ID: 1018324291

View in Genome Browser
Species Human (GRCh38)
Location 6:162648495-162648517
Sequence CCTCAGCCTCCCGAGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901262
Summary {0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018324283_1018324291 9 Left 1018324283 6:162648463-162648485 CCTCCGCCCGCCGGGTTCAAGTG 0: 1
1: 104
2: 5664
3: 38503
4: 104413
Right 1018324291 6:162648495-162648517 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1018324284_1018324291 6 Left 1018324284 6:162648466-162648488 CCGCCCGCCGGGTTCAAGTGATT 0: 2
1: 252
2: 11349
3: 56017
4: 94839
Right 1018324291 6:162648495-162648517 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1018324285_1018324291 3 Left 1018324285 6:162648469-162648491 CCCGCCGGGTTCAAGTGATTCTC 0: 163
1: 15995
2: 84037
3: 146799
4: 190459
Right 1018324291 6:162648495-162648517 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1018324286_1018324291 2 Left 1018324286 6:162648470-162648492 CCGCCGGGTTCAAGTGATTCTCC 0: 443
1: 2693
2: 5624
3: 7981
4: 9007
Right 1018324291 6:162648495-162648517 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1018324287_1018324291 -1 Left 1018324287 6:162648473-162648495 CCGGGTTCAAGTGATTCTCCTGC 0: 33779
1: 81745
2: 101616
3: 124160
4: 74442
Right 1018324291 6:162648495-162648517 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1018324280_1018324291 28 Left 1018324280 6:162648444-162648466 CCATCTTGACTCACTGCAACCTC 0: 128
1: 3979
2: 10693
3: 15362
4: 11679
Right 1018324291 6:162648495-162648517 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018324291 Original CRISPR CCTCAGCCTCCCGAGTAGCT GGG Intronic
Too many off-targets to display for this crispr