ID: 1018334791 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:162775135-162775157 |
| Sequence | CTGGGTCCCCACATGGTGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3220 | |||
| Summary | {0: 1, 1: 18, 2: 330, 3: 880, 4: 1991} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018334791_1018334797 | 9 | Left | 1018334791 | 6:162775135-162775157 | CCTTCCACCATGTGGGGACCCAG | 0: 1 1: 18 2: 330 3: 880 4: 1991 |
||
| Right | 1018334797 | 6:162775167-162775189 | ATAACATATGAACCAGAAAGTGG | 0: 1 1: 0 2: 2 3: 36 4: 315 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018334791 | Original CRISPR | CTGGGTCCCCACATGGTGGA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||