ID: 1018317263

View in Genome Browser
Species Human (GRCh38)
Location 6:162569322-162569344
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 3, 1: 6, 2: 12, 3: 26, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018317263_1018317268 -4 Left 1018317263 6:162569322-162569344 CCAACACCAAGCTGTCCAAGCTG 0: 3
1: 6
2: 12
3: 26
4: 215
Right 1018317268 6:162569341-162569363 GCTGGAGGCTGCCCTGCAACAGG 0: 1
1: 5
2: 16
3: 50
4: 282
1018317263_1018317269 5 Left 1018317263 6:162569322-162569344 CCAACACCAAGCTGTCCAAGCTG 0: 3
1: 6
2: 12
3: 26
4: 215
Right 1018317269 6:162569350-162569372 TGCCCTGCAACAGGCCATGCAGG 0: 1
1: 0
2: 3
3: 33
4: 196
1018317263_1018317272 11 Left 1018317263 6:162569322-162569344 CCAACACCAAGCTGTCCAAGCTG 0: 3
1: 6
2: 12
3: 26
4: 215
Right 1018317272 6:162569356-162569378 GCAACAGGCCATGCAGGACATGG 0: 1
1: 0
2: 5
3: 46
4: 233
1018317263_1018317273 16 Left 1018317263 6:162569322-162569344 CCAACACCAAGCTGTCCAAGCTG 0: 3
1: 6
2: 12
3: 26
4: 215
Right 1018317273 6:162569361-162569383 AGGCCATGCAGGACATGGCGTGG 0: 1
1: 2
2: 13
3: 20
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018317263 Original CRISPR CAGCTTGGACAGCTTGGTGT TGG (reversed) Intronic
901126115 1:6929994-6930016 CAGCATTTACAGCCTGGTGTAGG - Intronic
901828756 1:11879572-11879594 CAGGTTGGACACGTTGCTGTAGG - Intergenic
903179817 1:21599529-21599551 CAGCTTCGCCAGCGTGGTGGAGG - Exonic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
904396116 1:30223715-30223737 CAGCTTGGAGACCTAGGTGCTGG - Intergenic
904956974 1:34292756-34292778 CACCTTGGACCTCTTGGTGTTGG + Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
908058488 1:60319886-60319908 CAACTTGGACTGGTTGGTGAAGG + Intergenic
908415976 1:63913737-63913759 CAGCCTGGACAGCTTGTTTATGG - Intronic
909078360 1:71080593-71080615 CAGTCAGGCCAGCTTGGTGTTGG - Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912430583 1:109626486-109626508 CAGCCTGGAGAGCTGGGGGTGGG + Intronic
915060310 1:153176380-153176402 CACCTTGGACAGGTGGGGGTAGG - Intergenic
915330378 1:155108100-155108122 CAGGAAGGACAGCTTGGTGATGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
919479642 1:198072212-198072234 CACCATGCCCAGCTTGGTGTGGG + Intergenic
920715413 1:208335831-208335853 CAGCTAGGAAAGCTTTGTTTTGG - Intergenic
920942906 1:210500916-210500938 GAAGTTGGACAGCCTGGTGTGGG - Intronic
921015458 1:211186306-211186328 CAGCCTGGACAACATGGTGAAGG + Intergenic
921086655 1:211800236-211800258 CATGTTGGACAGGTTGGTCTTGG + Intronic
922213131 1:223500518-223500540 CAGCTTGCACAGCTGGGAGCAGG - Intergenic
924551823 1:245085245-245085267 CAGCCTGGAAAACTTGGTTTGGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1064676297 10:17763652-17763674 GAGCTTGGAAAGATGGGTGTGGG + Intronic
1066461321 10:35614867-35614889 CAGCCTGGCCAGCATGGTGAAGG + Intergenic
1068137112 10:52961613-52961635 CAGCTTGGTCAGCTGCGTGGAGG - Intergenic
1068921730 10:62492228-62492250 AAACTTGGACAGGTTGGTGCAGG + Intronic
1069261195 10:66400463-66400485 CAGCTTGAAGTGCTTAGTGTGGG - Intronic
1073303966 10:102488335-102488357 CAGCTTGCACTGCTTAGTCTTGG - Intronic
1073438813 10:103539748-103539770 CTTCTTGTCCAGCTTGGTGTAGG + Intronic
1074950494 10:118329585-118329607 CAGAGTGGAGAGCCTGGTGTGGG - Intronic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1075653739 10:124147489-124147511 GAGCTTGGGGAGCTTGGGGTGGG - Intergenic
1076797536 10:132805552-132805574 CAGATTGGACAGCTTGTTGGGGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078077246 11:8173263-8173285 GAGCTGGGGCAGCTTGGAGTGGG + Intergenic
1079939047 11:26655140-26655162 CAGCCTGGAAAGCTGGGGGTGGG - Intronic
1080396862 11:31898269-31898291 CTGCTTGCTCAGCTGGGTGTAGG + Intronic
1080944743 11:36958510-36958532 AACCTGGGACAGCCTGGTGTTGG - Intergenic
1081164372 11:39789311-39789333 CATCTTGGCCAGGTTGGTCTTGG + Intergenic
1081668898 11:44932554-44932576 CAGCGAGGAAAGCTCGGTGTGGG - Exonic
1082761513 11:57131297-57131319 CAGCCTGGACACCTTGGAGCAGG + Intergenic
1083287217 11:61667856-61667878 CAGGTTGCACAGCATGGTGGGGG - Intergenic
1083635193 11:64117124-64117146 CATCTTGGCCAGCGTGTTGTAGG - Exonic
1083635199 11:64117172-64117194 CAGCGTGGTCAGGTTGTTGTTGG - Exonic
1083675829 11:64324154-64324176 CCTCTAGGACAGCCTGGTGTGGG + Intergenic
1083800315 11:65042734-65042756 CAGCATGGCCAACATGGTGTTGG - Intronic
1084397372 11:68921345-68921367 CACCTTGGCCACCTTGGTGCTGG + Intronic
1085457105 11:76671238-76671260 CAGAGTGGACGGCTTGGTGCGGG - Intergenic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1091226217 11:133957710-133957732 CAACTTTGACTGCTTGGAGTCGG - Intergenic
1091556133 12:1574717-1574739 CTGCTTGAACAGCTGGATGTGGG + Intronic
1091586021 12:1817428-1817450 CTGCTTGAACAGCTCTGTGTAGG + Intronic
1094839268 12:34336186-34336208 CAGCATGGGGGGCTTGGTGTGGG - Intergenic
1095875720 12:47078817-47078839 CACCTTGGACAGGTTTTTGTTGG + Exonic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098056966 12:66517478-66517500 CAGCCTGGACAGATAGGTGGTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100244144 12:92739520-92739542 AAGCTTGGACAGCTTACAGTGGG - Intronic
1101327712 12:103731128-103731150 CAGCCAGAACAGCCTGGTGTTGG - Intronic
1102883998 12:116508270-116508292 GAGCTTGCAGAGCTTGGCGTTGG - Intergenic
1103464074 12:121128123-121128145 CAGCTTAGTCTCCTTGGTGTTGG + Intergenic
1105855269 13:24366276-24366298 GAGCCTGGCCAGCTTGGTGCCGG - Intergenic
1106356429 13:28987636-28987658 CAGCTGGGACAGGATGGTGGTGG - Intronic
1108463031 13:50686417-50686439 CAGCTTGAACACCTTGAGGTTGG + Intronic
1108722593 13:53147583-53147605 TAGCTTGGAAAGCGTGGTTTTGG + Intergenic
1109533268 13:63682346-63682368 CAGCTTGTACTCCTTTGTGTTGG - Intergenic
1110789846 13:79575663-79575685 CAGCATGGACAGATTGGGGCAGG + Intergenic
1112051703 13:95649497-95649519 CAGCTGTCACAGGTTGGTGTTGG + Intergenic
1114528825 14:23382530-23382552 GAACTTGGACAGGTTGGTGTTGG + Exonic
1114534421 14:23413861-23413883 GAACTTGGACAGGTTGGTGTTGG + Exonic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1119753731 14:77098880-77098902 CAGCTTGCCAGGCTTGGTGTCGG + Intronic
1120591169 14:86374551-86374573 CACCTTGGTCAGCTTTTTGTGGG - Intergenic
1121894655 14:97635613-97635635 CAAATTGTGCAGCTTGGTGTTGG - Intergenic
1122256697 14:100483400-100483422 CAGATTGGACAGGGTGGTGTGGG - Intronic
1122312975 14:100808920-100808942 AACCCTGGACAGTTTGGTGTGGG - Intergenic
1122354839 14:101116636-101116658 GAGCTTGGAGTGCTTGGAGTGGG - Intergenic
1124008288 15:25811826-25811848 CAGCTTGGACAGGTGCGTGATGG - Intronic
1125722426 15:41851641-41851663 CTGCCTGGACAGCATGGTGGGGG + Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126034337 15:44533172-44533194 CAGGTTGGCCAGCCTGGTCTTGG + Intergenic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1128446217 15:67763554-67763576 CACCTTGGACAGGTTGTTTTTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129979956 15:79859621-79859643 CAGCTTGGCCAACATGGTGAAGG + Intronic
1131890092 15:96963359-96963381 CATCTTGGAGAGCCTGGTGAAGG + Intergenic
1132673373 16:1111600-1111622 CATCTTGGCCAGGTTGGTCTTGG + Intergenic
1133312801 16:4861139-4861161 CAGTTTGGGCAGATTGCTGTTGG + Intronic
1135605446 16:23820371-23820393 CAGCTAGGACTGCATGGTCTAGG - Intergenic
1136293342 16:29288702-29288724 CATCTTGGAAGGCTTGGTGCTGG + Intergenic
1136713076 16:32255776-32255798 CATCTTGGACATCTTGGAGATGG + Exonic
1136754838 16:32673652-32673674 CATCTTGGACATCTTGGAGATGG - Exonic
1136813274 16:33196712-33196734 CATCTTGGACATCTTGGAGATGG + Exonic
1136819750 16:33306792-33306814 CATCTTGGACATCTTGGAGATGG + Intronic
1136826314 16:33363332-33363354 CATCTTGGACATCTTGGAGATGG + Exonic
1136831380 16:33462103-33462125 CATCTTGGACATCTTGGAGATGG + Exonic
1137613999 16:49836300-49836322 CAGCTTGGACAGGTTGGAGGTGG - Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1140650430 16:77082380-77082402 AAGCTTTGTCAGCTGGGTGTGGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1141813846 16:86395780-86395802 CAGCTGGGAGATCTTGGTGCTGG + Intergenic
1141922971 16:87148382-87148404 CAGCTTTGCCAGCATGGAGTTGG + Intronic
1142423993 16:89991063-89991085 CAACTTGAATAGCTTAGTGTGGG + Intergenic
1202991851 16_KI270728v1_random:19687-19709 CATCTTGGACATCTTGGAGATGG + Intergenic
1203056980 16_KI270728v1_random:933986-934008 CATCTTGGACATCTTGGAGATGG - Intergenic
1142517141 17:439592-439614 CAGGTTGGTCAGGTTGGTCTCGG + Intergenic
1143058051 17:4177152-4177174 CTGCTTGGACAGCGAGGTGCAGG + Exonic
1143522342 17:7451916-7451938 CCTCTAGGACAGCCTGGTGTGGG - Intronic
1149637142 17:58180074-58180096 CAGCGTGGAGAGCATAGTGTAGG + Intergenic
1150061387 17:62071652-62071674 AGGCCTGAACAGCTTGGTGTTGG + Intergenic
1152444347 17:80332532-80332554 CTGCGTGGACAGCCTGGTGCAGG - Exonic
1152798035 17:82317500-82317522 CGGCTGGGAGAGCTGGGTGTGGG - Exonic
1155960575 18:31991539-31991561 CAGATTGCTCAGCTTGGTGCTGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157292051 18:46416708-46416730 CAGCTGGGACAGATGGGTCTAGG + Intronic
1157591322 18:48837841-48837863 CTGCTGGGACAGGTTGGTGGGGG - Intronic
1157713276 18:49864521-49864543 CAGCTTTGACTGCTTGCTGATGG - Intronic
1158246293 18:55435938-55435960 ATACTTGCACAGCTTGGTGTTGG - Intronic
1159334358 18:67044018-67044040 CAGCATGGACAGCTATGGGTAGG - Intergenic
1160325407 18:77942430-77942452 CAGCTTGCACAGTTGGGTGTTGG + Intergenic
1162909348 19:13841056-13841078 CACCTTGGAAAGCTGGGTGGGGG - Intergenic
926577020 2:14593630-14593652 CAGTTTCTCCAGCTTGGTGTTGG - Intergenic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928606576 2:32948708-32948730 CTGCTTGGGCAGCTTTGGGTTGG + Intronic
929090427 2:38211213-38211235 CAGCTTTCTCATCTTGGTGTTGG - Intergenic
931377283 2:61718719-61718741 CAGATGGGACAGCTAGTTGTAGG + Intergenic
933091727 2:78127743-78127765 CAGCTGGGAATGGTTGGTGTAGG - Intergenic
933162724 2:79044290-79044312 AAGCTTGGGAAGTTTGGTGTTGG - Intergenic
935627124 2:105180594-105180616 CTGCTTTTACAGCTGGGTGTTGG + Intergenic
936047807 2:109200641-109200663 CAGCTTGGCCAGGTAGGGGTGGG - Intronic
939891948 2:147746773-147746795 CATCTTGGACACATTAGTGTAGG - Intergenic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
941769560 2:169330203-169330225 CAGCTTGGAGAGGATGGTGGGGG - Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944099228 2:196004753-196004775 CAGCCTGGACAACATGGTGAGGG + Intronic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945791389 2:214309871-214309893 CAGCTGGGACAGCAGGTTGTGGG + Intronic
946084054 2:217153281-217153303 CATATTGAACAGATTGGTGTTGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
946424984 2:219589663-219589685 AAGACTGGACACCTTGGTGTAGG + Intergenic
949019269 2:241732055-241732077 CATGTTGGCCAGGTTGGTGTAGG + Intergenic
1169355166 20:4899332-4899354 CAGCTTGGACAACTGGGTAGGGG + Intronic
1171059122 20:21939172-21939194 CAGCTTTGACCGGTTAGTGTGGG - Intergenic
1173441912 20:43085285-43085307 CACCTTGTAGAGTTTGGTGTAGG - Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1174642957 20:52061120-52061142 CAGCTTGTAAAGCTGGGTGGGGG + Intronic
1175543241 20:59761381-59761403 CAGCTTGGGCAGCTGGCTGTGGG - Intronic
1176545650 21:8196847-8196869 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1176564601 21:8379892-8379914 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1178125058 21:29507247-29507269 CTTCTTGGACAGCCTGGTGGAGG + Intronic
1179316457 21:40248106-40248128 CAGCATGGGCACCCTGGTGTTGG + Intronic
1180932134 22:19599492-19599514 CAGCCTGGCCAACATGGTGTTGG - Intergenic
1181360214 22:22328370-22328392 CAGCTTGCATAGCTCGGTGGTGG - Intergenic
1182619616 22:31611704-31611726 CAGCCTAGACAGCCTGGGGTGGG - Intronic
1182808976 22:33099674-33099696 GGGCTTGGACAGCTTGAAGTTGG + Intergenic
1184996729 22:48212542-48212564 CTGCTTGGAGAGCTTTGTGGTGG - Intergenic
1185369548 22:50454710-50454732 CAGGTTGGACACGTTGCTGTAGG + Exonic
1203250521 22_KI270733v1_random:113084-113106 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
950651972 3:14412944-14412966 CACCTTGGAAAGGTTGCTGTTGG + Intronic
951062706 3:18228445-18228467 CAGCTTGGAAAGATTGTTGAGGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953411489 3:42692847-42692869 CAGGATGGACAGCGTGGTCTGGG + Exonic
953690098 3:45110606-45110628 CAGCTTGAACACCTCGGGGTTGG + Exonic
954749199 3:52804180-52804202 CAGCATGGACAGTGGGGTGTGGG + Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
956259411 3:67322257-67322279 CATCTTTGTCAACTTGGTGTTGG + Intergenic
956308759 3:67855842-67855864 CAGCTGGGGCAGCTTGTTGAAGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
958177550 3:90015861-90015883 CTGTTTGGTCAGCTTGTTGTTGG + Intergenic
958429920 3:94026898-94026920 CAACTTGGACAACTTGTTCTGGG + Intronic
958781749 3:98551278-98551300 CAGCTTGCTGGGCTTGGTGTAGG + Intronic
958916776 3:100058931-100058953 CAGTTTGGACAGCATGGAGAAGG + Intronic
961440818 3:126952281-126952303 CAGCTGGACCAGCTGGGTGTTGG + Intronic
962620691 3:137175061-137175083 CAGGTTGAACAGCATGGTCTGGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964017170 3:151961971-151961993 CAGCTTTGTCATCTTGGTGCTGG + Intergenic
964046720 3:152337423-152337445 CAGCCTGGCCAGCATGGTGAAGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
966529743 3:180962925-180962947 CAGCTGCGACAGATTGGTATGGG + Exonic
968866726 4:3217672-3217694 CAGCTTGAGCAGCTGGTTGTAGG + Intronic
970606166 4:17683879-17683901 CAGCCTGGACAGCATGATGAAGG + Intronic
972488136 4:39561723-39561745 CAGCCTGGCCAACATGGTGTTGG + Intronic
973656133 4:53049719-53049741 CAGATTAGGCAGCTTGGTGCAGG - Intronic
976752330 4:88462164-88462186 CTGCATGGGCAGCTTGGAGTTGG + Exonic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
981713337 4:147730652-147730674 CTGTTTGGACAGCATGTTGTAGG - Intergenic
988796594 5:34657282-34657304 CTTCTTGGGCAGGTTGGTGTCGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
992191533 5:74296715-74296737 CAGATTGAACAGTTTGGGGTGGG - Intergenic
993618058 5:90136992-90137014 CACCTTGGACATGTTGGTGGTGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
994659364 5:102635212-102635234 CAGCCTGGGCAGCATGGTGAAGG + Intergenic
998508820 5:142694629-142694651 CAGCTTGGTCACCCTGGTGGCGG + Intronic
998569409 5:143244064-143244086 CACCGTGGACAGATTGGTGGGGG - Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999731152 5:154477610-154477632 GATCTTGGAGAGCTTGGTGTCGG + Exonic
1000494186 5:161957731-161957753 CAGCTTTAACACATTGGTGTGGG + Intergenic
1003570351 6:7252505-7252527 CAGAGTGGAGATCTTGGTGTTGG + Intergenic
1004433096 6:15564043-15564065 CAGCCTGGGCAACTTGGTCTCGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1006917499 6:37603943-37603965 CAGTTGGGACAGCTTGATTTGGG + Intergenic
1008480227 6:51978203-51978225 TGGCTTGGAAACCTTGGTGTGGG - Intronic
1008708464 6:54193810-54193832 CAGCTAGGAAAGCTTTGTGAAGG - Intronic
1009714227 6:67367439-67367461 CAGCTAGGACATGCTGGTGTGGG + Intergenic
1012661850 6:101908094-101908116 CAGCTCGGACAGAATGATGTAGG - Intronic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1016409461 6:143766697-143766719 CAGCTTGGGCAACTGGGTGGTGG - Intronic
1016785297 6:148004859-148004881 TGGCTTAGACAGCTTGGAGTAGG - Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1023223718 7:37947766-37947788 AAGCTGAGACATCTTGGTGTTGG - Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024812188 7:53225129-53225151 CATCTTGGTCAGCTTGCTCTAGG + Intergenic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1031304965 7:120114698-120114720 AAGCTTTGCCAGCTTGGTTTTGG + Intergenic
1032790389 7:135238281-135238303 CAGCTTGGCCAGCATGCTCTGGG + Intronic
1033648401 7:143322036-143322058 CAGCTTGGGGAGCTTGGAGCAGG + Intronic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1034738142 7:153447807-153447829 CAGCCTTGACAGCTGTGTGTTGG + Intergenic
1034787420 7:153937772-153937794 CATCATGTTCAGCTTGGTGTTGG + Intronic
1038623122 8:29163783-29163805 CATCTTGGGGAGCTTAGTGTTGG - Intronic
1041200685 8:55450339-55450361 CAGGTTGGACACGTTGCTGTAGG + Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1043422055 8:80107870-80107892 CTGGTTAGACAGATTGGTGTTGG + Intronic
1044459517 8:92428688-92428710 CAGCTTCCACAGCTTGGAATGGG + Intergenic
1046428449 8:114087568-114087590 TAGCTTGGACATATTTGTGTGGG + Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1049175537 8:141190299-141190321 CAGCATGGACGGCATGGTGCTGG + Exonic
1050856322 9:10361468-10361490 CAGAGTGGACAGTTGGGTGTGGG + Intronic
1052126333 9:24779815-24779837 CACCTTGGACAGTTAGATGTTGG + Intergenic
1052169856 9:25379727-25379749 CACCTTGGACAGCTTGGTAAAGG + Intergenic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1052658156 9:31392072-31392094 CAGATTGTACAGCTTCTTGTTGG + Intergenic
1052843165 9:33311036-33311058 CAGCTGGGACAGCTTTGTTCGGG + Intronic
1055597996 9:77885039-77885061 GACTTTGGACAGCTTGGTATAGG - Intronic
1056094249 9:83234737-83234759 AAGATTGGAAAGCTTGGAGTAGG - Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1059270600 9:113068252-113068274 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059271733 9:113073699-113073721 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059272867 9:113079146-113079168 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059274002 9:113084588-113084610 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059275136 9:113090032-113090054 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1060028101 9:120190183-120190205 CATGTTGGACAGCTGGGGGTGGG - Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1203466923 Un_GL000220v1:96356-96378 CATCTTGGAAAGCCTGCTGTTGG - Intergenic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1191758726 X:64624169-64624191 CAGTTTCACCAGCTTGGTGTAGG - Intergenic
1191810785 X:65186087-65186109 CACCTTGGGTAGCTTGGAGTTGG + Intergenic
1191979961 X:66914558-66914580 CTGCTTGGAAAGCTTGTTTTTGG + Intergenic
1192676900 X:73206590-73206612 CAGCTGAGTCATCTTGGTGTTGG - Intergenic
1197657098 X:129128386-129128408 CAGCTGTGACAGGTTGGTGGCGG - Intergenic