ID: 1018324283

View in Genome Browser
Species Human (GRCh38)
Location 6:162648463-162648485
Sequence CACTTGAACCCGGCGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148685
Summary {0: 1, 1: 104, 2: 5664, 3: 38503, 4: 104413}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018324283_1018324289 8 Left 1018324283 6:162648463-162648485 CCTCCGCCCGCCGGGTTCAAGTG 0: 1
1: 104
2: 5664
3: 38503
4: 104413
Right 1018324289 6:162648494-162648516 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1018324283_1018324291 9 Left 1018324283 6:162648463-162648485 CCTCCGCCCGCCGGGTTCAAGTG 0: 1
1: 104
2: 5664
3: 38503
4: 104413
Right 1018324291 6:162648495-162648517 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018324283 Original CRISPR CACTTGAACCCGGCGGGCGG AGG (reversed) Intronic
Too many off-targets to display for this crispr