ID: 1018323768

View in Genome Browser
Species Human (GRCh38)
Location 6:162641703-162641725
Sequence TAGAGTTAACAGAGGGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018323768 Original CRISPR TAGAGTTAACAGAGGGCGGA TGG (reversed) Intronic
904041111 1:27585784-27585806 AAGAGTTAACAGTTGGAGGAAGG - Intronic
908565623 1:65353030-65353052 TAGAGATAGCAGAGGACTGATGG - Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
909539645 1:76776760-76776782 TAGAGATAAAAGAAGGTGGAGGG + Intergenic
909564655 1:77040979-77041001 AAGAGTTGACAGAGGGTTGATGG - Intronic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
916921674 1:169475631-169475653 GAGAGTCAACAGAGGGTTGATGG - Intronic
919465354 1:197918034-197918056 TTGGTTTAACAGAGGGCGCAGGG - Intronic
923789011 1:237095162-237095184 TAGAGACAACAAAGGGCAGAGGG + Intronic
924637619 1:245803703-245803725 TAGAGTTAACAAAAGCTGGAAGG + Intronic
1069347953 10:67492105-67492127 TAGAGTATACAGAGGGTGTAGGG + Intronic
1073139279 10:101236943-101236965 GGGAGTTCAGAGAGGGCGGAGGG - Intergenic
1073156815 10:101354062-101354084 GAGAGGTAAGAGAGGGCGGGGGG + Exonic
1073854468 10:107658930-107658952 TGGAGTTGACAGAGGGTGCAGGG - Intergenic
1073934071 10:108609605-108609627 TAGAGTCTACTGAGGGTGGAGGG + Intergenic
1086018851 11:82200875-82200897 TAGACTTAGCAGAGGGCATAAGG + Intergenic
1088396461 11:109375348-109375370 TAGAGATGACTGAGGGTGGATGG + Intergenic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1093359079 12:18201723-18201745 TAGAGTTAACATAAGGAGAAAGG - Intronic
1098237166 12:68428360-68428382 TAGAGATAGCAGAGGGCTCATGG + Intergenic
1099036229 12:77590500-77590522 TGGGGTTATCAGAGGGTGGAGGG + Intergenic
1106435891 13:29722506-29722528 TGGAGTTCACAGAGAGCCGAAGG + Intergenic
1106455118 13:29920109-29920131 TAGAGGGAACAGAGGGGGGTTGG - Intergenic
1111063863 13:83064034-83064056 TAGAGTTAACAGGAGGAGAATGG - Intergenic
1111092981 13:83471910-83471932 TAGAGTAAGCAGAGGGCAGAAGG - Intergenic
1114562187 14:23601367-23601389 TAGAGTGAAGAGAGGGAGGCTGG - Intergenic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1129209585 15:74059923-74059945 TAAAGTTAAGTGAGGGAGGAGGG + Intergenic
1129835697 15:78704101-78704123 TAAAGTTAAGTGAGGGAGGAGGG - Intronic
1132086189 15:98910192-98910214 TAGAGTGAGCAGGGGGCGGGAGG - Intronic
1139412649 16:66776676-66776698 TAGATTGAACAGAGGGAGAATGG + Intronic
1140859320 16:79005498-79005520 TAGAGTTTTCAGAGAGAGGATGG - Intronic
1144916885 17:18731111-18731133 TAGTGTTTACATAGGGCTGAAGG + Exonic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1151304742 17:73256101-73256123 TGGAGTTATCTGGGGGCGGAGGG + Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1152307300 17:79528796-79528818 TAGAGTTTTCAGAGGGAGCACGG + Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1157415653 18:47500629-47500651 TGGAGTGTACAGAGGGGGGAAGG + Intergenic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1166803746 19:45472996-45473018 AAGAGTTCACAGAGCGAGGAGGG - Exonic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
931204641 2:60135813-60135835 TAGAGTCTACAGAGGCCGGCAGG + Intergenic
942512184 2:176714583-176714605 TACTGTTAACAGAGGACGTAAGG + Intergenic
945216300 2:207437552-207437574 GAGAGTGAACGGAGGGCGGGAGG + Intergenic
945681955 2:212924966-212924988 TAGAGTTCCCAGAGGGAGCATGG - Intergenic
946226607 2:218267217-218267239 TAGAGTGGACAGAAGGGGGAAGG - Intronic
1169006535 20:2212027-2212049 TAGAATGAACAGACGGCTGAAGG + Intergenic
1170370935 20:15647416-15647438 TAGAGTTAGCAAAGGGCTGAAGG + Intronic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1170633242 20:18083104-18083126 TAGAGTTGACAGAGTGTGGAGGG - Intergenic
1170679221 20:18510054-18510076 CAAAGTTAACAAAGTGCGGAAGG + Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172494921 20:35373850-35373872 TAGAGTAAACAGAGAGCAAAAGG - Intronic
1174584604 20:51598324-51598346 TAGTGTTGTCAGAGGGCGCAGGG + Exonic
1179116244 21:38495328-38495350 TTGAATTAACAGAGGTTGGAAGG - Intronic
1179132630 21:38652223-38652245 TAGAGATAGCAGTGGGCGGGAGG - Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1180468445 22:15636762-15636784 TGGGCTTTACAGAGGGCGGATGG - Intergenic
1181511556 22:23391492-23391514 GAGGGTTAACTGAGGGCTGAGGG + Intergenic
1182462462 22:30492194-30492216 GAGACTCAACAGAGGGCAGAGGG + Intronic
1182467430 22:30525971-30525993 GAGACTCAACAGAGGGCAGAGGG + Intronic
952976030 3:38697286-38697308 AAGAGTTAACACAGAGCAGAAGG + Exonic
956820430 3:72949210-72949232 TGGAGTTTACAGTGGGAGGAGGG - Intronic
959219281 3:103495404-103495426 TTGAGGTAACACAGGGTGGATGG - Intergenic
960044927 3:113187364-113187386 TAGAGTTATCATAGTGGGGAAGG + Intergenic
961208307 3:125105203-125105225 TCGAGATAATAGAGGGGGGATGG + Intronic
961231858 3:125320167-125320189 TTGAGAAAACAGAGGGAGGAAGG - Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975758865 4:77598311-77598333 TAGAGTTAACAGAGAGCAGTGGG + Intronic
981898072 4:149828263-149828285 AAGAGTAAACAGAAGGCAGATGG - Intergenic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
985589925 5:759257-759279 CAGTGTTAACAAAGGGCGCAGGG - Intronic
987309148 5:16666300-16666322 GAGACTTAACAGAGCGTGGAAGG - Exonic
988778553 5:34498805-34498827 TAGAGTCATCAGAGGGCAAAGGG + Intergenic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
999370383 5:151051743-151051765 TAGACTTAACTGAGGGTTGAGGG - Intronic
1000941948 5:167372428-167372450 CAGAGGTAACAGTGGGCTGAGGG - Intronic
1005588202 6:27297666-27297688 AAGAGTTAAAAGAGTGCTGAGGG + Intronic
1010034404 6:71307165-71307187 TAGAGTTCAGAGAGGGAGAAGGG + Exonic
1013118044 6:107116882-107116904 TACATTTAAAATAGGGCGGAGGG + Intergenic
1017068279 6:150549815-150549837 TAGAGTGGAGAGAGGGAGGAAGG + Intergenic
1018323768 6:162641703-162641725 TAGAGTTAACAGAGGGCGGATGG - Intronic
1021948563 7:25752541-25752563 TAGAGTGGAAATAGGGCGGAGGG - Intergenic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1036779652 8:11637003-11637025 GAGAGTTATCTGAGGGGGGAGGG + Intergenic
1044314836 8:90738014-90738036 TAGGGCTGACAGAGGGTGGAAGG + Intronic
1044669553 8:94665098-94665120 GAGAATTAACATAGGACGGAAGG + Intronic
1044828722 8:96224236-96224258 TAGAGATAGCAGAGTGGGGAGGG + Intergenic
1046297757 8:112244001-112244023 TAGAGCTTACAGAGGGCACAAGG + Intronic
1047093012 8:121594293-121594315 TAGAATTAACAGAAGACAGAGGG + Intergenic
1047360485 8:124164515-124164537 TTGAATTAACAAAGGGAGGAGGG - Intergenic
1053288976 9:36867695-36867717 GAGAGATAAAAGAGGGAGGAAGG - Intronic
1059802339 9:117763112-117763134 TAGAATTAAAAGAGTGCAGAAGG + Intergenic
1060149601 9:121279793-121279815 CAGAGTTGACAGAGTGCGGGAGG + Intronic
1185517825 X:714183-714205 TGGACTTAAAAGAGGGCAGAGGG + Intergenic
1192402834 X:70854306-70854328 TAGAGGTGACAGAAGGTGGAAGG + Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1200312291 X:155089858-155089880 TAGACTGAACAGTGGGCAGAGGG + Intronic
1201317224 Y:12659539-12659561 AAGAGTTAACGGAAGGCGGGTGG + Intergenic
1201322416 Y:12714748-12714770 TAGATTTAACAGATGGAGGCCGG - Intronic