ID: 1018331887

View in Genome Browser
Species Human (GRCh38)
Location 6:162738085-162738107
Sequence AAGCTGTGGCTCTCTTAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018331887_1018331891 16 Left 1018331887 6:162738085-162738107 CCTCACTAAGAGAGCCACAGCTT 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1018331891 6:162738124-162738146 TTTCATTCCTAGAGGCAAGCAGG 0: 1
1: 0
2: 2
3: 12
4: 175
1018331887_1018331889 8 Left 1018331887 6:162738085-162738107 CCTCACTAAGAGAGCCACAGCTT 0: 1
1: 0
2: 1
3: 21
4: 209
Right 1018331889 6:162738116-162738138 CTCTGTCCTTTCATTCCTAGAGG 0: 1
1: 0
2: 2
3: 27
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018331887 Original CRISPR AAGCTGTGGCTCTCTTAGTG AGG (reversed) Intronic
900123330 1:1058853-1058875 AAGCTGGGGTTCCCTGAGTGGGG + Intergenic
900356786 1:2268800-2268822 CAGCTGGGGCTCTCTGGGTGGGG - Intronic
901917901 1:12514053-12514075 AAGTTGTGGCTCTCTGGCTGAGG + Intergenic
902180534 1:14685040-14685062 TATCTGAGGCTCTCTTAGTTTGG + Intronic
903606689 1:24580097-24580119 AGGCTGTGGCCCTCACAGTGTGG - Intronic
905081956 1:35330613-35330635 AAATTGAGGCTCTCTTAGTAAGG + Intronic
906599964 1:47117342-47117364 AAACTGTGGCTCTATTATTTTGG - Intronic
909600869 1:77459645-77459667 AATCTGTGGTTCTCAAAGTGTGG - Intronic
915594958 1:156891824-156891846 ACTCTGTGGCTCTCTGTGTGAGG + Intergenic
915742258 1:158127840-158127862 AAGATCTGGATCTCTTGGTGGGG - Intergenic
919475295 1:198025390-198025412 AAGCTGTGGTTCTCTGACTTTGG + Intergenic
922575013 1:226655493-226655515 CACCTGTGGCTCTCTTTTTGGGG + Intronic
922695493 1:227728982-227729004 GAGCTGCGGCTCTCTAGGTGGGG + Intronic
922981892 1:229834020-229834042 AGGCTGTGGTTCTCAAAGTGTGG - Intergenic
923812836 1:237339491-237339513 TAGCTGTGGTTATCTTAGGGGGG - Intronic
924665855 1:246070882-246070904 AAGCTATTTATCTCTTAGTGGGG + Intronic
1064187676 10:13177003-13177025 AAGCTGTGGTTCTCATTGAGGGG + Intronic
1067935391 10:50607574-50607596 AAGCTTTGGCTCTAAAAGTGTGG - Intronic
1068671554 10:59728569-59728591 AAGGTGTGGTTCTCTTAATTAGG - Intronic
1069153769 10:64999379-64999401 ATGCTGTGACTCTCTTAATGAGG - Intergenic
1069330862 10:67291277-67291299 CAGCTGTGTCACTATTAGTGGGG - Intronic
1069514350 10:69065761-69065783 AAGCTGTGGGTCTCTTTCTGGGG + Intergenic
1071282472 10:84115078-84115100 AGGATGTGGCTCTTTTAGTTGGG + Intergenic
1071344394 10:84678559-84678581 ATGCTGTGGCTCTAGCAGTGAGG - Intergenic
1072873485 10:99146449-99146471 AAACTGAGTTTCTCTTAGTGAGG - Intronic
1073340131 10:102738016-102738038 AAGCTGAGGCCCTCTCAGGGAGG + Exonic
1073694538 10:105849970-105849992 AAGCAGTGGTTCTCCCAGTGTGG + Intergenic
1074375865 10:112940390-112940412 GAGCAGTGGTTCTCTAAGTGAGG + Intergenic
1075292977 10:121246141-121246163 AGCCTGTGGCTCTCTTGGTAGGG - Intergenic
1075399132 10:122149120-122149142 CAGCTGTGGCTGCCTTGGTGAGG - Intronic
1075960043 10:126560578-126560600 GTGCTGGGGCTCTCTTAGTAGGG - Intronic
1077486832 11:2842632-2842654 AACCTGTGGCTGTATGAGTGTGG - Intronic
1077552247 11:3205866-3205888 ACCCTGTGGCTCTCTGAGGGTGG - Intergenic
1078155374 11:8795372-8795394 AAGCAGTGGTTCTCAAAGTGGGG + Intronic
1080260830 11:30348101-30348123 AAGGTGTGGCCCTCTTTCTGTGG - Intergenic
1081700802 11:45151453-45151475 AGACTGTGGCTCTGTAAGTGGGG + Intronic
1083780576 11:64915377-64915399 GAGCTGTGGGTCTCTGGGTGAGG - Intronic
1085125215 11:73996958-73996980 ATGCTATGGCTCTTTTCGTGTGG - Intergenic
1085521067 11:77139170-77139192 ACGCTGTGTCTCTCTGGGTGAGG - Intronic
1085808369 11:79657565-79657587 AAGCTTTTCCTCTCTCAGTGGGG + Intergenic
1091549028 12:1523885-1523907 TTACTGTGGCTCTCTTATTGTGG + Intergenic
1091580310 12:1783369-1783391 AAGCTAAGCCTCTCTTAGTGAGG + Intronic
1092403548 12:8198433-8198455 ATGCTCTGGCTCTCTATGTGTGG + Intergenic
1092793447 12:12088799-12088821 CAGCTGTGGCCCCTTTAGTGTGG - Intronic
1094059085 12:26294345-26294367 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1094497226 12:30995894-30995916 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
1098045750 12:66398587-66398609 AAGCTGTGGGTCTCATAGGAAGG - Intronic
1100230124 12:92598956-92598978 AACCTGTGGCTCTCTGTCTGTGG - Intergenic
1100395526 12:94183304-94183326 AAGATGTGGCCATCTCAGTGTGG - Intronic
1100903033 12:99265171-99265193 TAGCAGTGGTTCTCATAGTGTGG + Intronic
1101447556 12:104748284-104748306 AAGCTGTGGTTCTCAAAGTTTGG + Intronic
1101797046 12:107984749-107984771 CAGCAGTGGTTCTCATAGTGAGG + Intergenic
1102166104 12:110808014-110808036 AAGCTGTGGCTCTTTTGGTCTGG - Intergenic
1106403081 13:29448351-29448373 AAGCTGTGACTATCTGAATGTGG + Intronic
1107726380 13:43303896-43303918 GAGCAGTGGCTCTCAAAGTGTGG - Intronic
1110335436 13:74324499-74324521 ATGTAGTGGCTCTCTCAGTGTGG + Intergenic
1110560283 13:76904432-76904454 AAAATGTTACTCTCTTAGTGGGG + Intergenic
1110843624 13:80170031-80170053 TAGCTGTGGGTCTTTTAGTCAGG + Intergenic
1113642754 13:111969892-111969914 AAGCTGAGGCTCTCTCAGGCTGG + Intergenic
1114152047 14:20052611-20052633 ATGCTGTGGCTCTCTCTGAGTGG - Intergenic
1115060930 14:29188570-29188592 GAGCTGTGGTTCTCAAAGTGTGG - Intergenic
1115316196 14:32027450-32027472 AAGCTGTGACTACCATAGTGGGG - Intergenic
1115402671 14:32980272-32980294 AAGAGGTGGCTCTCTTATTTTGG + Intronic
1116859880 14:49985947-49985969 AAACTGTGGTTCTGTTAGTAAGG + Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119087300 14:71750255-71750277 AGGCTGAGCCTCTCTTAATGGGG + Intergenic
1119584503 14:75820302-75820324 AAAATGAGGCTCTCTTAGTCAGG - Intronic
1119678951 14:76577578-76577600 AAGCCCTGGCTCTGTTAGAGAGG + Intergenic
1120345351 14:83282028-83282050 ATGCTGCTGCTCTCTCAGTGTGG - Intergenic
1120463329 14:84825136-84825158 AAGATGTTGCTTTCTTATTGGGG - Intergenic
1120510065 14:85402337-85402359 AAGAAGTGACTTTCTTAGTGGGG + Intergenic
1120871695 14:89343358-89343380 AATCTTTGGCTGTCATAGTGAGG - Intronic
1122480740 14:102045805-102045827 AGCCAGTGGCTCTCATAGTGTGG + Intronic
1122972260 14:105157132-105157154 AAGCTGTGGCTGCCTTATGGAGG - Intronic
1126866392 15:52941703-52941725 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1127282833 15:57506356-57506378 AGACTGTGGCTCTCATGGTGAGG + Intronic
1128800955 15:70496662-70496684 AAGCTGTGGCGCTGTTGGGGAGG - Intergenic
1131296500 15:91153946-91153968 AAGCTGTGTCTCCCTTAGTTGGG - Intronic
1131754337 15:95543826-95543848 AAGCAGTGGCTCTCAAAGTCTGG + Intergenic
1135204433 16:20471055-20471077 AATCTGTGTCTCTGTCAGTGAGG + Exonic
1135213822 16:20547057-20547079 AATCTGTGTCTCTGTCAGTGAGG - Intronic
1136098395 16:27975140-27975162 AAGGAGTGGCTCTCAAAGTGTGG - Intronic
1136291303 16:29273211-29273233 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1142097170 16:88246677-88246699 AAGCGGTGGTTCTCAAAGTGTGG - Intergenic
1142423424 16:89987449-89987471 AACCTGTGGCTGGCTTGGTGGGG - Intergenic
1143269503 17:5665423-5665445 ACGCTCTGGCTCTGTCAGTGTGG + Intergenic
1144040691 17:11408273-11408295 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1144814536 17:18024840-18024862 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1144854385 17:18260050-18260072 CAGCTGTGGCTCATTTATTGGGG - Intergenic
1147126857 17:38376281-38376303 AAGCTGTGCCAGTCTGAGTGTGG - Intronic
1149191900 17:54072907-54072929 AAGCTGTGGTTCTCTCAGCATGG - Intergenic
1153554141 18:6293265-6293287 GAGCTGTGGCTCTTTTTATGTGG - Intronic
1153909171 18:9691459-9691481 GAGCTGTGGTTGTATTAGTGTGG + Intergenic
1156715821 18:40009127-40009149 AATCAGTGACTCTCTTAGAGTGG + Intergenic
1157558904 18:48632473-48632495 AAGCAGTGGATCTCAGAGTGTGG - Intronic
1157574160 18:48732544-48732566 AAGCTGTGGCTCCCATAGAAGGG - Intronic
1158842746 18:61405666-61405688 AAGCAGTGGTTCTCAAAGTGTGG + Intronic
1158902007 18:61972768-61972790 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1161378248 19:3950903-3950925 CAGCTGTGGCTCCCTCAGTGGGG - Intergenic
1166110773 19:40621699-40621721 AAGCTGTGGATGTCTGGGTGGGG + Intronic
1166357389 19:42235235-42235257 AAGCAGTGGTTCTCAGAGTGTGG - Intronic
1168297218 19:55383437-55383459 AAGCTGGGGCTCTCCCCGTGCGG + Intronic
925418235 2:3688645-3688667 AGGCTGAGGCTCACTTAGAGGGG - Intronic
926703322 2:15818645-15818667 ATGCTGTGGCTGCCTTTGTGGGG + Intergenic
929290270 2:40182728-40182750 AAGATGTGGCTTTATTAATGAGG + Intronic
929599059 2:43193710-43193732 AGGCTGTGTCTCCCTAAGTGGGG - Intergenic
929939542 2:46322592-46322614 AAGCAGTGGTTCTCATAGTGTGG - Intronic
931710382 2:64985097-64985119 CATCTGTTGCTCTCTCAGTGTGG - Intergenic
931975737 2:67642258-67642280 AAGCTGTGACTTTCTCTGTGTGG + Intergenic
933909696 2:86929176-86929198 AAGCTGTGCCTCACTTATTTAGG + Intronic
934023031 2:87974203-87974225 AAGCTGTGCCTCACTTATTTAGG - Intergenic
935859417 2:107311864-107311886 AAGCAGTAACTCTCATAGTGTGG - Intergenic
936962619 2:118091868-118091890 AATCAGTGGCTCTCATTGTGGGG + Intronic
937228303 2:120382400-120382422 ATGCTGTGGCCCTCCAAGTGTGG + Intergenic
938245079 2:129769958-129769980 AAGCTGTGCCACTGTTTGTGAGG - Intergenic
938292529 2:130157656-130157678 CAGATGTGTCTGTCTTAGTGAGG - Intronic
938464023 2:131515313-131515335 CAGATGTGTCTGTCTTAGTGAGG + Intergenic
938877132 2:135543906-135543928 AACATGTGGTTCTCTAAGTGTGG - Intronic
939107276 2:137963658-137963680 AAGCTTTGGCTCTTCTGGTGGGG + Intergenic
941432189 2:165426479-165426501 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
941433546 2:165440038-165440060 AATCTGTGGCTCTCAAAATGTGG + Intergenic
941477785 2:165969902-165969924 AAGCAGTGGCTTTCAAAGTGTGG - Intergenic
942742263 2:179194408-179194430 AAGCTTTGGCTCTTTCAGTAGGG + Intronic
944185360 2:196942135-196942157 GAGCTATGGTTCTCATAGTGTGG - Intergenic
944897172 2:204177241-204177263 AAGATGTGGGTCTCTGATTGGGG - Intergenic
945908016 2:215615793-215615815 AAACTATAGCTCTCTTATTGAGG - Intergenic
947373743 2:229474630-229474652 AGGCTGTGGCTCTATGAGTCTGG - Intronic
1168971597 20:1935030-1935052 AGGCTGCAGCTCCCTTAGTGTGG + Intronic
1169677167 20:8167018-8167040 AAGACCTGGCTCTCTTAATGGGG + Intronic
1169742488 20:8910043-8910065 AAAGTGTGGCTCTATGAGTGAGG - Intronic
1171052528 20:21873390-21873412 GAGCTGTTGCTCTTCTAGTGAGG - Intergenic
1171164046 20:22955245-22955267 GAGCTGTGGCTTTCAAAGTGTGG + Intergenic
1172861753 20:38059753-38059775 AACCTGTGGCTCTCTAAATAAGG + Intronic
1173033226 20:39381531-39381553 AAGCAGTGGTTCTCTAAGTGTGG - Intergenic
1173299715 20:41791244-41791266 AAGCAGTGGTTCTCAAAGTGAGG + Intergenic
1175578033 20:60077450-60077472 GAGCAGTGGTTCTCTGAGTGTGG - Intergenic
1176387053 21:6143369-6143391 AAGCTCTGGCTCTCTTGCTCCGG - Intergenic
1177812638 21:25940968-25940990 GAGCTGTGGTTCTCCAAGTGTGG - Intronic
1179016519 21:37598380-37598402 AAGCTGTGGGCATCTTAGTGAGG + Intergenic
1179736420 21:43394883-43394905 AAGCTCTGGCTCTCTTGCTCCGG + Intergenic
1180132390 21:45835068-45835090 AACCTGTGGCTCTGTGAGTGGGG - Intronic
1180611208 22:17099399-17099421 AAGCAGTGGGTCTCAAAGTGTGG + Intronic
1183097067 22:35558782-35558804 ATGCTCTGCCTCTCTTACTGAGG - Intergenic
1183489673 22:38109682-38109704 AGGCTGTGGCTGGATTAGTGTGG + Intronic
1183573619 22:38672803-38672825 AAGCTGTAGCTCCCATAATGGGG - Intronic
1184466216 22:44669934-44669956 AAGCTGGGGCTCTCCAAGTGAGG + Intronic
950090974 3:10294221-10294243 AAGCTCTGCCTCTCTCACTGGGG + Intronic
950141315 3:10617944-10617966 CAGCTGTGGCTATTCTAGTGGGG - Intronic
952164130 3:30727882-30727904 AAGCAGTGGTTCTCAAAGTGTGG - Exonic
952529558 3:34249252-34249274 AAGTAGTGGCTCTCAAAGTGTGG + Intergenic
954100382 3:48367873-48367895 CAGCTGTGCCTCTCTTTGGGTGG - Intergenic
954386267 3:50245751-50245773 AAGGTGTGTCTCCCTCAGTGGGG - Intronic
956363985 3:68480027-68480049 AAGCATTGGCTCTCAAAGTGTGG + Intronic
959525850 3:107375647-107375669 AGGCAGTGGCTCTCAAAGTGTGG + Intergenic
961199370 3:125032247-125032269 AAGCAGTGGCTCACTTATTTGGG + Intronic
961960121 3:130845852-130845874 AACCAGTGGCTCTCAAAGTGAGG + Intergenic
961992357 3:131205518-131205540 CAGCTGTGTCTCTTTTTGTGGGG + Intronic
962229693 3:133651700-133651722 AAGCAGTGGCTCTAATGGTGAGG + Intronic
963567687 3:146949820-146949842 AATCTGTGGATCTCTTTGGGTGG + Intergenic
966359140 3:179115411-179115433 AATCTGTGGTTCTCAGAGTGTGG + Intergenic
966389704 3:179439000-179439022 AATCTGTGGTTCTCAGAGTGTGG + Intronic
967005642 3:185379825-185379847 AGGCTGTGGTTCTCAAAGTGTGG + Intronic
967620809 3:191631110-191631132 ATGCTGTGGCTCTTTCAGAGAGG + Intergenic
968784250 4:2607773-2607795 GAGCTGTGGTTCTCAAAGTGTGG - Intronic
969762516 4:9199359-9199381 ATGCTCTGGCTCTCTATGTGTGG - Intergenic
972178737 4:36439609-36439631 GAGCAGTGGCTCTCTCAGCGTGG - Intergenic
976195544 4:82528422-82528444 GAGCTGTGGTTCTCAAAGTGTGG - Intronic
981815228 4:148823475-148823497 AAGCTGTGGGGCTCACAGTGGGG - Intergenic
982307653 4:153950329-153950351 AAGCTGTGGTTCTATTGTTGAGG - Intergenic
982467628 4:155749898-155749920 AAGCTGTGGCTATCTGTGAGAGG + Intergenic
983534873 4:168846746-168846768 AAGCTGAGGCTCTCAAAGTGTGG + Intronic
984375550 4:178924250-178924272 GAGCCGTGGCTCTCAGAGTGGGG + Intergenic
986275115 5:6267609-6267631 AAGCTGGGGCTTTCTGAGAGAGG - Intergenic
989817788 5:45757233-45757255 AAGCTGTGACTCTCTGTATGCGG + Intergenic
995748125 5:115425246-115425268 CAGCTGTAGCTCCTTTAGTGAGG - Intergenic
997850181 5:137325416-137325438 AAGATCTGGCTCTCTTGATGAGG - Intronic
1001077031 5:168637657-168637679 AAGCTGGGGCTCTCTGAAGGAGG - Intergenic
1001228257 5:169963955-169963977 AAGCAGTGGTTCTCTCTGTGTGG - Intronic
1001230880 5:169987138-169987160 AGGCAGATGCTCTCTTAGTGGGG + Intronic
1006318435 6:33304686-33304708 AAACTGAGGGTCTCTTAGGGAGG - Intronic
1010715264 6:79221705-79221727 AGTCTGTGGCTTTGTTAGTGTGG + Intronic
1013947009 6:115733436-115733458 AAGCTTTGCTTCTCATAGTGTGG - Intergenic
1015876481 6:137827939-137827961 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1016363604 6:143292873-143292895 AAGCTGAGGCTCTCTTAGGATGG - Intronic
1016452955 6:144202448-144202470 AGCCTGTGGCTCTCAAAGTGTGG - Intergenic
1016520368 6:144940062-144940084 ATGCTGTGGCACTCTTAGTCTGG - Intergenic
1018269283 6:162058442-162058464 AAGCTCTGGCTCTCATACTGTGG + Intronic
1018331887 6:162738085-162738107 AAGCTGTGGCTCTCTTAGTGAGG - Intronic
1020043638 7:5023270-5023292 AAGGTGTGGTTCTCTTAATTAGG - Intronic
1020420354 7:7996879-7996901 AAACTGAAGCTCTCTCAGTGTGG - Intronic
1022423981 7:30250138-30250160 ATGATGTGGCTTTGTTAGTGAGG - Intergenic
1022970762 7:35514622-35514644 AAGCAGTGGTTCTCAAAGTGTGG + Intergenic
1027339819 7:77194393-77194415 AAGCTGTGTCTCTATTAGGTGGG - Exonic
1029344509 7:99968662-99968684 AGGCTGTAGCTCTCTTAAGGAGG - Intronic
1029405335 7:100371555-100371577 AAGCAGTGGTTCTCATAATGCGG + Intronic
1030225595 7:107146817-107146839 AAGTTGTGGCTCCCAGAGTGTGG + Intronic
1030257860 7:107530880-107530902 TAGCTGTGTATCTCTGAGTGTGG - Intronic
1032506362 7:132437613-132437635 AAGCTAAGGATCTCTTGGTGCGG - Intronic
1035296654 7:157871189-157871211 AAGCTGTGGTTCTCAAAGTGGGG + Intronic
1037962836 8:23111780-23111802 AAGCTGTGCCTCTGTTGCTGTGG - Exonic
1039431412 8:37528064-37528086 AAGCTTTGGCTGTGGTAGTGTGG + Intergenic
1039823896 8:41156948-41156970 AAGCAGTGTCTCTCTGAGTTGGG - Intergenic
1040531709 8:48271527-48271549 AAGCGGTGGCTCTGCTAGAGTGG + Intergenic
1040585857 8:48740282-48740304 AGGCTGTGTCTCTCTTACTGTGG + Intergenic
1041960218 8:63606193-63606215 TGGCTGTGGCTCATTTAGTGTGG - Intergenic
1043865274 8:85367704-85367726 AAGCAGTGGCTCTCTAAGTGTGG - Intronic
1044292707 8:90491534-90491556 GAGCTGTGGTTCTCCTAGCGTGG - Intergenic
1045258608 8:100551374-100551396 AGGCTGGGGCTCACTTAATGGGG - Intronic
1047528262 8:125652333-125652355 TCCTTGTGGCTCTCTTAGTGAGG - Intergenic
1048482699 8:134814758-134814780 AAACAGTTGCTCCCTTAGTGTGG - Intergenic
1048859466 8:138713289-138713311 AAGCTTTGGTTCTGTGAGTGTGG + Intronic
1048977077 8:139679107-139679129 AAACTGGGGTTCTCTTAGTGAGG - Intronic
1050118264 9:2282591-2282613 ACGCAGTGGTTCTCATAGTGTGG + Intergenic
1053257705 9:36632222-36632244 AATCTGTGGTTCTCAAAGTGTGG - Intronic
1055400474 9:75918456-75918478 AATCAGTGGCTCTCAAAGTGTGG - Intronic
1055480098 9:76701215-76701237 AAACTGTGGTTCTCTAAGTGGGG - Intronic
1056047431 9:82733560-82733582 AAGCTGGGGCTCTGTTTCTGTGG - Intergenic
1061952336 9:133943506-133943528 AAGCAGTGGCTGCCTTTGTGGGG - Intronic
1062195165 9:135269010-135269032 AGGCACAGGCTCTCTTAGTGAGG - Intergenic
1185503668 X:617400-617422 AAGCTGTGACTGTCTTACTGTGG - Intergenic
1186010476 X:5125973-5125995 AAGGTCTGGCTCTGTTACTGAGG + Intergenic
1186622304 X:11254201-11254223 AAGCTGTGTCTATCTCAGTTTGG - Intronic
1187147737 X:16653333-16653355 AAGCAGTGGTTCTCCAAGTGTGG + Intronic
1187767193 X:22655313-22655335 AGGCTGTGGTTCTCTCAATGTGG - Intergenic
1187966208 X:24614906-24614928 ATGCTGTGGTTCTCAAAGTGTGG + Intronic
1189214155 X:39308998-39309020 AAGCTTTGTCTCTCTTAGATGGG - Intergenic
1190450971 X:50580367-50580389 AAGCAGTGGTTCTCAAAGTGTGG - Intergenic
1190549913 X:51569081-51569103 ATGCTTTTGCTATCTTAGTGGGG + Intergenic
1195828097 X:109024831-109024853 GAGCACTGGTTCTCTTAGTGTGG - Intergenic
1199265873 X:145824665-145824687 CAGCTCAGGCTCTCTTGGTGTGG - Exonic
1199920747 X:152400540-152400562 AAATAGTGGCTCTCTTAGTGTGG + Intronic
1201669321 Y:16499736-16499758 AAGGTGTGGCTCTCTCACTTAGG - Intergenic