ID: 1018328556

View in Genome Browser
Species Human (GRCh38)
Location 6:162702482-162702504
Sequence TAGTAGGTAGGGAGGGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018328556 Original CRISPR TAGTAGGTAGGGAGGGCTGA GGG (reversed) Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
901455088 1:9358588-9358610 GAGGAGGGAGGCAGGGCTGAGGG - Intronic
901718628 1:11177001-11177023 CAGAAGGTTGGGAGGGCTGCCGG + Intronic
901777049 1:11567240-11567262 GAGGTGGCAGGGAGGGCTGAGGG + Intergenic
901783883 1:11611977-11611999 GTGTAAGTAGGGAGGGCTGCAGG + Intergenic
903967277 1:27098754-27098776 TAGGAGGGAGGGTGGCCTGAGGG - Intergenic
904385628 1:30140335-30140357 TAGCAGGTAGGGAGTGGTGAGGG + Intergenic
905096416 1:35475278-35475300 TAGTATATAGGGAGGGCTTAGGG - Intronic
905243570 1:36596903-36596925 GAGTAGGCAGGGAGGGGTGGTGG - Intergenic
905461010 1:38123033-38123055 TAGGAGGTACGCAGGGCTGTAGG + Intergenic
905811305 1:40915407-40915429 TGGTTTGGAGGGAGGGCTGATGG - Intergenic
906196392 1:43933137-43933159 AAGTGGGTACTGAGGGCTGAAGG - Intergenic
906794764 1:48688110-48688132 AAGAAGGAAGGGAGGGATGAAGG + Intronic
908318357 1:62956945-62956967 GAGAAGGGAGGGAGGGATGAAGG - Intergenic
908697658 1:66862767-66862789 TAGTGGGAAGGGAGGTGTGATGG - Intronic
908790486 1:67776106-67776128 TAGAATGGAGGGAGGGCTGGAGG + Intronic
908958292 1:69663600-69663622 GAAGAGGTAGGGAGGGCTAATGG - Intronic
909449835 1:75785740-75785762 TGGGAAGTAGGGAGTGCTGATGG - Intronic
910240475 1:85080504-85080526 TAGCAGGTGGGCAGGGCTGCAGG + Intronic
910327281 1:86025194-86025216 TGGTAGTTAGGGAATGCTGAAGG - Intronic
910815040 1:91283136-91283158 CAGGAGGTAGGGAGGGCGGCAGG - Intronic
912346702 1:108969553-108969575 TAGTAAATTGGGAGTGCTGATGG - Intergenic
912777658 1:112515932-112515954 TAGAGAGTAGTGAGGGCTGAGGG + Intronic
913976677 1:143464004-143464026 AATTACGTAGGGAGGGCAGAAGG + Intergenic
914071078 1:144289621-144289643 AATTACGTAGGGAGGGCAGAAGG + Intergenic
914108077 1:144676734-144676756 AATTACGTAGGGAGGGCAGAAGG - Intergenic
914454393 1:147822325-147822347 TGGTAGGAAGGTAGGGCAGAGGG - Intergenic
914828919 1:151156601-151156623 GAGTAGGTAGGCGGGGCTCAAGG + Intergenic
918461368 1:184780262-184780284 TAGTAGCTAGGGATGGGGGAGGG - Intergenic
920849998 1:209622353-209622375 GAGTGGGTGGGGAGGGCAGACGG + Intronic
921078987 1:211723920-211723942 TAGATGGTAGGGAGGCCTCAGGG + Intergenic
922194238 1:223345970-223345992 CAGTAGGCAGGGGAGGCTGAAGG - Intronic
922221857 1:223614449-223614471 TAGTAGGTGGGCATGGCTGCAGG - Intronic
922991945 1:229921626-229921648 TAGTAGAAAGGTAGGACTGATGG + Intergenic
923836804 1:237619768-237619790 TAGAAAGTATGGAGGGCAGAAGG + Intronic
924194545 1:241591993-241592015 AAGTAGGTAGGTACTGCTGATGG - Exonic
924277648 1:242404511-242404533 CAGGAGGTAGGGAGGGGTGGGGG + Intronic
1065022405 10:21510729-21510751 GAGTACGTGGGGAGGGCTTAGGG - Intergenic
1065164438 10:22960471-22960493 TTTTAGGGAGGGAGGGGTGAGGG - Intronic
1069629134 10:69887300-69887322 TAGTGGGTTGGGAGGGAAGATGG - Intronic
1071764664 10:88649182-88649204 TGGTAGGGAGGGAGGGGGGAGGG + Intergenic
1075989455 10:126822667-126822689 TAATAGTTAGGGAGGGGTGGTGG - Intergenic
1076921430 10:133456553-133456575 CAGTAAGTAGGGAGGAGTGAAGG + Intergenic
1078611647 11:12824756-12824778 TAGAAGGTAGAGAGGGTTGATGG + Intronic
1079750008 11:24185348-24185370 AAGGAGGGAGGGAGGGATGAAGG + Intergenic
1079873242 11:25826432-25826454 TAGTAGGTAAGGAAGGCTTCTGG - Intergenic
1082737877 11:56876509-56876531 TATTAGAGAGGGAGGGTTGAAGG + Intergenic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1083592565 11:63904181-63904203 AAGGGGGTAGGGTGGGCTGAGGG - Intronic
1084991615 11:72930819-72930841 GAGGAGGTAGGGATGGCTAATGG + Intronic
1085253114 11:75156453-75156475 TAGGAGGTAGGAAGGGCCCAAGG + Intronic
1085627091 11:78081844-78081866 AAGAAGGAATGGAGGGCTGAAGG - Intergenic
1087280619 11:96205802-96205824 AAGAAGGTAGGGATGGATGAAGG - Intronic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088560871 11:111114961-111114983 TAGAAGGGAGGAAGGGGTGAAGG - Intergenic
1090191031 11:124768433-124768455 TGGTAGGTAGGTAGGTCTGAAGG - Intronic
1091122535 11:133067915-133067937 TGGTATCTAGGGAGGTCTGAAGG + Intronic
1092086597 12:5768032-5768054 TAGTAGGTCAGGAAGGGTGAGGG - Intronic
1093531749 12:20174319-20174341 TAGGAGGGAGGGAGGGGTGGGGG - Intergenic
1096121027 12:49089659-49089681 TCCTAGGTAGGTAGGGCTGATGG - Exonic
1096238895 12:49948868-49948890 AAGTTGGGAGGGATGGCTGAGGG + Intergenic
1096574670 12:52545201-52545223 TGGGAAGTAGGGAGGGCTGAGGG - Intronic
1098670321 12:73220194-73220216 TAGGAGGTGGGGATGGCTAATGG + Intergenic
1101269026 12:103123277-103123299 TTGCAGGTAGGGAGTGCTGAAGG + Intergenic
1101392738 12:104317296-104317318 TTGTGGGTAGGGAAGGCTGCAGG - Intronic
1101726991 12:107395962-107395984 CAGCAGGGAGGGAGTGCTGAAGG + Intronic
1101958926 12:109233715-109233737 GGGTAGAGAGGGAGGGCTGAGGG - Intronic
1103012401 12:117467138-117467160 GAGTAGGGAGGGAGAGGTGACGG + Exonic
1103956804 12:124581979-124582001 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1104849218 12:131863293-131863315 AAGTGGGGAGGGAGGGGTGAAGG + Intergenic
1105222556 13:18345815-18345837 AATTACGTAGGGAGGGCAGAAGG - Intergenic
1105347750 13:19589490-19589512 TAGGAGTTAGGCAGGGCAGAAGG - Intergenic
1105558290 13:21466234-21466256 TAGTAGGAAGCCAGGTCTGAGGG - Intergenic
1106065176 13:26340856-26340878 TAGAAGGGAGGGAGGGAGGAAGG + Intronic
1106628263 13:31442816-31442838 TAGGAGGAAGTGAGGGCTCACGG + Intergenic
1106935852 13:34718654-34718676 TAGGAGGAAGGGAGGGCAGCAGG + Intergenic
1107373799 13:39780635-39780657 TATTATTTAGGGAGGTCTGAGGG + Intronic
1108532498 13:51340957-51340979 TAGGGGCTAGGGACGGCTGAGGG - Intronic
1110754914 13:79161509-79161531 TAGTATGGAGGGAGGGGGGAGGG + Intergenic
1111118279 13:83811162-83811184 TGGTAGGTATGAAGGGCAGATGG - Intergenic
1111882044 13:93969710-93969732 TAGAGGGGAGGGAGGGATGAAGG - Intronic
1112138150 13:96606624-96606646 AGGGAGGGAGGGAGGGCTGAGGG + Intronic
1115224022 14:31085171-31085193 CAGTAGATAGTGAGGGCTGGTGG - Exonic
1116202177 14:41811778-41811800 AAGTAGGGAGTGAGTGCTGATGG + Intronic
1118744427 14:68763382-68763404 GAGGAGGTAGGGAGGGATGGTGG + Intergenic
1122302114 14:100737109-100737131 TGATAGGAAGGGAGGGCTGGTGG - Exonic
1122653503 14:103240757-103240779 CAGGAGGAAGGCAGGGCTGATGG + Intergenic
1125064957 15:35471497-35471519 TGGTAGGTAGGGAGGTGTGGAGG - Intronic
1125461098 15:39907595-39907617 CAGCAGGCAGGGAGGGCTAAGGG - Intronic
1125526032 15:40375416-40375438 TACTAGCTAGGCAGAGCTGAGGG - Intergenic
1127194482 15:56568938-56568960 GGGTAGGTAGGGAAGGCTGTTGG - Intergenic
1127219381 15:56861786-56861808 TACTAGGGAGTGAGGGTTGAAGG + Intronic
1127299887 15:57642865-57642887 TACTATGTAGGAAGGGCTCATGG + Intronic
1128056711 15:64705002-64705024 GAGTAGGTAGGGATAGCTGAGGG - Intergenic
1128301220 15:66567528-66567550 TGCTAGGTAGCGAGGCCTGAAGG - Intergenic
1128778255 15:70340512-70340534 TATTAGCAAGGGTGGGCTGATGG - Intergenic
1130294720 15:82637516-82637538 TACTCCGTACGGAGGGCTGATGG - Intronic
1130751268 15:86715656-86715678 TACTAAGTAGGGATGGCTGTTGG + Intronic
1131379257 15:91950186-91950208 AATGAGGTAGGGAGGCCTGATGG + Intronic
1136513794 16:30755901-30755923 TAGTGGGTAGGTAGGGTTGGAGG + Intronic
1137539102 16:49349847-49349869 CAGTAGGGAGGGAGCTCTGAGGG - Intergenic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1137985913 16:53107949-53107971 CAATAGGGAGGGAGGGGTGAAGG + Intronic
1138134936 16:54513276-54513298 TGGTAGGTGGGGAAGGCAGATGG - Intergenic
1138256960 16:55573808-55573830 TAGAAAGTAGGGAGGACTGAAGG - Intronic
1138414145 16:56861604-56861626 AAGTGGGTAGGGAGGCCTGTGGG + Intergenic
1139707613 16:68752282-68752304 AAAGAGGTGGGGAGGGCTGAGGG - Intronic
1140773350 16:78226806-78226828 CAGCAGGTAGGGAAGGCTGGGGG - Intronic
1141193623 16:81842873-81842895 GGGTAGGCAGGGAGGGCTGAGGG + Intronic
1203112953 16_KI270728v1_random:1463364-1463386 GAGTAGGGAGGGACTGCTGAAGG + Intergenic
1143206777 17:5147675-5147697 TAGTAGGTAGATAGTCCTGACGG + Intronic
1143349139 17:6274621-6274643 TAGTAGGTGGTGAGTTCTGATGG - Intergenic
1143547408 17:7605988-7606010 TAATAGGTTGGGAGAGCTGAGGG - Intronic
1144590879 17:16522724-16522746 TAGTCTGTAGGGGAGGCTGAGGG - Intergenic
1145300608 17:21633233-21633255 TAGTAGGTAGGAAGGAAGGAAGG + Intergenic
1145349685 17:22070008-22070030 TAGTAGGTAGGAAGGAAGGAAGG - Intergenic
1146595403 17:34164002-34164024 AAGAAGGTAGGTAGGGTTGATGG - Intronic
1147273145 17:39291347-39291369 TGGTAGGTAGGGAGGGAGGGAGG + Intronic
1147368383 17:39974502-39974524 CAGCAGGTAGGGAGATCTGACGG + Intronic
1149174403 17:53852786-53852808 TAATAGGTAGGTTGGGATGAGGG - Intergenic
1149873615 17:60206518-60206540 TAGTAGGTAGATAGTCCTGACGG - Intronic
1149920324 17:60652132-60652154 TAGTAGGGAGAGAGAGATGAAGG - Intronic
1150087399 17:62283773-62283795 TAGTAGGTAGATAGTCCTGACGG - Intergenic
1150221834 17:63500030-63500052 TAGAGGGTGGGGAGGGCTGTGGG - Intronic
1151163922 17:72188168-72188190 AAGGAGGGAGGGAGGGATGAAGG + Intergenic
1151917846 17:77131835-77131857 TAGTAGGAAGGGTGTCCTGAAGG + Intronic
1152288117 17:79424093-79424115 CAGGAGACAGGGAGGGCTGAAGG - Intronic
1152891043 17:82881925-82881947 TAGGAGGGAGGGAGGGAGGAAGG - Intronic
1153367835 18:4278426-4278448 TAGGAGAGTGGGAGGGCTGAGGG - Intronic
1156808017 18:41210346-41210368 TATTACGGAGGGAGGGGTGAGGG + Intergenic
1157496949 18:48162938-48162960 CAGTCAGTAGGAAGGGCTGAGGG + Intronic
1158432171 18:57399295-57399317 AAGTAGGTAGGACTGGCTGATGG - Intergenic
1160567080 18:79792848-79792870 GCGGAGGTCGGGAGGGCTGAGGG + Intergenic
1160660103 19:293963-293985 CAGTGGGCAGGGAAGGCTGAGGG + Intergenic
1161131359 19:2590805-2590827 TAGTTGGTTGGGTGGGCGGATGG - Intronic
1161284039 19:3459675-3459697 GAGGAGGGAGGAAGGGCTGAGGG + Intronic
1162533931 19:11252267-11252289 GGGCAGGTAGGGAGGGCTGAGGG + Intronic
1162824400 19:13242871-13242893 CAGCTGGTAGGGAGGGCTGGGGG + Intronic
1162842006 19:13363591-13363613 GAGTGGGGAGGGAGGGCTCAGGG + Intronic
1162911501 19:13850337-13850359 ATGAAGGTGGGGAGGGCTGAGGG - Intergenic
1162955055 19:14092828-14092850 AAGTGGGCTGGGAGGGCTGAGGG + Exonic
1163551076 19:17966862-17966884 TAGGAGGTCCGGAGGGCTGTTGG + Intronic
1164926642 19:32135829-32135851 TTGGAGGTGGGGAAGGCTGAGGG + Intergenic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166231181 19:41426610-41426632 TGGCAGGTAGGGTGGGCTCAGGG + Exonic
1167646849 19:50710661-50710683 GAGCAGGAAGGGAGTGCTGAAGG - Intronic
925017594 2:543654-543676 TAGGAGGCAGGGAGGGGGGAGGG + Intergenic
925834411 2:7930166-7930188 TAGAGGGAAGGAAGGGCTGAGGG + Intergenic
926218502 2:10920082-10920104 TCGGTGCTAGGGAGGGCTGAGGG - Intergenic
926346387 2:11950173-11950195 TGGTAGGTTGAGAGGCCTGAAGG - Intergenic
926965197 2:18402119-18402141 TAGTATGTGGGAAGGGGTGATGG - Intergenic
928990678 2:37230668-37230690 TAGTAAGAAAGGAGGGCCGAGGG - Intronic
932115746 2:69045244-69045266 GAGTAGAAAGGGAGGGCTTATGG + Intronic
932703862 2:74008751-74008773 GAGTAGGAAGGGAGGGGTGGGGG + Intronic
934181377 2:89624967-89624989 AATTACGTAGGGAGGGCAGAAGG + Intergenic
934291679 2:91699209-91699231 AATTACGTAGGGAGGGCAGAAGG + Intergenic
935025145 2:99269523-99269545 CAGAAGGTAGGAAGAGCTGAGGG + Intronic
935667520 2:105525476-105525498 AGGGAGGTGGGGAGGGCTGAGGG + Intergenic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
936329497 2:111535560-111535582 TTGTAGGTAGACAGGGCAGAAGG + Intergenic
937149056 2:119673458-119673480 GAGTAGGGAGGGAGTGGTGAAGG - Intergenic
937970791 2:127547128-127547150 TAGGTGGAAGGGTGGGCTGATGG - Intronic
938928804 2:136067909-136067931 TAGAAGGAAGGGAGGGAGGAAGG - Intergenic
940043769 2:149387949-149387971 TATTTGGTAGGGAGCACTGAAGG + Intronic
941163791 2:162063803-162063825 TGGTAGGTTGGCAGGGATGAGGG + Intronic
942919381 2:181352676-181352698 TAGTAGGAAGGGAGGGTGGGAGG + Intergenic
946412801 2:219523377-219523399 TAGGAGCCAGGGAGGGCTGGGGG - Intronic
947925323 2:233916328-233916350 TAGTAAGTAGGGAAGGGTGGGGG - Intergenic
948019002 2:234714966-234714988 TGGGAGGTAGGGAGGGCTGAGGG + Intergenic
948274131 2:236695251-236695273 TGGCAGGAAGGCAGGGCTGAGGG + Intergenic
1169707172 20:8518682-8518704 CAGCAGGTTGGGAGGGCTGATGG + Intronic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1172298315 20:33829878-33829900 TAGTAGATAGGAAGGGAAGAAGG + Intronic
1172978048 20:38920923-38920945 TACAAGGTAGGGAGTTCTGAGGG + Exonic
1174167652 20:48596592-48596614 AAGTAAGTAGCCAGGGCTGATGG + Intergenic
1175273264 20:57749520-57749542 GAGGAGGGAGGGAGGGGTGAAGG + Intergenic
1175292065 20:57882542-57882564 AAGTGGGGAGGGATGGCTGACGG + Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176651222 21:9549396-9549418 TAGTAGGTAGGAAGGAAGGAAGG + Intergenic
1176731105 21:10498239-10498261 AATTACGTAGGGAGGGCAGAAGG - Intergenic
1177778670 21:25599111-25599133 CAGTAGGTAAGGGGTGCTGATGG - Intronic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1179008574 21:37535384-37535406 TAGAAGGTGGGGAGAGATGAGGG + Intergenic
1179388926 21:40969826-40969848 TAGGAGGGAGGGAGGGAGGAAGG + Intergenic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1183611353 22:38908744-38908766 TAGTAGTTACTGAGGGCTGGGGG - Intergenic
950432381 3:12958298-12958320 TTGTAGGTAGGGGAGGTTGAGGG - Intronic
950975892 3:17244465-17244487 TAGGAGGAAGGAAGGGCAGAAGG - Intronic
951891603 3:27572872-27572894 TAGGAGGTAGAGAGGGAGGAAGG - Intergenic
953026695 3:39149333-39149355 TGGGAGGTAGGAAGGGCTGGGGG + Intronic
953229486 3:41051991-41052013 AAGTAGGTATGGAGGAGTGATGG - Intergenic
953385669 3:42504488-42504510 TGGGAGGTGGGTAGGGCTGAAGG - Intronic
953546760 3:43869232-43869254 TAGGAGGCAGGGAGGGATGAAGG + Intergenic
954635698 3:52069716-52069738 TAAGAGGTGGGGAGGCCTGAAGG + Intergenic
956631132 3:71317244-71317266 TAGAAGGTAGAGGGGGTTGAAGG - Intronic
961577367 3:127848899-127848921 TAGGAGGTAGGGAAGGCTCCAGG + Intergenic
961698778 3:128725923-128725945 GAGTAAGGAGGGATGGCTGAGGG + Intergenic
962962303 3:140321884-140321906 TCGTAGGAAAGGAGGACTGAAGG + Intronic
963476348 3:145809715-145809737 TCATAGGTAGGTAGGGCTGAGGG - Intergenic
965505632 3:169511867-169511889 TAGTTGGGAGAGAAGGCTGATGG - Intronic
967751354 3:193119705-193119727 TAGTGGGTGGGAAGGGCTGTTGG - Intergenic
969465848 4:7355947-7355969 TGGAAGGAAGGGAGGGCAGAGGG - Intronic
971557612 4:28034705-28034727 GAGTAGGTAGGGATGGTTAATGG + Intergenic
972465198 4:39348946-39348968 CAGAAGGGAGGGAGGGGTGATGG - Intronic
974623400 4:64389883-64389905 TATTAGAAAGGGAGGGCTGGTGG + Intronic
976466245 4:85372039-85372061 GAGTGGGGAGGGAGGGTTGAAGG + Intergenic
977762195 4:100752116-100752138 TAGAAAATAGGGAGGGCTAAAGG - Intronic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
981842295 4:149126612-149126634 CAGAAGGGAGGGAGGGATGAAGG + Intergenic
984822059 4:183890571-183890593 AAGAAGGGAGGGAGGGATGATGG + Intronic
985648597 5:1096847-1096869 AAGGAGGGAGGGAGGGATGAAGG + Intronic
985819915 5:2152819-2152841 AAGAAGGGAGGGAGGGGTGAAGG - Intergenic
986627017 5:9731602-9731624 TATTAAGTAAGGAGTGCTGAAGG - Intergenic
990023515 5:51158279-51158301 TAGTAGGTAGAAAGTGCTGTAGG - Intergenic
990388142 5:55288716-55288738 AAGGAGTTAGGGAGGGCTTAGGG + Intronic
992895413 5:81240912-81240934 TGGTATTTAAGGAGGGCTGAGGG + Intronic
993412004 5:87585986-87586008 TACAAGGAAGGGAGGGATGAAGG - Intergenic
995440223 5:112183196-112183218 AGGTAGGTAGGGAGCTCTGAGGG - Intronic
996810074 5:127506781-127506803 CGGTAGGGAGTGAGGGCTGAAGG + Intergenic
997341013 5:133144661-133144683 TAGGAGGAAGGAAGGCCTGAGGG + Intergenic
1002427732 5:179185949-179185971 TACCAGGGAGGGAGGGCTGAGGG - Intronic
1003637874 6:7850430-7850452 TAGTAAGGAGGGAGGGATGAAGG - Intronic
1003978315 6:11365174-11365196 TGAAAGGTAGGGAGGGGTGAGGG - Intronic
1004934858 6:20497177-20497199 AAGGAGGGAGGGAGGACTGAAGG + Intergenic
1005363010 6:25050008-25050030 GAGCAGGGAGGGAGGGATGAGGG + Intergenic
1006734077 6:36259827-36259849 TACTAGGGAGGGAGGGAGGAGGG + Intronic
1006896591 6:37475254-37475276 TGGTGGGTAGTGGGGGCTGAAGG + Intronic
1008247499 6:49195861-49195883 TAGGAGGTGGGGATAGCTGAAGG - Intergenic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1011160228 6:84381259-84381281 TATTAGGGAGGGCAGGCTGATGG + Intergenic
1013637697 6:112044726-112044748 TTGGAGGCAGGGAGGCCTGAAGG + Intergenic
1015263769 6:131268050-131268072 TAGAAGGAAGGGAGGGATGGAGG + Intronic
1016317663 6:142808329-142808351 AAGGAGGGAGGGAGGGATGAAGG + Intronic
1018328556 6:162702482-162702504 TAGTAGGTAGGGAGGGCTGAGGG - Intronic
1018501218 6:164412914-164412936 TAGTATGAAGGGACAGCTGAAGG + Intergenic
1022804389 7:33807346-33807368 CAGTAGGCTGGGAGGGATGAGGG - Intergenic
1025277902 7:57600303-57600325 TAGTAGGTAGGAAGGAAGGAAGG + Intergenic
1025992835 7:66508587-66508609 AAGTAGGGAGGGAGGGAGGAAGG - Intergenic
1026079057 7:67200918-67200940 AAGTAGTTTGGGATGGCTGAAGG + Intronic
1026464853 7:70645218-70645240 GGGGAGGTTGGGAGGGCTGAGGG - Intronic
1026517658 7:71086813-71086835 TAGCAGGTGGGGAAGGCTGGTGG + Intergenic
1026697769 7:72611020-72611042 AAGTAGTTTGGGATGGCTGAAGG - Intronic
1026978146 7:74511277-74511299 CTGTAGGGAGGGTGGGCTGAAGG + Intronic
1027779172 7:82501508-82501530 TTAGAGGAAGGGAGGGCTGAAGG - Intergenic
1028194365 7:87888638-87888660 TAATAGGTAGGTAGGGATGTGGG - Intronic
1029177585 7:98675765-98675787 TAGGAGGAGGGGTGGGCTGATGG - Intergenic
1030698618 7:112614637-112614659 TAGTGGGGAGGGAGGAATGAGGG - Intergenic
1030844105 7:114387844-114387866 TAGTAGAAAGGGAGGGGTTATGG + Intronic
1031288750 7:119906752-119906774 TAGTAGCTGGGGAGGGTAGAGGG - Intergenic
1033420991 7:141204420-141204442 GTGGAGGTAGGGAGGGCTGCTGG + Intronic
1034207404 7:149329953-149329975 TAGTAGAGAGAGAGGGCTGGAGG + Intergenic
1034387064 7:150748800-150748822 TGGAAGGCAGGGAAGGCTGATGG + Intronic
1034598475 7:152223281-152223303 AATTACGTAGGGAGGGCAGAAGG + Intronic
1034942890 7:155243348-155243370 TAGTAAGGAGGGAGTGCAGAAGG + Intergenic
1034981954 7:155484774-155484796 CTGTAGGCAGTGAGGGCTGAAGG - Intronic
1035167174 7:156998712-156998734 GGGTAGGTAGGGAGGGTTAATGG + Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413834 7:158667512-158667534 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413864 7:158667598-158667620 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413902 7:158667712-158667734 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413975 7:158667917-158667939 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414044 7:158668119-158668141 GGGTAGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414095 7:158668262-158668284 AGGTAGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414134 7:158668379-158668401 TAATAGGTAAGGAGGGCGGAGGG - Intronic
1037768010 8:21783631-21783653 TAGAAGGTGTGGAGGGGTGAGGG - Intronic
1038240528 8:25803682-25803704 GAGCAGGTAGGGAGGGATGAGGG + Intergenic
1040869278 8:52083622-52083644 AAGTTGGTAGGGAGGGATGATGG + Intergenic
1041304815 8:56447513-56447535 TGGTGGGGAGGGAGGGATGAGGG + Intergenic
1046780401 8:118208900-118208922 CTGTATGTAGGGAGGGCTCAAGG + Intronic
1047343731 8:124007296-124007318 TAGAAGGTAGGGGGGGGAGAGGG - Intronic
1052215298 9:25959947-25959969 TAGCATGTAGGGAAGGCTGGTGG + Intergenic
1053047741 9:34934523-34934545 GAGTAGGAAGGGGGGGCTGGGGG - Intergenic
1054892814 9:70270463-70270485 GAGTAGGTTGGTGGGGCTGAAGG + Intronic
1055819316 9:80242802-80242824 AAGGAGGTAGGGAGGGAGGAAGG - Intergenic
1055907691 9:81313242-81313264 TAGTGGGTAGTGAAGGCTGAAGG - Intergenic
1056749039 9:89332486-89332508 TAGTAGTTAGCAGGGGCTGAGGG - Intronic
1057829502 9:98395862-98395884 GAGCAGGTAGGAAGGGCTGGGGG + Intronic
1059086708 9:111310881-111310903 GAGGAGGGAGGGAGGGATGAAGG - Intergenic
1059754161 9:117276673-117276695 GAGGAGGAAGGGAGGGCTGAGGG + Intronic
1060018592 9:120109067-120109089 TAATAGGCATAGAGGGCTGAGGG - Intergenic
1062050614 9:134444678-134444700 AAGTAGGTAGGGAGGAGGGAAGG - Intergenic
1203416814 Un_KI270330v1:894-916 TAGTTGCTACCGAGGGCTGAGGG - Intergenic
1203628957 Un_KI270750v1:52946-52968 TAGTAGGTAGGAAGGAAGGAAGG + Intergenic
1188459238 X:30404286-30404308 CAGAATGTGGGGAGGGCTGAAGG + Intergenic
1189899975 X:45696462-45696484 TAGAAGGTATGGAGGACAGAGGG - Intergenic
1192105821 X:68315282-68315304 AAGGAGGTAGGGAGGGAGGAAGG + Intronic
1193086211 X:77449278-77449300 CAGTAGGTTGGGAGGGGTAATGG + Intronic
1199279130 X:145978651-145978673 TAGTTGGTGGGGATGGTTGATGG + Intergenic
1199482976 X:148318222-148318244 TAGTAGATACTGAGGGCTGAGGG + Intergenic