ID: 1018334791

View in Genome Browser
Species Human (GRCh38)
Location 6:162775135-162775157
Sequence CTGGGTCCCCACATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3220
Summary {0: 1, 1: 18, 2: 330, 3: 880, 4: 1991}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018334791_1018334797 9 Left 1018334791 6:162775135-162775157 CCTTCCACCATGTGGGGACCCAG 0: 1
1: 18
2: 330
3: 880
4: 1991
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018334791 Original CRISPR CTGGGTCCCCACATGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr