
1172582820 20:36061994-36062016 AAGAGGAAGCAATGTGACCATGG - Intergenic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1173552721 20:43944470-43944492 CAGAGGGAACAGCATGAAAAAGG + Intronic
1173917581 20:46719906-46719928 GAGAAGAAGCAGCTTGCCCAGGG + Intronic
1174050481 20:47764071-47764093 CAGAGGGAGCAGCAAGTTCAAGG - Intronic
1174438339 20:50528075-50528097 CAGAGGAAACAGCATATGCAAGG - Intronic
1175194804 20:57235656-57235678 CAGAGGCAACAGCATGATCGAGG + Intronic
1176379195 21:6103349-6103371 CAGAGGCAGCAGCAGGGGCAGGG + Intergenic
1179121444 21:38549908-38549930 CAGAGGCATCTGCATGGCCAAGG - Intronic
1179744278 21:43434888-43434910 CAGAGGCAGCAGCAGGGGCAGGG - Intergenic
1179889739 21:44329509-44329531 CACAGGAAGCAGCTAGACTAGGG - Intronic
1180141157 21:45893972-45893994 CAGAGGTGGCAGCAAGGCCAGGG + Intronic
1181039020 22:20183264-20183286 CACAGGAAGCATCATGAGCCAGG - Intergenic
1181260174 22:21591756-21591778 CAGAGGAAGCAGCCTGGCGAAGG + Intronic
1181523867 22:23467070-23467092 CAGAGCCAGCACCAGGACCAAGG + Intergenic
1181949472 22:26543697-26543719 GAGATGAAGCAGCTTGCCCAAGG + Intronic
1182015790 22:27038648-27038670 CAGAGGAAACAGCAGGTGCAAGG + Intergenic
1182483007 22:30621933-30621955 AGGAGAAAGCAGCATGATCAGGG - Intronic
1182626182 22:31648221-31648243 CAGGGGACGCAGCAGGAACATGG + Intronic
1183060566 22:35334147-35334169 AAGAGGAAGCCGCTTGCCCAAGG + Intronic
1183373732 22:37450153-37450175 GAGGGGAAGCAGCTTGCCCATGG - Intergenic
1183664783 22:39241072-39241094 CAGAGGAAGCTGGATGGCAAAGG + Intronic
1183670172 22:39268239-39268261 CAGAGGAAGGAGCGTGGGCATGG - Intergenic
1183724568 22:39581259-39581281 CTGAGGAAGCAGCCTGATCAAGG + Intronic
1184695775 22:46138366-46138388 GAGAGGAAGAGACATGACCATGG + Intergenic
949411187 3:3766258-3766280 CTGAGAAAGTAGCATGGCCATGG - Intronic
949787449 3:7757586-7757608 AAGAGGAGGCAGTGTGACCATGG + Intergenic
949944194 3:9177366-9177388 CAGAGGGAGCAGCAAGTTCAAGG + Intronic
950156670 3:10726161-10726183 CAGAGGCAACAGCATTACAAAGG - Intergenic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
950825054 3:15809929-15809951 CAGAGGAAACAGCATCTGCAAGG - Intronic
952660833 3:35844767-35844789 TAGAGTAACCAGAATGACCAAGG - Intergenic
952877009 3:37954577-37954599 CAGAGGAAGAAGGAAGGCCATGG + Intronic
952943330 3:38459567-38459589 CAGGGGAAGGGGCATGCCCACGG - Intronic
953503580 3:43461682-43461704 CTGAGGAAGCCTCATGATCATGG - Intronic
953503911 3:43464057-43464079 CTGAGGAAGCCTCATGATCATGG - Intronic
953875183 3:46662578-46662600 GAGAGGCAGCAGGAAGACCAGGG + Intergenic
954070634 3:48140367-48140389 CGGAGGGAGCAGCATGTTCAGGG + Intergenic
954383028 3:50229660-50229682 CAGAGGCAGCAGCAAGTGCAAGG - Intronic
954862728 3:53703990-53704012 CAGAAGAAGCACCCTGACCCAGG + Intronic
955177498 3:56631321-56631343 TAGAGGAAGCAGAGGGACCATGG - Intronic
955981243 3:64529742-64529764 CAGGGGCATCAGCATCACCAGGG + Intronic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
957137418 3:76307164-76307186 CTGAGGAAATAGCATGAGCATGG - Intronic
957243512 3:77689256-77689278 CAGAGGAATCTACATGAACAAGG + Intergenic
957311667 3:78527742-78527764 AAGAGAAAGGAGCATGACCAGGG + Intergenic
958192730 3:90204212-90204234 CTGAGGAAGCTGCAGGACCAGGG - Intergenic
958416148 3:93876142-93876164 CTGAGGAAGCTGCAGGACCAGGG - Intronic
958669129 3:97180380-97180402 CTTAGGTACCAGCATGACCATGG - Intronic
959274227 3:104257355-104257377 CAGAAGAACCAGCAGGAGCAAGG + Intergenic
959561011 3:107781246-107781268 CAGAGATAGTAGGATGACCATGG - Intronic
959831693 3:110870277-110870299 CAGAGGAGGCAACTTCACCAAGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961455066 3:127019956-127019978 CAGAGAAAGCATCAGCACCAGGG - Intronic
961492477 3:127265153-127265175 CAGAGGGAGCGGCAGGGCCAGGG + Intergenic
961630459 3:128294756-128294778 CAGAGGAAACAGCATATGCAAGG + Intronic
961656283 3:128443927-128443949 CAGAGGGAACAGCATGTGCAAGG + Intergenic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962207302 3:133445466-133445488 CAGTGGCAGCAGCATCACCTGGG - Intronic
962622140 3:137190578-137190600 CAGAGGAGGCTGGATCACCAGGG - Intergenic
963543128 3:146620256-146620278 AAGAGGAAGACGAATGACCAAGG - Intergenic
963771750 3:149393296-149393318 CAGAGGAAGTAGCATGGGAAAGG - Intergenic
964654104 3:159047527-159047549 CAGAGGAAGCGGCATTATAAAGG + Intronic
965670093 3:171138976-171138998 AAGTGGAAGCTGCATGAGCAAGG + Intronic
967655449 3:192042835-192042857 CAGAGAAAGAGACATGACCATGG + Intergenic
968878074 4:3284739-3284761 CAGAGGTAGCAGCCAGGCCACGG + Intergenic
969158349 4:5232971-5232993 CAGAGGATGCACAATTACCAGGG - Intronic
969827395 4:9768272-9768294 AAGAGGAAGCAGCAAGTGCAAGG - Intergenic
969889094 4:10243192-10243214 GAGAGGAAGTAGCATGACATTGG - Intergenic
970342628 4:15122302-15122324 AGGATGAAGCATCATGACCAAGG - Intergenic
970422485 4:15918526-15918548 CAGAGAGAACAGCATGAGCAAGG - Intergenic
971155414 4:24076272-24076294 TAGATGAAGCAGCTTGCCCAAGG + Intergenic
971636557 4:29067600-29067622 CACAGAAGGCAGCATGCCCAAGG + Intergenic
972199483 4:36696851-36696873 CAAAGGAAGCAGAATGGGCAAGG - Intergenic
972352668 4:38251465-38251487 CAGAGGAAGGATTATGAGCAGGG - Intergenic
973846084 4:54914516-54914538 CAGATAAAGGGGCATGACCAGGG - Intergenic
974281645 4:59802824-59802846 CAAAGAAAGCAACATGATCACGG + Intergenic
974886784 4:67828997-67829019 GAGAGGAATGAGCATGAGCATGG - Intronic
975523990 4:75329433-75329455 CAGAGAAAATAGCATGTCCAAGG - Intergenic
975619004 4:76276777-76276799 CTGAGGCAGAAGCATGACAAGGG + Intronic
975940504 4:79638921-79638943 CAGAGGGAGCAGCAGGTGCAAGG - Intergenic
976584330 4:86778371-86778393 CATAGCAAGCAGCATGAGCATGG + Intronic
977140785 4:93369235-93369257 AAGAGGAGGCAACATGGCCATGG - Intronic
978367798 4:108000758-108000780 CAGAGGAAACCACATGAACAAGG + Intronic
979710097 4:123769466-123769488 AAAAGGAAACAGCATGGCCATGG + Intergenic
981671094 4:147287773-147287795 CAGCAGCAGCAGCATGACCTGGG + Intergenic
982112125 4:152066347-152066369 CAGAGGAGACAGCATGAACAAGG - Intergenic
982168342 4:152636958-152636980 CAGAGGAAGAATCATGCACAAGG + Intronic
982449403 4:155534062-155534084 CAGAGGAAACAGGATGAGCTGGG - Intergenic
984848140 4:184125318-184125340 CAAAGACAGCAGCTTGACCAAGG + Intronic
985145056 4:186887920-186887942 CTTAGGAAGCAGCATGAGAAGGG + Intergenic
985538535 5:477301-477323 CCAGGGAAGCTGCATGACCATGG + Intronic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
986323359 5:6652118-6652140 CAGAGAAAGCAGCAGCACCCCGG + Intronic
986618650 5:9646654-9646676 GAGAGGCAGCAGCAAGACCCAGG - Intronic
987677303 5:21091089-21091111 CACAGGATGCATCTTGACCATGG - Intergenic
987778056 5:22395228-22395250 AGGAGGATGCAGTATGACCATGG + Intronic
988673717 5:33409564-33409586 CAGAGGAGGCAGCTTGCCAAGGG - Intergenic
989564395 5:42887376-42887398 GAGAGGCAGGAGCATGACGAGGG - Intronic
990345045 5:54863520-54863542 CAAAGGGAACAGCATGGCCAAGG - Intergenic
991406477 5:66305397-66305419 CAGAGGGAACAGCATGTGCAAGG + Intergenic
991932446 5:71766763-71766785 AAGAGGAATCTGCAAGACCAAGG - Intergenic
992415278 5:76546716-76546738 CAGTGCAAGCGGCAAGACCAAGG - Intronic
993015814 5:82533291-82533313 CACATGAAGGAGCATGAGCATGG + Intergenic
993972100 5:94432225-94432247 CAGCGGGAGCAGCATCACCTGGG + Intronic
994818632 5:104618813-104618835 AAGAGAAAGCACCATGATCAAGG + Intergenic
995010505 5:107252475-107252497 CAAAGGAAGCAAGATGACAAGGG + Intergenic
995060426 5:107807146-107807168 CAGAGGAAACAGCTAGAACAAGG + Intergenic
995240215 5:109877048-109877070 GAGAGGAGGCAACATGACCATGG + Intergenic
996299012 5:121959571-121959593 CAGAGGAAGCATCATAGCTAAGG + Intergenic
996385607 5:122906924-122906946 CAGAGTAAGCTGCATGAGCAGGG - Intronic
997064381 5:130544727-130544749 CAGAGGAAGGAGGATGCCAAGGG + Intergenic
998965710 5:147538468-147538490 CAGAGAAAACAGAATGAACATGG - Intergenic
999149233 5:149415797-149415819 CAGAGGAAGCTGCATGTTCAAGG - Intergenic
1001156688 5:169278607-169278629 CAGAGGAAGTAGCAGAAGCAGGG - Intronic
1001225798 5:169943694-169943716 CAGTGGAATCAGCATCACCTGGG + Intronic
1001290330 5:170452822-170452844 CAGAGGAAACAGCGTGATTAAGG + Intronic
1001667104 5:173442466-173442488 CATGGGAAGCAGCATCACAAGGG - Intergenic
1001794440 5:174490353-174490375 CAGAGGCAGCAGCAGGGCCGAGG + Intergenic
1002344193 5:178536443-178536465 CAGAGGAAGCAGCCACACCTGGG - Intronic
1002703272 5:181142370-181142392 CCCTGGAACCAGCATGACCAAGG + Intergenic
1002914000 6:1514365-1514387 TGGATGAAGCATCATGACCAGGG + Intergenic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1005475919 6:26207679-26207701 CACAGGAAAAAGCATGACAAGGG + Intergenic
1005944492 6:30585481-30585503 CAGAGGAAGCAGGCAGACAACGG - Intronic
1006091103 6:31629578-31629600 CAGTGGCAGCAGCATCAACAGGG + Exonic
1006756674 6:36422323-36422345 CAGAGGGAGCAGCTTGTGCAAGG - Intronic
1007272486 6:40649023-40649045 GAGAGCAAGCAGCTTGTCCAAGG - Intergenic
1007829154 6:44625042-44625064 CAGAGGCAGCCCTATGACCAGGG + Intergenic
1008304741 6:49887588-49887610 CCGAGGAAGCAGCATCATCTGGG + Intergenic
1008487262 6:52049892-52049914 CAGCAGAATCAGCATCACCAAGG + Intronic
1009843397 6:69105735-69105757 CAGATGGAGTAGCATGCCCAAGG + Intronic
1010443020 6:75919971-75919993 CAGAGGACCCAGCAGGATCATGG - Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1011215925 6:85005568-85005590 AAGAGGAAGCAGGAGGATCAGGG + Intergenic
1011219072 6:85034968-85034990 CACAGAATGCAGCAAGACCATGG - Intergenic
1011787816 6:90866352-90866374 CATAGGAAGCAGAATGACAGAGG - Intergenic
1012267802 6:97167683-97167705 CAGAGGGAGCAACATGTACAAGG - Intronic
1012490661 6:99779856-99779878 CAGTGGAAGCAGCATGGCCTGGG + Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014742144 6:125158031-125158053 AACAGAAAGCAGCATAACCACGG - Intronic
1014885723 6:126778647-126778669 CACTGGAAGCAGTAAGACCAAGG - Intergenic
1015201443 6:130585987-130586009 CAGAGGCAGCAGCATGAAGCAGG + Intergenic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1016458710 6:144259318-144259340 TAGAAGAAGCAGCATTATCAAGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016685434 6:146876671-146876693 CAGAGGAAGCCTCATGCCAAAGG - Intergenic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1018311364 6:162513150-162513172 CAGAGGAAGCAGCATGACCAAGG + Intronic
1018696547 6:166395874-166395896 CAGAGGAGGCAGCAGAACAAAGG + Intergenic
1019628648 7:2034802-2034824 CAGAGGTAGCACCAAGAACATGG - Intronic
1019640891 7:2103115-2103137 CAGAGGCAGCAGCAAGCGCAGGG - Intronic
1019777985 7:2923714-2923736 CAGAGGAAGGGGCTTGCCCAAGG - Intronic
1019875731 7:3808974-3808996 CTGAGGATCCAGCATCACCAAGG + Intronic
1020507035 7:9003984-9004006 CAGAGGATGCTGTATGACCAAGG - Intergenic
1020600441 7:10268682-10268704 CACAGGAATCAGCATGTCCCTGG + Intergenic
1022302036 7:29110859-29110881 CAGAGAAGGAAACATGACCATGG + Intronic
1022454860 7:30549701-30549723 CAGAGGAATCATCAAGAACAGGG - Intronic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1023047667 7:36224973-36224995 GAGAGAAAGCGACATGACCATGG + Intronic
1023388577 7:39685262-39685284 CAGAGGAAGCTGCATGGCAAAGG + Intronic
1023609388 7:41957956-41957978 AAGAGGCAGCAGCATGGACAAGG - Intergenic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023746378 7:43326380-43326402 CAGAGGCAGCATGATGGCCACGG + Intronic
1024346819 7:48321984-48322006 CAGAGGAAGCTGTTTGAACAGGG + Intronic
1024966331 7:55025280-55025302 CAGAGGATGAAGCAGGAGCAAGG + Intronic
1026203693 7:68237115-68237137 CTGAGGGAGCAGTATGACCCGGG - Intergenic
1027277614 7:76575991-76576013 CAGAGGTAGGGGCATGGCCAGGG + Intergenic
1029570002 7:101363054-101363076 CAGAGGCAGCAACACGCCCAGGG - Exonic
1030773327 7:113502067-113502089 CAGAGGTAGAAGCATGTCAAAGG + Intergenic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1032879884 7:136077768-136077790 CCCAGGAAGGAGCATGGCCATGG + Intergenic
1033549727 7:142436003-142436025 CAGAGGAGGCAACTGGACCAGGG - Intergenic
1033912412 7:146281010-146281032 CAGAGGGAGCAAGATGGCCAAGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034726636 7:153342192-153342214 AAGAGGTAGCAGAATGGCCAAGG + Intergenic
1035455740 7:159007485-159007507 CAGAGGACGCAGCTTTGCCAGGG + Intergenic
1035475488 7:159141130-159141152 CAGAAGCAGCAGCGTGGCCATGG - Intronic
1035565695 8:639308-639330 AAGAATAAGCAGCATGACCTGGG - Intronic
1038175297 8:25176843-25176865 CAGAAGGAGCAGCATAACTAAGG - Intergenic
1038503480 8:28064237-28064259 AAGAGGAAACAGAGTGACCAAGG - Intronic
1040555839 8:48476896-48476918 CAGAGGAGGCTGCATGGCCAGGG - Intergenic
1040821281 8:51560693-51560715 CAGAGAAAGCTCCATGACCTTGG + Intronic
1041007679 8:53511045-53511067 TAGGGGAAGCAGCAGGTCCATGG + Intergenic
1042086844 8:65118807-65118829 CAGAGAAAGAGGCATGGCCAAGG + Intergenic
1043477861 8:80622514-80622536 TAGAGACTGCAGCATGACCATGG + Intergenic
1045242110 8:100411635-100411657 CAGAGGATGCAGTAGGATCAGGG + Intergenic
1046773944 8:118144097-118144119 GGGAGGAGGCAACATGACCACGG - Intergenic
1047521524 8:125598810-125598832 CAGAGGCAGCAGCCAGACCAAGG - Intergenic
1047635468 8:126756868-126756890 CAGAGGAAACAGCACGTGCAGGG - Intergenic
1048975757 8:139672244-139672266 CAGAGGCAGGAGCAGGACCAGGG + Intronic
1049133215 8:140868085-140868107 CTGAGGAAGCTGGATGACAATGG - Intronic
1049377112 8:142294539-142294561 CAGAGGAGGCAGGGTGCCCACGG - Intronic
1049632308 8:143665430-143665452 CTGCGGAAGCTGCATGACCGTGG - Intergenic
1049706835 8:144047056-144047078 CAGAGGAGGCAGCACCACCCAGG - Exonic
1049735303 8:144202034-144202056 AAGAGAAAGCAGCAGGGCCAAGG + Intronic
1049747394 8:144268822-144268844 CAGAGGCAGCAGCAGGGCAAGGG + Intronic
1050914653 9:11116574-11116596 CAGAGGAAGCAATTTGGCCAAGG - Intergenic
1051146275 9:14030920-14030942 TAGAGGAGGCAGCAGGACTAGGG + Intergenic
1051210046 9:14731756-14731778 CAGAGGAATCCACATGACTAAGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052681625 9:31700507-31700529 CTGAGGAAGCACAATGATCAAGG + Intergenic
1053304560 9:36974947-36974969 CAGAGGGAGCAGAATGTCCAGGG - Intronic
1054776757 9:69130534-69130556 CAGCAGCAGCAGCATGACCTGGG - Intronic
1054780933 9:69165465-69165487 CAGAGAAAGCAGTTTGCCCATGG - Intronic
1057487093 9:95494217-95494239 CAGAGGGAGCAGCCTGGGCAAGG - Intronic
1057691277 9:97288717-97288739 CAAAGGAAGCTGCATGGACATGG + Intergenic
1058734323 9:107880117-107880139 CAGTGGAAGCATGCTGACCAGGG + Intergenic
1059691664 9:116690733-116690755 CAGAGAAAGTAGCCTGTCCAAGG - Intronic
1060052989 9:120390331-120390353 AAGGAGAAGCAGCATGCCCACGG - Intronic
1060544381 9:124451673-124451695 CAGAGGAAACAGTAGCACCACGG - Intronic
1060909934 9:127341406-127341428 CAGAGCATGCACCATGGCCAGGG + Intronic
1061363438 9:130157935-130157957 CAGAGGGAGGAGAATGGCCAGGG + Intergenic
1061649761 9:132038090-132038112 AAGAGAAAGCAGCTTCACCAAGG + Intronic
1062477435 9:136735779-136735801 CAGAGGCAGTGGCATGGCCAGGG - Intergenic
1062647409 9:137555787-137555809 CAAAGGAACCAGCAAGACCTGGG + Intronic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1062671139 9:137710049-137710071 CCGACGCAGCAGCAGGACCATGG - Intronic
1186136836 X:6530121-6530143 CAAAGGAAGCTGCATGGTCAAGG + Intergenic
1186267506 X:7848309-7848331 CAGAGGAAGCTGCATGGTCAAGG - Intergenic
1186287910 X:8065477-8065499 CAGAGGAAGCCGCGTCATCAGGG + Intergenic
1186297539 X:8166560-8166582 CAGAGGAAGCTGCATGGTCAAGG + Intergenic
1186376661 X:9010699-9010721 CGGAGGAAGCTGCATGGTCAAGG - Intergenic
1186584761 X:10861064-10861086 CAGAGGCAGCAGTATGAGGATGG - Intergenic
1186683328 X:11898478-11898500 CAGTGGCAGCAGCATCACCTAGG + Intergenic
1187940583 X:24377002-24377024 CAGATGAAGCAGTTTGCCCAAGG - Intergenic
1188323016 X:28763652-28763674 TAGAGGGAGCAGCATGAACTAGG + Intronic
1189212206 X:39292949-39292971 CAGAGGAAGCAGCCTAAACAAGG + Intergenic
1189811599 X:44785845-44785867 CAGATGATTCAGCATGACTAGGG + Intergenic
1192228975 X:69251385-69251407 TTGAGGAAACAGCATGGCCAAGG - Intergenic
1192268777 X:69558947-69558969 CCGAGGAAACAGCATGTGCAAGG + Intergenic
1192511146 X:71721057-71721079 AAGAGGAGGGAGCATGAGCAGGG - Intergenic
1192515551 X:71760496-71760518 AAGAGGAGGGAGCATGAGCAGGG + Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1197268925 X:124405062-124405084 CAGAGGAAGGAGCAAAACAAAGG - Exonic
1197645766 X:129015124-129015146 CAGAAGAAGCAGCAAGAAGATGG - Intergenic
1201438215 Y:13981665-13981687 CAGAGGAAGCTGCATGGTCAAGG + Intergenic
1201446365 Y:14060440-14060462 CAGAGGAAGCTGCATGGTCAAGG - Intergenic
1202378867 Y:24259795-24259817 GAGGGGAAGCAGCAGGACCTGGG - Intergenic
1202491915 Y:25410326-25410348 GAGGGGAAGCAGCAGGACCTGGG + Intergenic