ID: 1018327760

View in Genome Browser
Species Human (GRCh38)
Location 6:162692290-162692312
Sequence TCTTTTCTTTAGAATGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 489}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018327760_1018327765 26 Left 1018327760 6:162692290-162692312 CCACACACATTCTAAAGAAAAGA 0: 1
1: 0
2: 4
3: 57
4: 489
Right 1018327765 6:162692339-162692361 GGATATAACCTCTAAGTGCTTGG No data
1018327760_1018327762 4 Left 1018327760 6:162692290-162692312 CCACACACATTCTAAAGAAAAGA 0: 1
1: 0
2: 4
3: 57
4: 489
Right 1018327762 6:162692317-162692339 ATTGGCTCTTGACAAGCTCCTGG No data
1018327760_1018327763 5 Left 1018327760 6:162692290-162692312 CCACACACATTCTAAAGAAAAGA 0: 1
1: 0
2: 4
3: 57
4: 489
Right 1018327763 6:162692318-162692340 TTGGCTCTTGACAAGCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018327760 Original CRISPR TCTTTTCTTTAGAATGTGTG TGG (reversed) Intronic
900501395 1:3006670-3006692 TCTTTTCTTTAGAAATTATCTGG + Intergenic
900527274 1:3135371-3135393 TCTTTTCTTGAGAAAATGTCGGG - Intronic
900837313 1:5015007-5015029 TCTGTTCATTTGAAAGTGTGTGG + Intergenic
902062086 1:13653853-13653875 TATTTTCTTTTGAATGACTGTGG - Intergenic
902645334 1:17793834-17793856 TCCTTTGTGTAGAATATGTGTGG + Intronic
902739143 1:18422588-18422610 TCCTTTTTTTCGAATGTGTAAGG - Intergenic
903504845 1:23825977-23825999 TCTTGTGTTTAGAGTGTGGGAGG + Intronic
903631428 1:24775836-24775858 TTTTTTCTTGAGAATGGGTCAGG + Intronic
905011680 1:34751380-34751402 TCCTTTCTTTCGAATGTGGAAGG - Intronic
905551244 1:38841652-38841674 TTTTTTTTTTAGAGTGGGTGTGG - Intronic
905722619 1:40218651-40218673 TCTTTTCCTTGGAATCTTTGTGG + Intronic
906251494 1:44314134-44314156 TCTTTTTTTTAAAGTGTGTTGGG + Intronic
906283261 1:44568319-44568341 TCATATCATTAGAATGTTTGAGG - Intronic
906347121 1:45023506-45023528 TTTTTTTTTTTGAGTGTGTGTGG + Intronic
906441310 1:45848086-45848108 TCTTATCTATAGAATGTATAGGG + Intronic
907151000 1:52287414-52287436 TCTTTTATTAAGAAAGTGTTTGG + Intronic
907348097 1:53801077-53801099 TTTTTTTTTTGGTATGTGTGTGG - Intronic
908054269 1:60266453-60266475 TCTTTTCCTTAGATTTTTTGAGG - Intergenic
908602464 1:65755537-65755559 TTTTTTCTTTACAATGTATCAGG - Intergenic
909025017 1:70471269-70471291 TGTTTTTTTTAAAATGTGTGTGG + Intergenic
909206880 1:72769801-72769823 GCCTTTCTTTGGAATGTGTAAGG - Intergenic
909376014 1:74943134-74943156 TTATTTCTGTATAATGTGTGTGG + Intergenic
909882144 1:80892905-80892927 TCTATTCTTAAGAAATTGTGTGG + Intergenic
910137739 1:83992426-83992448 TTTTTTCTTTAGAGTATTTGAGG - Intronic
911135371 1:94433656-94433678 TCTTTTTTTTAGACAGTGTCTGG + Intronic
912179212 1:107197389-107197411 TTTGTTCTTTAGAAACTGTGTGG + Intronic
912983020 1:114395873-114395895 TCTTTTCTTAACAAGGGGTGGGG - Exonic
915173271 1:153993620-153993642 TTTTTTTTTTAGGCTGTGTGTGG + Intronic
915717302 1:157956773-157956795 ACTTTTCTTTAGAATGTAGGGGG - Intergenic
916424134 1:164664658-164664680 TCTTTCCTTTGGAATTTGTCCGG - Intronic
918275355 1:182949008-182949030 GCCTTGCTTTAGAATTTGTGAGG - Intronic
919307244 1:195857020-195857042 TCTTTTCTTTGGAGTCTGTTGGG - Intergenic
919522948 1:198611762-198611784 TTTTCTCTTTAAGATGTGTGCGG - Intergenic
919923687 1:202181378-202181400 TCTTTTCTTTTGATGGTGTCAGG + Intergenic
920785123 1:209033943-209033965 TCTTATCTTTTAAAGGTGTGTGG - Intergenic
921254965 1:213330770-213330792 TCTTTTCTTGAGAAGGTGAACGG + Intergenic
923006688 1:230055625-230055647 TTTTTGCTTAAGAAGGTGTGGGG - Intergenic
923366502 1:233267016-233267038 TCTTTTCTTTAAAACTTTTGTGG + Intronic
923374707 1:233349568-233349590 ACTTCTCTAGAGAATGTGTGGGG - Intronic
923483989 1:234411843-234411865 TCTTTTCTTTCCAATCTGTCTGG - Intronic
923861519 1:237896606-237896628 GCTTTTCATTTGAATGTGGGTGG + Intergenic
923937299 1:238777368-238777390 CATTTTCTTGAGAATGTCTGTGG + Intergenic
924320048 1:242839497-242839519 TATCTTCTTTTGAATCTGTGAGG + Intergenic
1063031232 10:2237612-2237634 TCTTTTCTTTAAGTTGTCTGGGG - Intergenic
1063275719 10:4565660-4565682 TTTTTCCTTTAAAAAGTGTGGGG - Intergenic
1063276570 10:4574816-4574838 TATTTTGTTTATAATATGTGTGG - Intergenic
1063829974 10:9941453-9941475 TATTTACTTTATCATGTGTGTGG + Intergenic
1064765504 10:18666770-18666792 ACTTTTCTATAGATTGTGTTCGG - Intronic
1064876418 10:19999838-19999860 GCTTTTCCTGAGAATGTGTCAGG - Intronic
1065394983 10:25225761-25225783 TCTTTTCTATGGAATGTATTGGG + Intronic
1065683006 10:28256223-28256245 TCTTTTATATAGAAAGTGTCTGG - Intronic
1067387273 10:45827361-45827383 TCTTTTCTTCATAATGTGCACGG + Exonic
1067504209 10:46836479-46836501 TCTTTTCTTCATAATGTGCACGG - Intergenic
1067590379 10:47503514-47503536 TCTTTTCTTCATAATGTGCACGG + Exonic
1067637501 10:48011616-48011638 TCTTTTCTTCATAATGTGCACGG + Intergenic
1067875992 10:50008718-50008740 TCTTTTCTTCATAATGTGCACGG - Exonic
1068319645 10:55394765-55394787 TCTTGTCTTTGGATTGTGTTTGG + Intronic
1069153474 10:64996091-64996113 TATTTTTTTTGGTATGTGTGTGG + Intergenic
1069649368 10:70033550-70033572 GCTAATCTTTAGAATGTGTGCGG - Intergenic
1070265360 10:74896961-74896983 TCTTTTCTTTGGTGTGTGTGTGG + Intronic
1071080963 10:81810558-81810580 TGATTTCTTTAAAAAGTGTGGGG + Intergenic
1071576718 10:86732468-86732490 CCTTTTCTCTAGAATGCATGGGG + Intronic
1072724552 10:97804011-97804033 TCTTTTTTTTAGAAGGAGTCTGG - Intergenic
1073252730 10:102131440-102131462 TCTTTTCATGAACATGTGTGGGG + Intergenic
1073741483 10:106412831-106412853 CATTTACATTAGAATGTGTGGGG + Intergenic
1074102184 10:110362514-110362536 TCTATTCTTTAAAATGAGTTTGG + Intergenic
1074297817 10:112207305-112207327 CCTTATCTGTAGAATGTGTTAGG - Intronic
1075003775 10:118816380-118816402 TCTTTTCTTTTGCATGTGAGTGG + Intergenic
1075142912 10:119855818-119855840 TATTTTCTTTTTAATGTCTGTGG - Intronic
1075227614 10:120643884-120643906 TGATTTCTTTAGAATGCCTGTGG + Intergenic
1077852609 11:6088174-6088196 TCTTTTCTGTAAAATGTGCTAGG - Intergenic
1079265519 11:18928404-18928426 AATTTTCTTCAGAATGTCTGCGG + Intergenic
1079331869 11:19540283-19540305 GCTTGTCTTTAGAAAGAGTGAGG - Intronic
1079547334 11:21648334-21648356 TTTTTTCTTTTGAATATTTGGGG - Intergenic
1080052954 11:27875476-27875498 TCTTTCCCTTTGAATCTGTGTGG - Intergenic
1080058795 11:27934803-27934825 TCTTTTGTGGGGAATGTGTGTGG + Intergenic
1081070905 11:38607110-38607132 TCCATTCTTTGGAATCTGTGAGG + Intergenic
1081846447 11:46243801-46243823 TCCCTTCTTAAGAAAGTGTGTGG - Intergenic
1082595304 11:55071959-55071981 TCTTTTTTGTAGAATCTGTGAGG + Intergenic
1083459959 11:62804757-62804779 GCATTTCTTAAGAGTGTGTGTGG - Intronic
1084351631 11:68604992-68605014 TTTTTTCTTTAAAATGTTTTTGG - Intronic
1084741777 11:71144845-71144867 TCATTTCTTAAGAGCGTGTGTGG + Intronic
1084897338 11:72283006-72283028 TCTTTTTTTTTGTGTGTGTGGGG + Intergenic
1087345005 11:96960749-96960771 TCTTTTCTTTAGACTGTTGGGGG + Intergenic
1088164426 11:106915953-106915975 TCTTTTCTTTACAGTGAGAGTGG - Intronic
1088295731 11:108291862-108291884 TCTTATCTTGAGCATGTGTGTGG + Intronic
1088608332 11:111552909-111552931 AATTTTCGTTAGAATGTGTTTGG + Intronic
1090989607 11:131804250-131804272 GCTTTTTATTAGAAAGTGTGAGG - Intronic
1091594625 12:1868630-1868652 CCTTTGCTTTAGCCTGTGTGTGG - Intronic
1091935989 12:4434908-4434930 TCTTTTCTGCAGACTGTGTGTGG + Intronic
1092324173 12:7511551-7511573 TCTTGTCTTTAAAATTTGTTAGG - Intergenic
1092552342 12:9516621-9516643 TCTTTTCTTTAAATTTTGGGTGG + Intergenic
1093277314 12:17146293-17146315 TCTTTTCCTGTGTATGTGTGTGG - Intergenic
1093334738 12:17889908-17889930 ACTTTTCATTAGAATGTTTCAGG - Intergenic
1093891712 12:24529454-24529476 TCTTTTCGTTAAAAGGTATGTGG - Intergenic
1094479957 12:30873795-30873817 TCTTTTTTTTTGTGTGTGTGTGG - Intergenic
1094519777 12:31173990-31174012 TCTTTTCTTTAAATTTTGGGTGG - Intergenic
1094622948 12:32097662-32097684 TAATTTCTTTAAATTGTGTGAGG - Intergenic
1095078696 12:37968827-37968849 ACTGTTTTTTAGAATCTGTGAGG + Intergenic
1095132017 12:38554487-38554509 TGTTTTCTCTAGAATTTGTATGG + Intergenic
1095132796 12:38563932-38563954 GCTTTTCTTTAGTAGGTGTCAGG + Intergenic
1095569062 12:43661304-43661326 TCTTTTTTTTTATATGTGTGTGG + Intergenic
1096366594 12:51033450-51033472 TCTCTGCTTTAGAATCAGTGTGG + Intergenic
1096429230 12:51529709-51529731 TCCTTTCTTTGGAATGTGCAAGG - Intergenic
1096835873 12:54350956-54350978 TCTTTTCTATAGAACGAGTGGGG + Exonic
1097693089 12:62752484-62752506 TCTTTTCTGTGGAATGTTGGGGG - Intronic
1099297369 12:80845342-80845364 TCCTTACTTTGTAATGTGTGTGG - Intronic
1099651899 12:85439370-85439392 TCTTTTCTGTAGATATTGTGGGG + Intergenic
1100234625 12:92648359-92648381 TCTTTTCTTCAGCAGGTCTGAGG + Intergenic
1102060956 12:109930735-109930757 TGTTTTCCTTGGAATGTTTGAGG - Exonic
1102663869 12:114553519-114553541 TCTGGTCATTAAAATGTGTGAGG + Intergenic
1102702245 12:114849562-114849584 GCATTTCCTTAGAATATGTGAGG + Intergenic
1103967440 12:124648871-124648893 TCTTTTCTTTGGAATGTGCAGGG - Intergenic
1104367237 12:128189039-128189061 TGTGTTTTTGAGAATGTGTGAGG + Intergenic
1105791619 13:23805989-23806011 TGTTTCCTTGAGAATGTCTGTGG + Exonic
1106300855 13:28463570-28463592 TATTTACTTTAGAATATGTTTGG - Intronic
1108417655 13:50215607-50215629 TCTTTTGTTTACAATTTGTGTGG - Intronic
1108856951 13:54804765-54804787 TCTTTTCGTTACAGTGTTTGAGG + Intergenic
1108897600 13:55353142-55353164 TCTTTTCTTTACAATTGATGTGG - Intergenic
1109886004 13:68545959-68545981 TAATTTATTTTGAATGTGTGTGG - Intergenic
1109888821 13:68580061-68580083 TTTTTTCTTTTTAATGTTTGTGG - Intergenic
1110318883 13:74137534-74137556 TCTTTTCTGGACAATGTGTTAGG - Intergenic
1110561734 13:76917376-76917398 TCCTTTCTTTAGAGGGTCTGTGG - Intergenic
1110622409 13:77611586-77611608 CCTTTCCTTTATAATGTTTGAGG + Intronic
1110661032 13:78059704-78059726 TCTATTTTTTGGAATCTGTGAGG + Intergenic
1111280703 13:86019663-86019685 TTTTTTCTGTTGAATTTGTGAGG - Intergenic
1111359658 13:87159787-87159809 TCTTTCATTTATAATGTGTGTGG - Intergenic
1111534556 13:89586009-89586031 TCTTGGGTTTAGAATGTGTAAGG - Intergenic
1111610172 13:90594720-90594742 TCTTTTCTTTAAAAAATTTGTGG + Intergenic
1111652445 13:91108823-91108845 TCTTTTCTTTTGTAGATGTGGGG - Intergenic
1112038466 13:95519989-95520011 GTTTTTCTTTACAATGTTTGGGG + Intronic
1112355687 13:98673252-98673274 GCTTTTCTTTAGACTGAGTGAGG - Intergenic
1112475652 13:99729172-99729194 TCTTGTCTTTTAAAAGTGTGAGG + Intronic
1112548350 13:100394111-100394133 GCTTTCCTTTGAAATGTGTGAGG + Intronic
1112956288 13:105062865-105062887 TCTTTTCTATAGAATGTTGTAGG + Intergenic
1113160634 13:107376756-107376778 TCTTTTCACTAGGATATGTGTGG - Intronic
1114987007 14:28242194-28242216 TCATGTCTTAAGAATGTGTCAGG - Intergenic
1115025640 14:28742173-28742195 TATTTTCTTTAAAAGGTATGTGG - Intergenic
1115198191 14:30824802-30824824 TCTTCTCTTTAGAATGACTTAGG - Intergenic
1117035165 14:51721060-51721082 TGGTTTCTGTAGAATTTGTGTGG + Intronic
1118140350 14:63073776-63073798 CCTTTTCTTTGTAATGTGTAGGG - Intronic
1119604121 14:75999885-75999907 TCTTTGCTTTAAAATCTTTGTGG - Intronic
1119973709 14:79001763-79001785 TCTTTTCTTTCTAATTTTTGTGG + Intronic
1120005765 14:79356267-79356289 TCTTTTGTTTGGAGTATGTGTGG + Intronic
1120345229 14:83280340-83280362 ATCTTTCTTGAGAATGTGTGGGG + Intergenic
1120349637 14:83338456-83338478 TATTTTCGTTAAAATTTGTGTGG - Intergenic
1120688518 14:87566268-87566290 TCTGTTCTTTCAAAAGTGTGTGG + Intergenic
1120800255 14:88680331-88680353 CCTTTTTTTTAAAATGTGTCTGG + Intronic
1121751351 14:96360047-96360069 TTTATTCTATAGAATGTATGTGG - Intronic
1121859372 14:97302203-97302225 TCTTATCTTTAAAATGAGAGAGG + Intergenic
1124156522 15:27230136-27230158 TATTTTATTTAGTGTGTGTGTGG + Intronic
1124167657 15:27342541-27342563 TCTTTTCTCTGGAAGGTCTGTGG - Intronic
1124662119 15:31558301-31558323 TCTCTTCTTTGGAATGTTTAAGG - Intronic
1125262737 15:37846400-37846422 TAATTTCCTTAAAATGTGTGTGG + Intergenic
1125530107 15:40407563-40407585 CCTTTTCTCTTGAATGTGTCTGG + Intronic
1125828728 15:42696131-42696153 TCTTGTCCTTAGACTGTTTGAGG + Intronic
1126082234 15:44975458-44975480 TCTCTTCTTTGGAATGGGTTGGG + Intronic
1126169905 15:45686499-45686521 TTTTTTTTCTAGAATGGGTGAGG - Intronic
1126563131 15:50066780-50066802 TCTTTTTTTTACAGTTTGTGGGG + Intronic
1127710088 15:61588733-61588755 TCTTTTCTTTATAAAGTCTCAGG - Intergenic
1128147371 15:65339439-65339461 TTTTTTCTTTAGGAAGTTTGAGG + Intronic
1128987829 15:72234171-72234193 TCTTTTGTTTATAATGTTGGGGG + Intergenic
1129571186 15:76686261-76686283 TCTGTTCTGTAGAATGTCTGTGG - Intronic
1129833200 15:78683760-78683782 TTTTTTAATTAGAGTGTGTGGGG - Intronic
1130034898 15:80349991-80350013 TCTTTGCTTTATGATGTATGAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131887781 15:96936920-96936942 TCTTTTGTTTAGTCTTTGTGTGG - Intergenic
1133363242 16:5190560-5190582 TCTTTTATTTAAAATGTATAGGG - Intergenic
1134211154 16:12278453-12278475 TCTTTTCTTTTGAGGGTGAGGGG - Intronic
1135426178 16:22338672-22338694 TCTTTTCTTTCTGATGTGGGTGG - Intergenic
1135826325 16:25731715-25731737 TCCTTTCTTTGGAATGTGGAGGG + Intronic
1136079393 16:27841582-27841604 TCTCTTGTTTAATATGTGTGAGG - Intronic
1137052341 16:35724845-35724867 TCTCTTCTTTAGAATGTCTGGGG + Intergenic
1137728446 16:50672736-50672758 AGTTTTGTCTAGAATGTGTGAGG + Exonic
1138824568 16:60303648-60303670 ACTTCTCTTTAAAATGTTTGTGG + Intergenic
1138995271 16:62444177-62444199 TTTTTTATTCTGAATGTGTGGGG - Intergenic
1139843462 16:69901378-69901400 TCTTTTCTTTAGGATGTGAAAGG + Intronic
1141511772 16:84516958-84516980 TCTTTTCCTTACTGTGTGTGGGG - Intronic
1143172193 17:4936821-4936843 CCATTTCTTTAGAAGATGTGTGG - Intergenic
1143318190 17:6048805-6048827 TCTTTTGTCTATAAAGTGTGGGG + Intronic
1143953279 17:10650301-10650323 TCTGTTCATTAGAAAGTGTTTGG - Intronic
1144236247 17:13263059-13263081 TCTTTTCTTTAGTAGATGCGGGG + Intergenic
1144263001 17:13541515-13541537 TTTTTTTATTAGAATGTGTTTGG - Intronic
1144517814 17:15931171-15931193 TCTTTTCTTTCCTATCTGTGTGG - Intergenic
1145729534 17:27164324-27164346 TCTTTTTTTTACAATCTATGAGG + Intergenic
1146834216 17:36096753-36096775 TCTTTTCCTTAGAAAATGTGGGG - Intergenic
1147764823 17:42827067-42827089 TCTTTTCTTTTAAATGTATGTGG + Intronic
1148123954 17:45227447-45227469 TCTTTCTATTAGAATGTGTGGGG - Intronic
1149149567 17:53544117-53544139 TATTTTCTTTAGGATGGGTGCGG - Intergenic
1149730650 17:58942662-58942684 TCTGTTCTTTAAGATTTGTGGGG + Intronic
1150655898 17:67039212-67039234 TTCTTTCTTTGGAATGTGTAGGG + Intergenic
1151129470 17:71881589-71881611 TCTCTTCCTTAGAATGGTTGAGG - Intergenic
1151739951 17:75974124-75974146 TGAATTTTTTAGAATGTGTGTGG + Intronic
1152769647 17:82159324-82159346 TCTTGTCTGTAGCATTTGTGCGG + Intronic
1153295110 18:3537814-3537836 TCTGTGTTTTTGAATGTGTGAGG + Intronic
1153387430 18:4513143-4513165 GTTTTTCTTTAGAATGCTTGTGG + Intergenic
1153816123 18:8791646-8791668 TCTATTATTTAGAAAATGTGTGG - Intronic
1154139380 18:11809963-11809985 TCTTTCCTTTTGTATGTATGTGG + Intronic
1154231648 18:12561115-12561137 TTTTTTCTTTTTAATTTGTGGGG - Intronic
1154310777 18:13264672-13264694 GCTGTTCTTTGGACTGTGTGAGG + Intronic
1155009048 18:21756890-21756912 TGTTTCTTTTGGAATGTGTGTGG + Intronic
1155123027 18:22842182-22842204 TCTTTCCTCTAGCATTTGTGAGG - Intronic
1156888724 18:42165484-42165506 CTCTTTCTTTAGAATGTGTGAGG + Intergenic
1157259867 18:46168415-46168437 TCTTTTCATTAAAATATGAGAGG + Intergenic
1157636255 18:49157928-49157950 TCTTGTGTATAGAATGAGTGAGG + Intronic
1157754859 18:50208572-50208594 TCCTTTCTTTGGAATGTGCAGGG + Intergenic
1157836031 18:50904173-50904195 TCTTTTGGTTACAATTTGTGTGG + Intronic
1157861517 18:51145085-51145107 TATTATCTTTTGAATATGTGTGG + Intergenic
1157864666 18:51170759-51170781 TCTTTTCATTGGATTATGTGTGG + Intergenic
1157929174 18:51801938-51801960 TTTTTTTTTTTGAAGGTGTGGGG + Intergenic
1158047922 18:53178799-53178821 TATTTTCTATAGAAAGTCTGAGG + Intronic
1159280956 18:66284715-66284737 ACCTTTCTTTAAACTGTGTGTGG - Intergenic
1160352720 18:78198296-78198318 TCTTTTATTTAAAATCTTTGGGG - Intergenic
1163110861 19:15160463-15160485 TCCTTTATTTATAATGGGTGGGG - Exonic
1163349362 19:16765711-16765733 ACTTTTCTTTAGAAAGTGCCAGG + Intronic
1164379702 19:27721272-27721294 ACTTTTTTTTAGAATCTATGAGG - Intergenic
1164381796 19:27742267-27742289 TCTCTCCATTAGAATGTCTGAGG + Intergenic
1164385470 19:27767737-27767759 TCTTCTCGTTAGAATGTCTGGGG + Intergenic
1167242895 19:48355703-48355725 TCCTTTCTTTGGAATGTGCGGGG - Intronic
1167567264 19:50264504-50264526 ACTTTTCTTAGGAATGTGTGGGG + Intronic
1167828507 19:51997594-51997616 TTCTTTCTTTGGAATGTGTAGGG - Intronic
925681850 2:6430597-6430619 TTTTTTCTTTTCAATGTTTGTGG + Intergenic
926164331 2:10509907-10509929 TAATTTCTTTATAAGGTGTGAGG - Intergenic
926273783 2:11388321-11388343 TCTTTTTATTAGAATTAGTGGGG - Intergenic
928464661 2:31512561-31512583 TCTTTTCTTCAGTATATATGTGG - Intergenic
929491537 2:42401272-42401294 TCTTCTTTTTAAAATGTGTGTGG - Intronic
929926795 2:46219266-46219288 TCTTTTCTTTAGGTTTTCTGGGG + Intergenic
930625562 2:53693507-53693529 TTTTCTCTTTGGAATGTCTGTGG - Intronic
930992474 2:57674634-57674656 GATTTTCTTTAGAATGTTTTGGG - Intergenic
931677768 2:64714752-64714774 TCTTTTCTTTATAATATTTTAGG - Intronic
931753712 2:65353061-65353083 TCTTTGCTTTACAATGACTGGGG + Intronic
932030529 2:68178983-68179005 TTTTTTTTTTAGTTTGTGTGTGG - Exonic
932345163 2:70990651-70990673 TCTTTGCCTTAGAATGGGAGAGG - Intronic
932804919 2:74775138-74775160 TTTTTTCTTTAGAACTTTTGAGG - Intergenic
932833542 2:75012923-75012945 TCTTTTCCTAAGAATTGGTGAGG - Intergenic
932953530 2:76323013-76323035 TCACTTCTTTTAAATGTGTGGGG - Intergenic
933000754 2:76919455-76919477 AACTTTCTTGAGAATGTGTGAGG + Intronic
933380762 2:81540995-81541017 TCTTTTCTTTATTATTTGTGAGG - Intergenic
934946902 2:98548940-98548962 TCTTTTCTTTAGCAGTTTTGAGG + Exonic
935037052 2:99387334-99387356 TCTTTTTTTTATATAGTGTGAGG + Intronic
935864914 2:107376722-107376744 GCATTTCTTTATTATGTGTGAGG - Intergenic
936256622 2:110921111-110921133 CCTTTTCTTTTTAATGTCTGTGG + Intronic
936291775 2:111230897-111230919 TTTTTTTTTTATAATGTGTTAGG - Intergenic
936642476 2:114330450-114330472 TATTTTGTTCAGAATGTGTCAGG + Intergenic
936969263 2:118161226-118161248 TTTTTTTTTTTGCATGTGTGTGG + Intergenic
937425008 2:121791363-121791385 TCTCTTCTGTCGAATGTGGGCGG + Intergenic
937719638 2:125078859-125078881 TTTATTCTTTAAAATGTCTGGGG + Intergenic
938235653 2:129704393-129704415 TCTTTTATACAGAAAGTGTGAGG - Intergenic
938609440 2:132932319-132932341 TCTTTTCTTTTTTTTGTGTGTGG + Intronic
938883832 2:135622419-135622441 TTTTTTTTTAAGAATGTGCGTGG + Intronic
939052631 2:137326414-137326436 TACTTTGTTAAGAATGTGTGGGG - Intronic
939774780 2:146371025-146371047 TCTTTTCAATGGAATGTGTGTGG - Intergenic
939876953 2:147588377-147588399 TATTGTTATTAGAATGTGTGAGG - Intergenic
940007305 2:149019871-149019893 ACCTTTCTTTAGAAGGGGTGGGG - Intronic
941029026 2:160492045-160492067 TTTCTTTCTTAGAATGTGTGTGG - Intronic
941211257 2:162642845-162642867 TGTTTTCTTTAGCATTTGTCTGG - Intronic
941543604 2:166817471-166817493 TCTTTTCTTAAGAAGTTCTGAGG - Intergenic
942073185 2:172333682-172333704 TCTGTTCTTTTAAATGTGTGTGG + Intergenic
942226300 2:173819467-173819489 TCTTTTCTTTATGAAGTGTAGGG - Intergenic
942355060 2:175102272-175102294 GCTTTTGTTTAGAATATGTTTGG - Intronic
942546087 2:177065379-177065401 GGCTTTCTTTAGGATGTGTGGGG - Intergenic
942771962 2:179532189-179532211 TCTTTTCTTCTGAATTTGTAAGG + Intronic
943231085 2:185253118-185253140 TCTTTTCTTTATTAAGTATGTGG - Intergenic
943805704 2:192122460-192122482 TCTTTTCTTAAGAATGGGATAGG + Intronic
943954744 2:194174588-194174610 TCTTTTATTTAAAATGTCTCAGG - Intergenic
944220840 2:197302770-197302792 TCCTTTCTTGAGAAAGTCTGTGG + Intronic
944922864 2:204433751-204433773 TCTTTTGTTGAGAAGGTTTGAGG - Intergenic
944981679 2:205127844-205127866 TCATTTCTCTAGAAAGTGTGAGG - Intronic
946000460 2:216477843-216477865 TCTTCCCTTTGCAATGTGTGTGG + Intronic
947506507 2:230712324-230712346 ACTTTTTTTTTTAATGTGTGAGG + Intergenic
1168737327 20:152705-152727 TCTTTTCTTGAGATAGTGTCTGG + Intergenic
1169024482 20:2357405-2357427 TCTCCTCTGTGGAATGTGTGTGG + Intergenic
1169225132 20:3851652-3851674 TCCTATCTTAAGAATGTATGTGG + Intronic
1169562314 20:6814981-6815003 TCATTTCTAAAGAATATGTGTGG + Intergenic
1169608692 20:7353585-7353607 TCTTTTCTTTAGAGAGAGAGAGG - Intergenic
1170117834 20:12879969-12879991 ATTTTTCTTTAGCTTGTGTGAGG - Intergenic
1171079126 20:22160264-22160286 ACTTTTCTTAAGAATTAGTGAGG - Intergenic
1171145575 20:22778573-22778595 TCTTTTCTTTCCAATTTGTTTGG - Intergenic
1171446754 20:25209981-25210003 TCTTTTCCTTTGAATGTGGTAGG + Intronic
1172016409 20:31877043-31877065 TCTTTTCTTTTGTAGGGGTGAGG + Intronic
1172461744 20:35124083-35124105 TCTTTTCTTAAGGTTGTCTGTGG - Intronic
1173276288 20:41586504-41586526 TCCATTCCTTAGAATCTGTGAGG + Intronic
1173798095 20:45876649-45876671 TCTTATCTTTATAAGGGGTGGGG + Intronic
1174232994 20:49061808-49061830 TTTTTTTTTAATAATGTGTGAGG + Intronic
1174961334 20:55160475-55160497 TCCTTTATTTAGAATGTGTAGGG + Intergenic
1176037692 20:63048375-63048397 ACTTTTATTTGGAATGTGTGGGG + Intergenic
1176947074 21:14995146-14995168 CCTTTTATTTAGTATGTATGTGG - Intronic
1177542788 21:22517188-22517210 TCTTTATTTTATATTGTGTGGGG + Intergenic
1177557405 21:22710225-22710247 GCCTTTCTTGGGAATGTGTGGGG - Intergenic
1178137645 21:29645984-29646006 TCTTCTCTTTGGAATGTGCAAGG - Intronic
1179429543 21:41310427-41310449 TCTTTGCACTAGAATGTGAGTGG + Intronic
1181624057 22:24110871-24110893 TTTTTTTTTTTAAATGTGTGTGG + Intronic
1182709127 22:32309762-32309784 TCTTATCTGTCAAATGTGTGAGG - Intergenic
1182747817 22:32619021-32619043 TCCTCTCTATAGAATCTGTGAGG + Intronic
1182948837 22:34352218-34352240 TGTTTTCTTTCTAATGTGTCTGG + Intergenic
1182999904 22:34847384-34847406 TTTTTTCTTTATATTGTGTTAGG - Intergenic
1183651234 22:39154621-39154643 TCTTTTCGTTAGCATTTGCGTGG - Intergenic
1184492085 22:44815543-44815565 CCTTCTCTTTGGAACGTGTGGGG + Intronic
949252023 3:1996643-1996665 TCTTTACTATAGGATGTCTGAGG + Intergenic
950447282 3:13045607-13045629 TCTTTGTTCTAGGATGTGTGGGG - Intronic
950756902 3:15181466-15181488 TTTTTTTTTGAGAATGTATGAGG - Intergenic
951320547 3:21239026-21239048 TTTCTTTTTTAAAATGTGTGTGG + Intergenic
952090783 3:29882814-29882836 TGTTTTCTTTAAAATGTCTATGG + Intronic
952577714 3:34794867-34794889 TCTTTGCTTTGGAATATGTAGGG - Intergenic
952922657 3:38296664-38296686 TCCATTCTTTGGAATCTGTGAGG - Intronic
953496015 3:43387571-43387593 ACCTTTCTTTAGAATATCTGGGG - Intronic
954295451 3:49672290-49672312 CCTGTTCCTTAGATTGTGTGTGG - Intergenic
954734145 3:52691232-52691254 TTTTTTCTTTAAATTGTGTGTGG - Intronic
955616790 3:60817381-60817403 TCTTTCCTTTAGCATTTCTGTGG + Intronic
955705058 3:61719390-61719412 TCTTTTCTTGCTAAAGTGTGTGG + Intronic
956299519 3:67755072-67755094 TCTATTCTTTTAAATTTGTGAGG - Intergenic
956562546 3:70596346-70596368 TCTGTTCCTGAGATTGTGTGTGG + Intergenic
956564284 3:70617747-70617769 TCTATTCCTTGGAATCTGTGAGG + Intergenic
957199472 3:77113518-77113540 GCTTTTCCTTATAATGTGTCAGG - Intronic
957532704 3:81460934-81460956 TCTTTTCTTGATCCTGTGTGGGG - Intergenic
957668132 3:83262974-83262996 TCTTGTCCTGGGAATGTGTGTGG - Intergenic
958026015 3:88049987-88050009 TCTTTTCAGTAAAATGTCTGTGG + Intergenic
958208977 3:90443533-90443555 TCTTTTTTTTAGAATATGCAAGG - Intergenic
958645743 3:96871414-96871436 TCATTTCTTTAAAATATTTGGGG - Intronic
959117347 3:102193923-102193945 TCTTTTTATGAGAGTGTGTGGGG + Intronic
961923954 3:130456308-130456330 TATTTTCATTAAAAAGTGTGAGG + Intronic
962786147 3:138769871-138769893 TCTTATCTTTAAAATGGGTAGGG - Intronic
963717880 3:148824696-148824718 TTTTTTCTTTAAAAGGAGTGAGG + Intronic
964036262 3:152201361-152201383 TCTTTTCTTTAGAGAATGTTAGG - Intergenic
964995783 3:162878589-162878611 TCTTTTCTTTAGAATTTATTGGG - Intergenic
966306270 3:178538781-178538803 TTTTTTCTTTATAAGCTGTGAGG + Intronic
966329687 3:178796860-178796882 TCTTTTATTAAGAATGGGTTTGG - Intronic
966391593 3:179458456-179458478 TCTCTTCTTTAAAATGTCTTTGG + Intergenic
966474405 3:180326881-180326903 TGTTTTCTTTAAAATGTGAAGGG + Intergenic
967297012 3:187975130-187975152 CCTTTTCTGTAAAATGGGTGGGG - Intergenic
967353593 3:188543076-188543098 TCTTTCCTTTAGGATGTGACTGG + Intronic
967562766 3:190935751-190935773 TATTTTCTGTATAAAGTGTGAGG + Intergenic
968896150 4:3404814-3404836 TCTTTTCTGTAGAGGGTGTCAGG + Intronic
970167096 4:13250353-13250375 TGTGTTCATTGGAATGTGTGGGG - Intergenic
971067163 4:23046010-23046032 TCTTTACTTTTGGATGTGTGTGG + Intergenic
971752209 4:30665306-30665328 TCTTTTCTTTAACATATGTCTGG + Intergenic
972257215 4:37369996-37370018 TCTGTTCTTTAGCATCTGTGCGG + Intronic
972387504 4:38581456-38581478 TTTTGTCATTAGAATGTGTACGG - Intergenic
972570246 4:40304068-40304090 TTTTTTTTTTAGATTCTGTGTGG - Intergenic
972612758 4:40670523-40670545 TCTTATCCCTAGAATGTGAGAGG + Intergenic
972727423 4:41757383-41757405 TGTTTTCTTTAGGAGGTTTGTGG + Intergenic
973318036 4:48781310-48781332 TCTTCTCTTTTCAATGCGTGAGG - Intergenic
974392547 4:61290785-61290807 TCTTTTATTTACAATGTGTTAGG + Intronic
974642888 4:64654538-64654560 TCTATTCTTTATTGTGTGTGTGG + Intergenic
975351758 4:73355176-73355198 TCTATTCTTCAGTTTGTGTGTGG + Intergenic
975598638 4:76075778-76075800 TTTTTCATTTAGAATGTGAGTGG - Intronic
976017231 4:80572037-80572059 TTTTTTCTTTTTAATGTTTGTGG + Intronic
976519774 4:86013318-86013340 TCTTATAATTAAAATGTGTGTGG + Intergenic
976588105 4:86821355-86821377 TCTTTTTTTGAGAATGTATTTGG - Intergenic
977611932 4:99044495-99044517 TATTATATGTAGAATGTGTGAGG + Intronic
977706187 4:100073133-100073155 TTTTTTTTTTACTATGTGTGAGG - Intergenic
978768561 4:112430307-112430329 TATTTTCCTTAGAATGTATGTGG + Intronic
978869596 4:113559138-113559160 TGTTATCTTTAGAATGTCTGTGG - Intronic
978872308 4:113594148-113594170 TCTGTTCATTTAAATGTGTGTGG - Intronic
978959424 4:114658340-114658362 TCTTTTCCTCAGAATGGATGGGG + Intronic
979762148 4:124419560-124419582 TCTTTTCTTTCAAATGTTTTAGG + Intergenic
979830794 4:125298795-125298817 TCCTTTCTTTGGAATGTGCAAGG + Intergenic
980097582 4:128508353-128508375 TCTTTGCTTTGGAATGTGATTGG + Intergenic
980142739 4:128940158-128940180 TCTTTTTTTTATAATGAGTGGGG - Intronic
980169577 4:129273027-129273049 TTTTTTCTTTAGAATGTTTGTGG + Intergenic
980423578 4:132595330-132595352 TCTTTCCTCTCAAATGTGTGGGG - Intergenic
980567917 4:134569977-134569999 TCTTTTCTTTAGAGTGGTTAAGG - Intergenic
980845832 4:138323808-138323830 TCATTTCTTTAGTATATATGAGG - Intergenic
981322468 4:143408873-143408895 TCTTTTCCTGAGAAAGTGTGGGG - Intronic
981990719 4:150917341-150917363 TCTTTTAATTAGAATCTCTGTGG - Intronic
982631861 4:157840269-157840291 TCTTTTATTTATAAGCTGTGTGG + Intergenic
982705434 4:158704098-158704120 TCTTTTCTTTTTTGTGTGTGGGG - Intronic
983611671 4:169653331-169653353 TCTTTTCTTTATAAATTGTCCGG - Intronic
983767667 4:171505830-171505852 TGTTTTCTTTAGAAGATGAGAGG + Intergenic
985125178 4:186686243-186686265 TGTTTTCTTCAGAATGTCGGGGG - Intronic
985977558 5:3432842-3432864 CCTCTTCATTATAATGTGTGTGG - Intergenic
986535683 5:8784509-8784531 ACTTGTCTTTAGAATGTGTGAGG + Intergenic
987389188 5:17360222-17360244 TCTTTTCTTTACAAAGGGTAAGG - Intergenic
988546229 5:32160555-32160577 GTTTGTCTTTAGAATGAGTGAGG - Intronic
989490201 5:42042113-42042135 TATTTTTATTATAATGTGTGTGG + Intergenic
989647791 5:43654858-43654880 TCTTTTCTTGATAATCTCTGGGG + Intronic
990446532 5:55898331-55898353 TCTTTCCTTTTGAAGGTGCGGGG - Intronic
990454688 5:55973637-55973659 TCTTTGCTGTACAATGTCTGGGG - Intronic
991017494 5:61947501-61947523 GCTTTATTTTAGTATGTGTGTGG - Intergenic
991072025 5:62494204-62494226 TCTTTTCTTTATGATGTTTATGG + Intronic
992006653 5:72484949-72484971 TCATGACTTTAAAATGTGTGTGG + Intronic
992549650 5:77848422-77848444 TCTTTTCTTTACAAAGTAGGGGG + Intronic
992949504 5:81844360-81844382 TCATTTCTGATGAATGTGTGGGG + Intergenic
993514488 5:88813802-88813824 TCTTTGTTTTAGGATGTGTTTGG + Intronic
993962028 5:94309812-94309834 TCTGTTATTTATACTGTGTGAGG - Intronic
994366376 5:98922167-98922189 ACTTTTTTTTAGTGTGTGTGTGG - Intronic
994469315 5:100182347-100182369 TTTTTTTTTTGTAATGTGTGAGG + Intergenic
994924733 5:106100120-106100142 ACTTTTCTCTAGAATGTGCATGG - Intergenic
995181605 5:109235309-109235331 TCTGGTCTTTAAAAAGTGTGTGG + Intergenic
995203561 5:109453598-109453620 TCTTTTCATTTAAATGTGGGAGG - Intergenic
995351005 5:111175552-111175574 TCATCTCTTTAGAATGTGTAGGG + Intergenic
996402625 5:123079363-123079385 TTTTCCCTTTAGATTGTGTGTGG - Intergenic
996993416 5:129665109-129665131 TCTTTAGGTTAGAAAGTGTGGGG - Intronic
998653055 5:144142815-144142837 TACTTTCCTTAGAATCTGTGAGG + Intergenic
999048079 5:148491338-148491360 TCTTGCCTTAAGAATGTATGAGG + Intronic
1000317462 5:160106525-160106547 TCTTGTTTTTTTAATGTGTGAGG - Intronic
1002317729 5:178354764-178354786 TCTTTTCTTTAGGTTGGGTGTGG + Intronic
1002666564 5:180829925-180829947 TATTTTCTTTGGTATGCGTGTGG - Intergenic
1002807196 6:588650-588672 TCTTTTCATTAGAAAGTGAAGGG - Intronic
1002819114 6:707288-707310 TCTTTTCTTAACAGTGTGTGTGG - Intergenic
1004066691 6:12253094-12253116 TTTTTTCCTTTGAGTGTGTGGGG - Intergenic
1007951583 6:45877305-45877327 TCTATTAGTTAGGATGTGTGTGG - Intergenic
1008127327 6:47683549-47683571 TCTTTTTTTCTGAATGTGTGCGG + Intronic
1008162519 6:48095939-48095961 TCTTTTTTTTTAAATGTGTGAGG - Intergenic
1008704321 6:54139120-54139142 AGCTTTCTTTAGAGTGTGTGTGG + Intronic
1009262509 6:61511869-61511891 ACTGTTTTTTAGAATCTGTGTGG + Intergenic
1009617651 6:66031501-66031523 TTTTATCCTTAGAATGTGTGAGG + Intergenic
1009654815 6:66528265-66528287 TTTTTTCTTTACAATGCATGAGG - Intergenic
1010114291 6:72283563-72283585 TCTTTTCTTCACAATTTGTGGGG + Intronic
1010152795 6:72755161-72755183 TCTTTTGATTAGCATTTGTGTGG + Intronic
1010329327 6:74604311-74604333 TCTTATCTGGAAAATGTGTGTGG + Intergenic
1010368399 6:75079375-75079397 GGTTTTCTTTAGAATGTGGGTGG - Intergenic
1010650622 6:78450908-78450930 TTTTTTCTTTAAAATCTGTTAGG - Intergenic
1010674317 6:78723334-78723356 TTTTTTCTTCAGAATGAATGAGG - Intergenic
1010766717 6:79783542-79783564 TATTTTCTTTTGAATGTGAAAGG + Intergenic
1010802020 6:80187380-80187402 GCTTTTATTTAGAATGTTGGGGG + Intronic
1011230946 6:85161364-85161386 TGTTTTCTTTAGGTTATGTGTGG - Intergenic
1012163495 6:95918622-95918644 GGCTTTCTTTATAATGTGTGTGG + Intergenic
1012304733 6:97640253-97640275 TCTATGCTTTAGATTGTGTTAGG + Intergenic
1012507220 6:99961215-99961237 TTTTTTTTTTAGAATGTTTTAGG + Intronic
1012995256 6:105966518-105966540 TGTTTTCATTAGAATGTCTTTGG + Intergenic
1013240360 6:108239626-108239648 TCTTCTCTTTTGAATGTCTTCGG - Intronic
1013647393 6:112158870-112158892 TTTTTTCTTTAGAATGCGTCAGG - Exonic
1014232575 6:118920631-118920653 TCTGTTCATTTAAATGTGTGTGG + Intronic
1014265024 6:119267853-119267875 TCTTTTCCTTATAATTTATGTGG + Intronic
1014648893 6:124010810-124010832 TCTTATTTTTAGAAACTGTGTGG + Intronic
1015602569 6:134924683-134924705 CCTTTTCTTTAGTAGGTTTGTGG - Intronic
1015956484 6:138603928-138603950 TCTTTTATTCAGAGTCTGTGTGG - Intronic
1016134612 6:140524256-140524278 GCTTTTCCTTGGTATGTGTGTGG + Intergenic
1016343615 6:143087304-143087326 TCCATTCCTTGGAATGTGTGAGG - Intronic
1016605738 6:145922855-145922877 TCTTTTCTTTGTATTGTGTGTGG - Intronic
1017274713 6:152553028-152553050 TCTTCTATTTAGAATGTATGTGG + Intronic
1017926395 6:158914854-158914876 TCTTTTCCTTAACATGTGGGTGG + Intergenic
1017940742 6:159050802-159050824 TTTGTTATTTTGAATGTGTGTGG + Intergenic
1017988389 6:159464735-159464757 TATTTACTTTAAAATGAGTGTGG - Intergenic
1018327760 6:162692290-162692312 TCTTTTCTTTAGAATGTGTGTGG - Intronic
1018553342 6:165024277-165024299 TCTTTTTTAAAAAATGTGTGAGG + Intergenic
1019661511 7:2226697-2226719 TCTTCTCTTTAGGTTGGGTGTGG + Intronic
1020691272 7:11357566-11357588 TCTCTTCTATAGAATCTGTTTGG + Intergenic
1020696753 7:11422548-11422570 TACTTTGTTTAGAATGTGTTTGG + Intronic
1020929452 7:14374536-14374558 GCTTTTTATCAGAATGTGTGCGG - Intronic
1022231323 7:28415754-28415776 TCTTTTCTCTATTATCTGTGAGG + Intronic
1022511386 7:30936993-30937015 TCCTTTCTCTGGAATGTCTGTGG + Intergenic
1023112802 7:36831167-36831189 TCAGTTCTTCAGAAAGTGTGGGG - Intergenic
1024353047 7:48387053-48387075 TTTTTTGATTAGAATGTGCGAGG + Intronic
1025004053 7:55341870-55341892 TAATTTCTTTAAACTGTGTGTGG + Intergenic
1025822519 7:64981915-64981937 TCTTTTTTGTAGAATGTTTTTGG - Intronic
1027957292 7:84897059-84897081 TCTGTTCTTTGTAATATGTGTGG - Intergenic
1028500838 7:91517526-91517548 TCTTTTCTTTTTTGTGTGTGTGG - Intergenic
1030709667 7:112735496-112735518 TGTTTCCTTGAGAATGTCTGTGG + Intergenic
1030925376 7:115446813-115446835 TTATTTCTTTAGCATGAGTGAGG - Intergenic
1031250832 7:119378690-119378712 TCCATTCTTTGGAATTTGTGAGG - Intergenic
1031291584 7:119944151-119944173 TTTTTTTTTTTTAATGTGTGTGG - Intergenic
1031521639 7:122773827-122773849 TCATTTCTTTAAAATGTGAAAGG - Intronic
1032524771 7:132571795-132571817 TCTTTACTTTAGACTCTATGAGG - Intronic
1032851710 7:135800874-135800896 GCTTTTCTTCCCAATGTGTGGGG - Intergenic
1032879151 7:136070353-136070375 TCTTTTCTCTACAAAGTTTGAGG - Intergenic
1034138449 7:148794255-148794277 TTTTTTCTTTATATTGTTTGTGG + Intronic
1034249536 7:149677080-149677102 TCTATTCCTTGGAATCTGTGAGG + Intergenic
1034993614 7:155564344-155564366 TCTTTTCTTGACAATTTTTGTGG - Intergenic
1035853710 8:2949386-2949408 TCTTTTCTTTCCTATGTGTCAGG - Exonic
1035893055 8:3366958-3366980 TCTGTTAGTGAGAATGTGTGTGG - Intronic
1036635952 8:10549561-10549583 TCTTTTCTTGATGATCTGTGGGG - Intronic
1037009795 8:13826939-13826961 TCTTTTGTTTAAAATTTCTGAGG - Intergenic
1037188169 8:16090063-16090085 TCTTTTCTTTAATATCAGTGGGG + Intergenic
1038037206 8:23696568-23696590 TCTTTCGTTTGGATTGTGTGGGG + Intergenic
1038688777 8:29742423-29742445 TCCTTTCATGAGATTGTGTGAGG + Intergenic
1038756610 8:30347236-30347258 TATTTTATTTAATATGTGTGCGG - Intergenic
1039371389 8:36987405-36987427 TAGTTTCATTATAATGTGTGGGG + Intergenic
1039786098 8:40835366-40835388 CCTATTCTTTAAAATGTGAGTGG - Intronic
1040113332 8:43585140-43585162 TCTCTTTTGTAGAATATGTGAGG + Intergenic
1040135672 8:43850830-43850852 TCTTTTTTATAGAATATGTGAGG + Intergenic
1040137917 8:43876945-43876967 TCTTTTTTTGAGAATCTGTGAGG - Intergenic
1040321336 8:46307480-46307502 TCTTTTTTTTAGAATCTGTGAGG - Intergenic
1040321400 8:46308506-46308528 CTCTTTCTTTAGAATCTGTGAGG - Intergenic
1040326511 8:46345238-46345260 TTTTTTTTTTAGAATCTGCGAGG + Intergenic
1040347083 8:46515012-46515034 CTGTTTCTTTAGAATCTGTGAGG + Intergenic
1040721176 8:50325221-50325243 TCTTAACTTTAGAATCAGTGTGG + Intronic
1040876732 8:52160659-52160681 CCTTTTCATTAGAATGTTTAAGG + Intronic
1040924463 8:52663643-52663665 TACTTCCTTTAGAATGTGTTTGG - Intronic
1041550316 8:59092932-59092954 TGTTTTCTTTAGAAGCAGTGAGG + Intronic
1042158427 8:65868196-65868218 TCTTTGCTTTTGAAGGTTTGGGG - Intergenic
1042757082 8:72226800-72226822 TCTTTTATTTTTAATTTGTGTGG - Intergenic
1043108863 8:76152093-76152115 TCCTTCCTTTAGCATGTGTATGG - Intergenic
1043391276 8:79794672-79794694 TCTCTCCTTTTGAAAGTGTGGGG + Intergenic
1044690440 8:94871640-94871662 TCTTTTCTTCAGAATGTCAAAGG - Intronic
1044776164 8:95690653-95690675 TCAATTCTTTAGAATTTGTATGG - Intergenic
1044810788 8:96059087-96059109 TGGCTTCTTTAGAATGTGTGCGG + Intergenic
1044950116 8:97427682-97427704 GTATTTCTTTAGAATGTCTGAGG - Intergenic
1045085886 8:98684849-98684871 TCTTTTCGTTAAAAAATGTGTGG - Intronic
1045560261 8:103254815-103254837 TGTTTTCTTTAAAATGGCTGGGG + Intergenic
1045684292 8:104695473-104695495 TAATTTCTTTGGAATGTGTTTGG + Intronic
1045723285 8:105139661-105139683 TTTTTTCTCCAAAATGTGTGTGG + Intronic
1045827795 8:106421201-106421223 AGTGTTCTATAGAATGTGTGTGG - Intronic
1046578024 8:116056158-116056180 TCTTTCCTTTAGGATCAGTGTGG - Intergenic
1046633328 8:116644082-116644104 TCTTTTCTTTAAAATTTCTGTGG + Exonic
1047012978 8:120692363-120692385 GCCCTTATTTAGAATGTGTGTGG - Intronic
1047059761 8:121212009-121212031 TCATTTCCTTGGAATGTGTGAGG + Intergenic
1047104104 8:121714206-121714228 TCCTTTCTGTAAACTGTGTGGGG + Intergenic
1047307632 8:123665948-123665970 TCTTTGCTTTAAAATGAGTCTGG + Intergenic
1047378914 8:124336955-124336977 TCTTTTCTTTTTAATATCTGTGG - Intronic
1049264850 8:141662413-141662435 TCTTTTCTGTAAAATGTGGGTGG - Intergenic
1050858184 9:10388786-10388808 CCTATTCTTTAGGAAGTGTGAGG + Intronic
1051511108 9:17878855-17878877 TTTTTTCTTTGGAATATATGTGG - Intergenic
1052132652 9:24868089-24868111 TCTTGTCTTTTAAAAGTGTGTGG - Intergenic
1052323146 9:27190108-27190130 TCCTTTCTTTAGATTGATTGTGG - Intronic
1052539351 9:29787994-29788016 TCTTTTTTTTTAAATGTATGTGG - Intergenic
1054916976 9:70503740-70503762 TCTTGTCTGTAGCATCTGTGTGG + Intergenic
1055413655 9:76058983-76059005 TCTTTTTTTTCGTCTGTGTGGGG - Intronic
1056841375 9:90000374-90000396 TCATTTCTTTGAACTGTGTGTGG + Intergenic
1056844612 9:90026282-90026304 TATTTTATTTAGTATCTGTGTGG - Intergenic
1058789625 9:108429733-108429755 TCTTTTTTCTTGTATGTGTGTGG - Intergenic
1059000997 9:110348819-110348841 TCTTTTTTTTGGTGTGTGTGTGG + Intergenic
1059034519 9:110739640-110739662 ACCTTTCTTTGGAATGTGTAGGG + Intronic
1060248865 9:121969539-121969561 TTTTATCTTTAGTCTGTGTGAGG + Intronic
1060726320 9:126008282-126008304 TCTGGTCTTTTGAAAGTGTGTGG + Intergenic
1061529612 9:131200179-131200201 TCTTTCATTTAGTATCTGTGCGG + Intronic
1061884417 9:133584371-133584393 TCTTATCTGTACAATGGGTGTGG + Intronic
1062175748 9:135161679-135161701 TCTTTTCTTTTTTTTGTGTGAGG - Intergenic
1062208319 9:135349276-135349298 TCTTTTCTTTAAAATGGGGCTGG - Intergenic
1062330275 9:136039138-136039160 TCTTATATTTAGTATTTGTGTGG - Intronic
1185648923 X:1634603-1634625 TCCTCTCTTTAGAATGTGGAGGG + Intronic
1186043493 X:5507763-5507785 TCATTTCTACTGAATGTGTGTGG + Intergenic
1186337502 X:8606534-8606556 TCTTTTCTTTATAATATTTTGGG + Intronic
1186856163 X:13628208-13628230 ACCTTTCTTTGGAATGTGTATGG + Intronic
1188499636 X:30811093-30811115 TTTTTACTTTAAAATGTCTGAGG - Intergenic
1189287518 X:39862000-39862022 TCTTTATTATAGATTGTGTGTGG + Intergenic
1189370400 X:40423481-40423503 TCTTTTCTTTTGACTTGGTGAGG + Intergenic
1189907340 X:45775067-45775089 TTTGTTCTTTAAAATGGGTGGGG - Intergenic
1190626411 X:52342497-52342519 TATTTTATTCAGGATGTGTGGGG + Intergenic
1190747742 X:53335449-53335471 TCTATTCTTTTAAATTTGTGGGG - Intergenic
1191179463 X:57544808-57544830 TCTTTTTTTTTTAATGTGTATGG - Intergenic
1191225351 X:58036606-58036628 TTTTTTCTTTCACATGTGTGGGG - Intergenic
1191229713 X:58084410-58084432 CTCTTTCTTTAGAATGTCTGAGG + Intergenic
1191233581 X:58116625-58116647 CTTTTTCTTTAGAATGACTGAGG - Intergenic
1191235212 X:58128623-58128645 TCTCTTCTGTAGAATGCCTGGGG - Intergenic
1191236499 X:58138567-58138589 CTTTATCCTTAGAATGTGTGGGG - Intergenic
1191241767 X:58195536-58195558 TCTTTCCATTAGAATGCTTGGGG - Intergenic
1191241820 X:58195954-58195976 GTTTATTTTTAGAATGTGTGAGG - Intergenic
1191242106 X:58197802-58197824 TCTTTTCATTAGAGTGCCTGAGG - Intergenic
1191246070 X:58229279-58229301 CTCTTTCATTAGAATGTGTGGGG - Intergenic
1191583850 X:62797076-62797098 TCTTTTTTGTAGAATCTATGTGG - Intergenic
1191957929 X:66666547-66666569 TCTTTTCTTAATAATGTCTTGGG + Intergenic
1193653376 X:84167609-84167631 CCTTTTATTTACAATGTGTTTGG - Intronic
1194665065 X:96668260-96668282 TCTTGTCATTTGAAAGTGTGTGG - Intergenic
1196770836 X:119291638-119291660 TCTTTTCTTTATAAAGTCTCAGG + Intergenic
1198427333 X:136533218-136533240 GCTTTCCTTTTGATTGTGTGCGG + Intronic
1199056310 X:143299180-143299202 TCTTTTCTTTGGAAGGTGGAAGG - Intergenic
1199148755 X:144403897-144403919 GCTTTTCTTTTCAATGTTTGAGG - Intergenic
1199193845 X:145003858-145003880 TCTTTTCTTTTGTAGCTGTGAGG + Intergenic
1201984966 Y:19956272-19956294 TTTTTTCTTGAAAATATGTGTGG + Intergenic