ID: 1018329062

View in Genome Browser
Species Human (GRCh38)
Location 6:162708511-162708533
Sequence AGTGTCATGAAAGCCGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018329062 Original CRISPR AGTGTCATGAAAGCCGTGTT AGG (reversed) Intronic
917229622 1:172822147-172822169 AGTGTTCTGAAAGCAGAGTTGGG + Intergenic
1063830887 10:9951267-9951289 AGTGAAATGAAATCCCTGTTAGG + Intergenic
1068042377 10:51841386-51841408 AGTGTGATAAATGCCTTGTTAGG + Intronic
1074057763 10:109938235-109938257 AGTGTCAGGAAAGGCCTCTTTGG + Intergenic
1076527738 10:131123057-131123079 AGTCTCATGACAGCTGTGTGGGG - Intronic
1084545892 11:69814955-69814977 AGTGTCCTGGAAGCTGTGTCTGG - Intronic
1084964577 11:72737974-72737996 AATGTCATGGAAGCTGTGTGAGG + Intronic
1089609278 11:119660517-119660539 AGTGTCACGCCTGCCGTGTTAGG - Intronic
1090240131 11:125176007-125176029 AGCGTGATGACAGCCATGTTTGG + Intronic
1090982766 11:131737991-131738013 AGTGTAATTACAGCCGTGCTGGG - Intronic
1094332490 12:29310192-29310214 CATGTAATGAAAGCCGTTTTGGG - Intronic
1096470307 12:51871471-51871493 ATGCTCATGAAAGCCGTGTAGGG + Intergenic
1096611669 12:52806035-52806057 AGGTTCCTGAAAGCCTTGTTGGG + Intergenic
1099123400 12:78721028-78721050 ATTGTCATGAAGGCATTGTTAGG + Intergenic
1100876653 12:98968887-98968909 TATTTCATGAAAGCAGTGTTTGG + Intronic
1102848749 12:116217634-116217656 AGTGTGATAAAAGCTGTGATGGG - Intronic
1109639612 13:65172855-65172877 AGTAGCATGAAAGCAGTCTTAGG + Intergenic
1111431188 13:88150062-88150084 AATGTCATGAAAGTGGTGTCTGG - Intergenic
1114033826 14:18601819-18601841 CTTGTCCTGAAAGCTGTGTTGGG + Exonic
1114078618 14:19180993-19181015 ATTGTCCTGAAAGTTGTGTTGGG + Intergenic
1114124821 14:19713192-19713214 CTTGTCCTGAAAGCTGTGTTGGG - Intergenic
1114439627 14:22735823-22735845 AGGGTCATGAAAGACTTGTGGGG - Intergenic
1115919963 14:38361642-38361664 AGTCTCATAAATGCTGTGTTAGG + Intergenic
1117165963 14:53033886-53033908 AGAATCATGAAATCTGTGTTAGG - Intergenic
1118973725 14:70659443-70659465 CGTGTCATGTCAGCCCTGTTAGG + Intronic
1119163702 14:72474941-72474963 AGGGCCATGAATGCTGTGTTAGG + Intronic
1119382160 14:74236189-74236211 AGTGTCATGAAGGCCGGGCCTGG - Intergenic
1119464483 14:74844449-74844471 TGTGTCATTAAAGCTTTGTTGGG + Intronic
1119621360 14:76134279-76134301 AAGGTAATGAAAGCCGGGTTGGG - Intergenic
1121569932 14:94939925-94939947 ATTGTTATTAAAGCAGTGTTGGG + Intergenic
1123568282 15:21574481-21574503 CTTGTCCTGAAAGCTGTGTTGGG - Intergenic
1123604390 15:22009803-22009825 CTTGTCCTGAAAGCTGTGTTGGG - Intergenic
1127176253 15:56361350-56361372 AATGTTATGAAAGCAGTGCTTGG - Intronic
1127332457 15:57952237-57952259 AGTGTAATGGAAGCAGTGGTTGG - Intergenic
1130120832 15:81046225-81046247 AGTGTCATGGAAGCTGTATGAGG - Intronic
1202976639 15_KI270727v1_random:301569-301591 CTTGTCCTGAAAGCTGTGTTGGG - Intergenic
1134201236 16:12200887-12200909 AGTGTCATGAGAGCATTGTGAGG + Intronic
1134871066 16:17652993-17653015 AGTGTCAAGAGGGCCGGGTTCGG + Intergenic
1143238803 17:5426309-5426331 AGTATCATGAAATCTGTGTGTGG - Intronic
1153255895 18:3170921-3170943 AGTGTAATGAAAGAAGTCTTAGG - Intronic
1155275134 18:24180046-24180068 AGTGTGATGAAAACCATGGTTGG - Intronic
1158830815 18:61276234-61276256 AGTGTCATGAAAGCTGTAAAAGG + Intergenic
1162154906 19:8671120-8671142 AGTGACATCAAAGCTCTGTTTGG - Intergenic
928767296 2:34662444-34662466 AATGTCATGAAAGACATATTTGG + Intergenic
931779478 2:65566949-65566971 AGGGTCCTGAAAGCCGTATATGG + Intergenic
934060029 2:88284499-88284521 AGTCTCACCAAAGCCGGGTTGGG - Intergenic
935360632 2:102243718-102243740 AGTGACATGAAAGCAGGGTCGGG - Intergenic
938210490 2:129462679-129462701 AGTGTCTTGAAACCACTGTTGGG + Intergenic
939562045 2:143743578-143743600 TCTGCCATGAAAGCCATGTTCGG + Intronic
939717872 2:145608059-145608081 AATGTCCTGGAAGCCGTGTGTGG + Intergenic
945613319 2:212033689-212033711 AGTGGCATGGAAGCCATTTTAGG + Intronic
1171981687 20:31633256-31633278 AGTGGCCTGAATGCCGTGTCCGG + Intergenic
1176163964 20:63663295-63663317 GGTGTCCTGGAAGCCGTGTCTGG + Intronic
1179259469 21:39745475-39745497 ACTTTCAAGAAAGTCGTGTTCGG + Exonic
1182889265 22:33803129-33803151 AGGGTCATGAATGCTGTCTTGGG - Intronic
952097717 3:29973808-29973830 AGGGTCATGAAAGAAGTGTGTGG - Intronic
952931657 3:38365506-38365528 AGCGTCATGACTGCCGTGATGGG + Intronic
958016605 3:87945431-87945453 ACTTTCAAGAAAGTCGTGTTTGG + Intergenic
965700238 3:171453267-171453289 AGTGTTATGAAAGAGGTGTGAGG + Intronic
967519421 3:190411955-190411977 AGTGTCTTGAAATCCTTGTGGGG + Exonic
968598174 4:1496006-1496028 AGTGGGATGAGAGCCGTGCTGGG + Intergenic
978782555 4:112571750-112571772 AGTTTCATGAAAAACTTGTTGGG - Intronic
981952009 4:150421832-150421854 AGTGGCCTGAAAGCAGTGCTTGG - Intronic
982269356 4:153570657-153570679 AGTGGTATGGAAGCTGTGTTAGG + Intronic
983163005 4:164440458-164440480 TGTGTCAGGAAAGCAGTGTAGGG + Intergenic
986141344 5:5033454-5033476 AGTGTGATGACAGCCTTGTATGG - Intergenic
987743610 5:21942116-21942138 TGTGTCATGAAAGCAGAGGTTGG + Intronic
991184994 5:63796014-63796036 ACTGTCATGAGAACCGTGTGGGG + Intergenic
994718432 5:103351792-103351814 AGTGACCTGAATGCCATGTTAGG + Intergenic
995657544 5:114443887-114443909 AGTGTCAGGAAAGGTGGGTTGGG + Intronic
995731347 5:115245750-115245772 ACTGTCATGAAAAAAGTGTTTGG + Intronic
997025663 5:130058094-130058116 AGAGTCATGACAGCAGTGGTAGG - Intronic
1004209706 6:13626839-13626861 AGTGTTATGAAAGCAGAGGTGGG + Intronic
1004960996 6:20788320-20788342 AGTTTCATGAGAGCCATGTTAGG - Intronic
1005479142 6:26239113-26239135 AGTGGCATGAAAGCAGTGGTAGG + Intergenic
1007294277 6:40810063-40810085 ATTGTCATGAAAGCCTTGAGAGG - Intergenic
1013130723 6:107230257-107230279 AGTTTCAGGAAAGCCATGTCAGG - Intronic
1014563256 6:122916725-122916747 AGTATCATGAATTCCCTGTTGGG + Intergenic
1018329062 6:162708511-162708533 AGTGTCATGAAAGCCGTGTTAGG - Intronic
1018505869 6:164467652-164467674 AGTTGCATGCAAGCCTTGTTGGG + Intergenic
1023969411 7:44979891-44979913 AGTGTCAGGAATGCAGTGTCTGG - Intergenic
1024111032 7:46146334-46146356 AGTGTCATTAAAGACATGATGGG - Intergenic
1027764059 7:82317035-82317057 AATGTCATCAAAGCCATGTTAGG + Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1028381696 7:90207408-90207430 AGTGTAAGGACAGCTGTGTTTGG - Intronic
1036640970 8:10583502-10583524 AGTGTCAGGAAAGCCCTGTTGGG - Intergenic
1038213346 8:25540003-25540025 ACTGTCATCAAAGCCATGCTTGG - Intergenic
1040038188 8:42891472-42891494 ACTGTCATGAGACCCCTGTTTGG - Intronic
1047997506 8:130350666-130350688 AGGCTCATGAAAGCTGTGATGGG - Intronic
1050008952 9:1165091-1165113 AGAGTCAAGAAAGACATGTTAGG + Intergenic
1058602878 9:106690083-106690105 AGTCTCATGAAAACCCTGTGAGG - Intergenic
1062146576 9:134992695-134992717 AATGTAATGAAAGCCGTGTCTGG - Intergenic
1193241224 X:79171904-79171926 CTTGTCTTGAAAGCCGTCTTCGG - Exonic
1195812735 X:108851894-108851916 AGTGTCTGGAAACCCCTGTTGGG - Intergenic
1198737624 X:139804635-139804657 AGTGTAATGAATGCTTTGTTTGG - Intronic