ID: 1018324289

View in Genome Browser
Species Human (GRCh38)
Location 6:162648494-162648516
Sequence GCCTCAGCCTCCCGAGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846289
Summary {0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018324287_1018324289 -2 Left 1018324287 6:162648473-162648495 CCGGGTTCAAGTGATTCTCCTGC 0: 33779
1: 81745
2: 101616
3: 124160
4: 74442
Right 1018324289 6:162648494-162648516 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1018324280_1018324289 27 Left 1018324280 6:162648444-162648466 CCATCTTGACTCACTGCAACCTC 0: 128
1: 3979
2: 10693
3: 15362
4: 11679
Right 1018324289 6:162648494-162648516 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1018324285_1018324289 2 Left 1018324285 6:162648469-162648491 CCCGCCGGGTTCAAGTGATTCTC 0: 163
1: 15995
2: 84037
3: 146799
4: 190459
Right 1018324289 6:162648494-162648516 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1018324284_1018324289 5 Left 1018324284 6:162648466-162648488 CCGCCCGCCGGGTTCAAGTGATT 0: 2
1: 252
2: 11349
3: 56017
4: 94839
Right 1018324289 6:162648494-162648516 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1018324286_1018324289 1 Left 1018324286 6:162648470-162648492 CCGCCGGGTTCAAGTGATTCTCC 0: 443
1: 2693
2: 5624
3: 7981
4: 9007
Right 1018324289 6:162648494-162648516 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1018324283_1018324289 8 Left 1018324283 6:162648463-162648485 CCTCCGCCCGCCGGGTTCAAGTG 0: 1
1: 104
2: 5664
3: 38503
4: 104413
Right 1018324289 6:162648494-162648516 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018324289 Original CRISPR GCCTCAGCCTCCCGAGTAGC TGG Intronic
Too many off-targets to display for this crispr