ID: 1018334797

View in Genome Browser
Species Human (GRCh38)
Location 6:162775167-162775189
Sequence ATAACATATGAACCAGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 315}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018334795_1018334797 -9 Left 1018334795 6:162775153-162775175 CCCAGTGAGAAGGTATAACATAT 0: 1
1: 0
2: 3
3: 10
4: 145
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334783_1018334797 29 Left 1018334783 6:162775115-162775137 CCCCAGAGAATTTGTTCTCCCCT 0: 1
1: 0
2: 1
3: 27
4: 274
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334784_1018334797 28 Left 1018334784 6:162775116-162775138 CCCAGAGAATTTGTTCTCCCCTT 0: 1
1: 0
2: 4
3: 25
4: 303
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334785_1018334797 27 Left 1018334785 6:162775117-162775139 CCAGAGAATTTGTTCTCCCCTTC 0: 1
1: 0
2: 3
3: 29
4: 234
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334796_1018334797 -10 Left 1018334796 6:162775154-162775176 CCAGTGAGAAGGTATAACATATG 0: 1
1: 0
2: 2
3: 14
4: 142
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334789_1018334797 11 Left 1018334789 6:162775133-162775155 CCCCTTCCACCATGTGGGGACCC 0: 1
1: 11
2: 193
3: 560
4: 1185
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334791_1018334797 9 Left 1018334791 6:162775135-162775157 CCTTCCACCATGTGGGGACCCAG 0: 1
1: 18
2: 330
3: 880
4: 1991
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334790_1018334797 10 Left 1018334790 6:162775134-162775156 CCCTTCCACCATGTGGGGACCCA 0: 1
1: 17
2: 277
3: 806
4: 1529
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334792_1018334797 5 Left 1018334792 6:162775139-162775161 CCACCATGTGGGGACCCAGTGAG 0: 1
1: 7
2: 115
3: 383
4: 1013
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315
1018334793_1018334797 2 Left 1018334793 6:162775142-162775164 CCATGTGGGGACCCAGTGAGAAG 0: 1
1: 15
2: 360
3: 1179
4: 2632
Right 1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG 0: 1
1: 0
2: 2
3: 36
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018334797 Original CRISPR ATAACATATGAACCAGAAAG TGG Intronic
901266111 1:7912121-7912143 AAGAAATATGAACCTGAAAGAGG + Intergenic
901733496 1:11297340-11297362 ACTATCTATGAACCAGAAAGTGG + Intergenic
906027318 1:42684033-42684055 ATAATATATTTACAAGAAAGTGG + Intronic
908059528 1:60332627-60332649 AAAACATATAAACCAAAAAAAGG - Intergenic
908959792 1:69682630-69682652 ACCATCTATGAACCAGAAAGCGG + Intronic
909681977 1:78301707-78301729 AAAACATATGAAAAAAAAAGTGG - Intergenic
909858983 1:80579700-80579722 ATTACATATGAAAGAGACAGAGG + Intergenic
909998591 1:82313439-82313461 AAAACATATTAACCAAAATGTGG - Intergenic
911727792 1:101260342-101260364 AAAAAATATGAACAAGAAAAGGG - Intergenic
912186504 1:107282910-107282932 ATCATCTATGAACCAGAATGTGG - Intronic
912661097 1:111531315-111531337 ATACCAAATGAAACATAAAGAGG - Intronic
915256973 1:154640826-154640848 ATAAAGTCAGAACCAGAAAGGGG + Intergenic
916628552 1:166586785-166586807 CTAAGATATGTAACAGAAAGAGG + Intergenic
917964829 1:180171921-180171943 ATAACATCTGTACCAGAGAGAGG + Intronic
919283702 1:195525932-195525954 TTAACATATTAACAAGAAAAGGG + Intergenic
919527498 1:198672225-198672247 ATCAAATATGAACCAGAGACAGG - Intronic
920831364 1:209468765-209468787 GCTACATATGAACCAGAAAATGG - Intergenic
922998527 1:229985926-229985948 AGAGCATATGAAGCAGTAAGTGG - Intergenic
923517330 1:234708762-234708784 ACCACCTATGAACCAGGAAGTGG + Intergenic
923948042 1:238912724-238912746 GTTATCTATGAACCAGAAAGGGG - Intergenic
924152912 1:241146840-241146862 ATCATCTATGAATCAGAAAGTGG - Intronic
924417901 1:243877884-243877906 ATATAATAGGAACCAAAAAGAGG - Intergenic
1067375280 10:45722141-45722163 ATAACATCTGGACAAGAAAGTGG + Intergenic
1067378451 10:45750370-45750392 ATAACATCTGGACAAGAAAGTGG - Intronic
1067883089 10:50063761-50063783 ATAACATCTGGACAAGAAAGTGG + Intergenic
1067886148 10:50091050-50091072 ATAACATCTGGACAAGAAAGTGG - Intronic
1069281453 10:66659744-66659766 ATTATCTATGAACCAGAAAGTGG + Intronic
1069747547 10:70725527-70725549 ACCATCTATGAACCAGAAAGTGG - Intronic
1070296767 10:75168516-75168538 GTAACAGATCAACCAAAAAGGGG - Intronic
1074743035 10:116502933-116502955 AAAACATATTAACAAGAAAATGG + Intergenic
1076051986 10:127342402-127342424 GTAACACATGAAGCAGAATGGGG - Intronic
1078697114 11:13645543-13645565 ATAAAATTTGAACAATAAAGAGG - Intergenic
1078924529 11:15861997-15862019 AGATGTTATGAACCAGAAAGGGG + Intergenic
1078971493 11:16417545-16417567 ATAGGATAAGAACCAGAATGCGG + Intronic
1079228921 11:18632672-18632694 ATAACAGAAGAATCAAAAAGGGG - Intronic
1080991289 11:37538783-37538805 GTTTCATATGAACCAGAAAAGGG - Intergenic
1082592626 11:55032002-55032024 TTAAAATATAAACTAGAAAGAGG - Intergenic
1082695032 11:56353065-56353087 ATAAAACATGAATAAGAAAGAGG - Intergenic
1082732731 11:56819997-56820019 ATAATATTTGAACCACAAAAGGG + Intergenic
1082853227 11:57783816-57783838 ATAACATTCAAGCCAGAAAGGGG - Intronic
1085822669 11:79809829-79809851 ATAAAGTATGAAGCAGAAAGAGG + Intergenic
1086192351 11:84094590-84094612 ATTATCTATGAACCAGGAAGAGG - Intronic
1087189485 11:95237849-95237871 TTAACATATGAAGAGGAAAGTGG - Intergenic
1087867255 11:103246077-103246099 ATAACATATCAACCAGTACTAGG - Intronic
1087966747 11:104424070-104424092 ATCATCTATGAACTAGAAAGTGG + Intergenic
1089355673 11:117850992-117851014 ATAGCATATGTATCAGGAAGGGG - Intronic
1089420528 11:118330062-118330084 AGAAGATATGAACCAGGAAGTGG - Intergenic
1089763279 11:120744383-120744405 ATAACATATGAACAGCAAAAAGG - Intronic
1089934945 11:122354819-122354841 ATAACGTGTGATCCAGACAGAGG - Intergenic
1090685066 11:129107451-129107473 ATAACATAGAAAGCAAAAAGTGG - Intronic
1091472989 12:746203-746225 ATAATATATGAAGAAGTAAGCGG - Intergenic
1091521582 12:1249820-1249842 GCTACCTATGAACCAGAAAGTGG - Intronic
1093942981 12:25075032-25075054 ATTATAAATGAACCTGAAAGTGG + Intronic
1095214986 12:39537916-39537938 ATTACAGATGAATCAGAATGAGG + Intergenic
1095455573 12:42381656-42381678 AGAACATATGAATTAGAAAATGG - Intronic
1095763573 12:45868778-45868800 ATAACAAGTGATCCAGAAATAGG - Intronic
1096006076 12:48173213-48173235 ATAGCAAATGTGCCAGAAAGTGG + Intronic
1096265650 12:50120482-50120504 ATAGCATATGGACCACAAAAGGG + Intergenic
1096349048 12:50878985-50879007 ACAACTTATGAACCAGAAAATGG + Intronic
1097467626 12:59947621-59947643 ATAACATATGAAACAGTATGGGG - Intergenic
1097703095 12:62840209-62840231 ATCATCTATGAACCAGAAAGGGG - Intronic
1098048174 12:66424000-66424022 ATAAAATATGAATGGGAAAGAGG - Intronic
1098100793 12:67014595-67014617 ATAACAAATGTAACACAAAGGGG + Intergenic
1099543361 12:83943894-83943916 ACAACATATGAACCTGGAAGTGG - Intergenic
1100134054 12:91533186-91533208 GTGAACTATGAACCAGAAAGTGG + Intergenic
1100335124 12:93621880-93621902 TTAACATATGAACACCAAAGTGG + Intergenic
1100924269 12:99526235-99526257 ATGACAAATTAGCCAGAAAGAGG - Intronic
1102759625 12:115374355-115374377 ATAACCTTGGCACCAGAAAGGGG + Intergenic
1105929320 13:25037404-25037426 ATCACCTGTGAACCAGAAGGTGG - Intergenic
1106788901 13:33134674-33134696 ATACCATATAAACCCTAAAGTGG + Intronic
1108058523 13:46509330-46509352 GTAACACTTGAATCAGAAAGAGG - Intergenic
1108475261 13:50810046-50810068 TTAAAATATGAAGCAGAAAATGG - Intronic
1109234579 13:59799227-59799249 ATGCCAACTGAACCAGAAAGAGG + Intronic
1109517850 13:63467531-63467553 ACCATGTATGAACCAGAAAGTGG - Intergenic
1109872976 13:68360926-68360948 ATAATATATGACACAGAAATAGG - Intergenic
1110858780 13:80325287-80325309 AAAACATATGTACCACAAATTGG + Intergenic
1111931633 13:94518694-94518716 ATAACAAATGAACCAACAGGAGG - Intergenic
1112036757 13:95504163-95504185 ATGACAATTGAACCAGAAAGAGG + Intronic
1112252576 13:97796430-97796452 AGAAAATATGAACCAGAATGAGG - Intergenic
1112544260 13:100349561-100349583 ATAAAGTAGAAACCAGAAAGTGG - Intronic
1112947690 13:104951530-104951552 ATACCAAATGAACCAAAAAGAGG - Intergenic
1114262644 14:21049290-21049312 ATGAAAAATGAACCAGAAAATGG - Intronic
1114861944 14:26534457-26534479 ATAAAATATGAAATAGAAACAGG + Intronic
1114926406 14:27405403-27405425 GAAACATATAGACCAGAAAGCGG + Intergenic
1115505274 14:34087725-34087747 ATAACTAATGAACCTGAGAGTGG + Intronic
1115524637 14:34267433-34267455 ATAAGATGTGAACCTGAAATTGG - Intronic
1116140002 14:40981250-40981272 ATAATATAAGAAGAAGAAAGAGG - Intergenic
1116595251 14:46833775-46833797 ATAACACAGGAAGGAGAAAGTGG + Intergenic
1117139267 14:52770051-52770073 ATGACATATGAACCAAGAATAGG - Intronic
1117316351 14:54574760-54574782 ATAACATCTGAAACAGTTAGAGG + Intronic
1117706137 14:58470406-58470428 ATAAAATATGAAAAATAAAGAGG - Intronic
1118284838 14:64461895-64461917 TTAAGAAATGTACCAGAAAGCGG - Intronic
1118425455 14:65655636-65655658 AAAATATATGAAGCAGAAACTGG + Intronic
1118547476 14:66907881-66907903 ATCACATATGTACAAGCAAGGGG + Intronic
1120798854 14:88667283-88667305 ATAAAATATGAAGGAGAAAAAGG - Intronic
1121277899 14:92680125-92680147 ACCATCTATGAACCAGAAAGTGG - Intronic
1124968378 15:34458375-34458397 ATAACAAATGAAACAGCAAAAGG + Intergenic
1125307261 15:38332908-38332930 ATCACTTATGAACCTGAAAGTGG - Intronic
1126923129 15:53549999-53550021 ATAATATAAGCTCCAGAAAGCGG + Intronic
1128486770 15:68099724-68099746 ATACCAGAAGAAACAGAAAGTGG - Intronic
1129162544 15:73754574-73754596 ATAGGAGAAGAACCAGAAAGTGG + Intergenic
1129886989 15:79045365-79045387 GTAACATTTAACCCAGAAAGTGG - Intronic
1130441597 15:83960347-83960369 ATAAAATCTGGACCAGAATGAGG + Intronic
1131355736 15:91744430-91744452 CTGACATAGGAAACAGAAAGAGG - Intergenic
1132072969 15:98796087-98796109 AGCACATATGAACGTGAAAGAGG + Intronic
1133618261 16:7500416-7500438 ATAACAGTTGAAACACAAAGTGG - Intronic
1134285360 16:12856924-12856946 ATAACAAAGGAAACAAAAAGAGG - Intergenic
1136015158 16:27393238-27393260 ATAATATAGGAAACAAAAAGAGG - Intergenic
1138800563 16:60022802-60022824 ACAAGAAATGAACCAGAAATAGG + Intergenic
1138989989 16:62378920-62378942 AAAACATTTTAAGCAGAAAGAGG + Intergenic
1139110389 16:63883481-63883503 AGAAAATATGAACTAGAAATAGG + Intergenic
1143360708 17:6367570-6367592 ATCATCTATGAACCAGAAAATGG + Intergenic
1149216855 17:54366263-54366285 ACCATCTATGAACCAGAAAGTGG + Intergenic
1149289290 17:55200497-55200519 ATAACACAGGAAACAAAAAGGGG - Intergenic
1149344119 17:55717068-55717090 TTCACTTATGAACCAGAGAGTGG + Intergenic
1150416380 17:64991949-64991971 AGAACATGTCAATCAGAAAGGGG - Intergenic
1153177625 18:2396041-2396063 ATTAAATATTAACCAGCAAGGGG - Intergenic
1156589336 18:38468279-38468301 ATAACATATGAAGCACTAACTGG - Intergenic
1156889033 18:42168580-42168602 ATGACATATGTATCTGAAAGGGG - Intergenic
1157118288 18:44883002-44883024 ATAACATATGAAGCAGTGAATGG + Intronic
1157502320 18:48200268-48200290 CTGACATATGAACCTGAAAGGGG - Intronic
1158281434 18:55832663-55832685 AAAATATAGGAACCAGAAAGTGG - Intergenic
1158423634 18:57319361-57319383 ATAAAGGATGAAACAGAAAGAGG - Intergenic
1158998402 18:62947344-62947366 ATCACATATGAACCACATTGAGG - Intronic
1159338473 18:67101904-67101926 ATCAAATATAAAACAGAAAGAGG + Intergenic
1161944120 19:7423999-7424021 ATAACATAAAAACCTCAAAGTGG - Intronic
1161964499 19:7540793-7540815 ATAACGGATGAACCAGAGATTGG - Intronic
1165397361 19:35572235-35572257 GCAACAGATGAATCAGAAAGTGG + Intergenic
1168068245 19:53932596-53932618 GCAACAAATGAACTAGAAAGAGG - Intronic
1168375825 19:55878494-55878516 ATAACATATTATCCAAAAAAAGG - Intronic
928504200 2:31932592-31932614 ATAACAAATGAGCCAGATAATGG - Intronic
929411557 2:41702618-41702640 ATAACATGTGAAGAAGAAGGTGG - Intergenic
930159238 2:48137244-48137266 ATAACATAAGAAAAAGAAATAGG + Intergenic
930620651 2:53639877-53639899 GCAATCTATGAACCAGAAAGTGG + Intronic
933580312 2:84118262-84118284 CTAAAACATGAACCAGAAAGAGG + Intergenic
934471788 2:94550658-94550680 TTCACATAAGAACCAGACAGAGG - Intergenic
934570309 2:95366791-95366813 ATAAAATAAGCACAAGAAAGAGG - Intronic
934784746 2:96996804-96996826 AGAAAATCAGAACCAGAAAGAGG + Intronic
935465837 2:103397141-103397163 ACCACCTATAAACCAGAAAGTGG + Intergenic
935887733 2:107641598-107641620 ATAAAATATTAACCATAAAAAGG - Intergenic
937844181 2:126559888-126559910 ATAATATAGGAACAACAAAGAGG - Intergenic
938828427 2:135030165-135030187 AAAACATATAAAAAAGAAAGGGG - Intronic
939275993 2:139996746-139996768 AGAACTTATGATCCAGAGAGTGG + Intergenic
940361373 2:152799733-152799755 ACAATCTATGAACCAGGAAGAGG + Intergenic
940436309 2:153660043-153660065 ATAATATATGTACCAGGAAGAGG - Intergenic
940978428 2:159973554-159973576 GATACATATGAACCAGGAAGTGG + Intronic
941458888 2:165743642-165743664 CTAACATATGAAAGAGAGAGAGG + Intergenic
941810069 2:169746752-169746774 TTAACATATGAATCAAAAATTGG + Intronic
942156299 2:173132168-173132190 ATGACAGATGAATCAGAAAGGGG - Intronic
943592718 2:189818443-189818465 ACCACCTATGAACCAGAAAGTGG + Intronic
944108844 2:196109410-196109432 AAAATACATGAACCACAAAGAGG + Intergenic
944956462 2:204816933-204816955 AAATCATATGAAACAAAAAGAGG - Intronic
945148294 2:206761907-206761929 TTAAGACATGGACCAGAAAGTGG - Intronic
946125499 2:217558980-217559002 ATAGGGTATGAATCAGAAAGTGG - Intronic
946864511 2:224030990-224031012 AAAACACATGATACAGAAAGAGG - Intronic
948750803 2:240131833-240131855 ATGAATTATGAACTAGAAAGAGG + Intronic
1169153958 20:3313452-3313474 AGAACAAATCATCCAGAAAGGGG + Intronic
1169931026 20:10833172-10833194 AAAACATTTGCACCAGAATGAGG + Intergenic
1169945315 20:10982020-10982042 TCAATAAATGAACCAGAAAGTGG - Intergenic
1169991219 20:11504851-11504873 AATACAAATGAAACAGAAAGGGG + Intergenic
1170333905 20:15247545-15247567 TTAACATGTAAAGCAGAAAGTGG - Intronic
1170669803 20:18421385-18421407 AAAAAATAAGAACCACAAAGTGG + Intronic
1171031307 20:21679256-21679278 ATCATTTATGGACCAGAAAGTGG - Intergenic
1172280692 20:33705726-33705748 ATAGGATATGGGCCAGAAAGGGG - Exonic
1173832298 20:46098866-46098888 ACTACATACGAACCATAAAGGGG - Intergenic
1174346454 20:49933849-49933871 AGAACATATGAAGCAAAAATTGG + Intergenic
1174714889 20:52746981-52747003 ATATCATATGAACCTGGGAGGGG + Intergenic
1175029720 20:55939909-55939931 ACAGTCTATGAACCAGAAAGCGG - Intergenic
1176880512 21:14186819-14186841 ATAATCTATGAACCAGGAATTGG + Intronic
1177711700 21:24784108-24784130 AGAACATATGAACAAGGAAATGG - Intergenic
1177721414 21:24911528-24911550 AAAACTGATGAACCAAAAAGTGG - Intergenic
1178160783 21:29911761-29911783 ACTATCTATGAACCAGAAAGTGG + Intronic
1178409865 21:32354097-32354119 AGAACATCTGAGACAGAAAGAGG + Exonic
1179602797 21:42491736-42491758 ATAAAATAAGAACCAGTAGGTGG - Intronic
1182637063 22:31736577-31736599 AGAACATATGAACCTGATGGTGG + Intronic
949369154 3:3316273-3316295 GTAAAATCTGAACCAGAAAGAGG - Intergenic
949763894 3:7504613-7504635 AGAGCAAAAGAACCAGAAAGAGG + Intronic
950843761 3:15994424-15994446 ATGACATAAGAAACAAAAAGAGG - Intergenic
951051029 3:18093734-18093756 ACCACCTATGAACCACAAAGTGG - Intronic
951629498 3:24703828-24703850 ATTAAATAAGAACCAGAAATAGG - Intergenic
953120040 3:40031164-40031186 ATTATCTATGAACCAGGAAGCGG - Intronic
955541445 3:59980724-59980746 AGCATCTATGAACCAGAAAGTGG + Intronic
956882715 3:73527304-73527326 ATAGGATATGAACCAGTAAATGG + Intronic
958456503 3:94338266-94338288 ATCATCTATGAACCAGAAAGTGG + Intergenic
958543140 3:95506709-95506731 ACAACAGAAGATCCAGAAAGAGG - Intergenic
958690127 3:97454838-97454860 GTAGCACATGAAGCAGAAAGAGG + Intronic
958749826 3:98182178-98182200 ATCACATCTGAACAAAAAAGAGG - Intronic
958891335 3:99786445-99786467 GTCATCTATGAACCAGAAAGTGG + Intronic
958946304 3:100366187-100366209 GTAAGAGATGAAACAGAAAGAGG - Intronic
958960409 3:100504442-100504464 ATAACCTATGCACCACAGAGTGG + Intronic
959123777 3:102265468-102265490 ATCATCTATGAACCAGGAAGTGG + Intronic
960042372 3:113163533-113163555 GTACCATATGAACCAGTAAGTGG + Intergenic
960451349 3:117812686-117812708 AAATCATAGGCACCAGAAAGAGG - Intergenic
963789339 3:149567608-149567630 ATTACACAGGAGCCAGAAAGGGG + Intronic
964167154 3:153722328-153722350 ATAAGATATGAACTTCAAAGAGG - Intergenic
964681645 3:159346420-159346442 AAACCATATGAACCAGAAATGGG - Intronic
967935431 3:194723843-194723865 ATGAGATTTGAACTAGAAAGTGG - Intergenic
969331813 4:6477958-6477980 GAAACATCTGAACCAGGAAGGGG - Intronic
969382881 4:6817818-6817840 AAAACATATGAAACAAAAATTGG - Intronic
969950404 4:10829774-10829796 ACCATTTATGAACCAGAAAGTGG + Intergenic
970268475 4:14316807-14316829 AGAAAATATGATCCATAAAGAGG - Intergenic
971212796 4:24636066-24636088 ATCATCTATGAACCAGGAAGTGG + Intergenic
971256271 4:25016452-25016474 ATAACATTTGCACCAAAAGGTGG - Intronic
971704795 4:30026456-30026478 ATAAAATGATAACCAGAAAGTGG - Intergenic
972019011 4:34284655-34284677 ATAACATCTAAATCAGAAAAAGG + Intergenic
972600808 4:40570806-40570828 CTAGCATATGAGTCAGAAAGTGG + Intronic
972768651 4:42175004-42175026 ACCATCTATGAACCAGAAAGTGG - Intergenic
973894455 4:55397370-55397392 TTAGCATATGAGCAAGAAAGCGG - Intronic
974754278 4:66183465-66183487 ATCATCTATGAACCAGAAAGTGG - Intergenic
975311258 4:72906137-72906159 AGAACACATGGACCAGGAAGGGG - Intergenic
976415463 4:84769138-84769160 CTTACAGATGAACAAGAAAGTGG + Intronic
976437682 4:85037006-85037028 ATTAAATTTGAACCAGAAATAGG + Intergenic
977335551 4:95693958-95693980 ATAGTCTATGAACCAGAAAGTGG - Intergenic
978658178 4:111091687-111091709 ATAACATATGACTCAAAAAAAGG + Intergenic
978882305 4:113720591-113720613 ATATCAAATTAACCAGAAATGGG + Intronic
979305551 4:119138914-119138936 AAAATATAAGAACCAGAAATGGG + Intronic
979723352 4:123930288-123930310 GCAACAAATGAACAAGAAAGAGG + Intergenic
982419789 4:155181660-155181682 GTCACTTATGCACCAGAAAGTGG + Intergenic
982465160 4:155721464-155721486 ATGACAGAGGAAGCAGAAAGTGG - Intronic
982538828 4:156641560-156641582 ATAATTTATGAACAAGAAAATGG - Intronic
982845771 4:160250323-160250345 ATTACATATTAACCAGAAGAAGG + Intergenic
983514075 4:168638650-168638672 ACCATCTATGAACCAGAAAGTGG - Intronic
983514815 4:168644790-168644812 ATAGCATATGCATCAGAAATAGG + Intronic
983838811 4:172429012-172429034 ACCATCTATGAACCAGAAAGCGG - Intronic
983908331 4:173207647-173207669 TTAAAAAATAAACCAGAAAGGGG - Intronic
986688331 5:10293358-10293380 ACCACATATGAACCAGAAAGTGG - Intronic
987941347 5:24542753-24542775 ATCATCTATAAACCAGAAAGAGG - Intronic
988057877 5:26123938-26123960 ATAACACAACAACCAGAAAAAGG - Intergenic
988833230 5:35007200-35007222 ACCATCTATGAACCAGAAAGTGG + Intronic
989429748 5:41338943-41338965 ATAATAAAAGAACCAGAATGAGG - Intronic
990172270 5:53065784-53065806 ACAACAGCTGAACCAGAAAATGG - Intronic
993217956 5:85049334-85049356 TTAACATATAAACCAGTAGGTGG - Intergenic
995836481 5:116404954-116404976 ATCACATCTGTACCAGAAGGTGG + Intronic
996060830 5:119031471-119031493 ACAAAATAAGAAACAGAAAGTGG + Intergenic
996813824 5:127551359-127551381 GTAAAATTTCAACCAGAAAGAGG - Intronic
998311268 5:141135537-141135559 ATACCAGAAGAAACAGAAAGTGG + Exonic
998703173 5:144729013-144729035 AATACATATGAACCTGAAACTGG - Intergenic
998709985 5:144813192-144813214 ATAAGAAATGAAACATAAAGAGG + Intergenic
998845128 5:146301197-146301219 ATAACAAATAAACCAGGTAGTGG - Intronic
1000034419 5:157433447-157433469 AAAACATATGAAGCAAAAGGTGG + Intronic
1001744251 5:174078780-174078802 ACCATCTATGAACCAGAAAGTGG + Intronic
1004509420 6:16273095-16273117 ATCACAGATGGCCCAGAAAGAGG - Intronic
1004735197 6:18398819-18398841 GTAACATATGATCCAGCAATCGG - Intronic
1005134242 6:22549303-22549325 ATAGCATATAAATCAGAAGGGGG - Intergenic
1006949950 6:37813505-37813527 ACCATCTATGAACCAGAAAGTGG + Intergenic
1007267218 6:40605775-40605797 AAAAAATGTGAACCAGTAAGGGG - Intergenic
1008119449 6:47594901-47594923 ATTTCATATCAACCAGAAACTGG - Intronic
1009466708 6:63979616-63979638 AAAACATATGGCTCAGAAAGGGG + Intronic
1010922550 6:81702276-81702298 ATTAAATAAGAACTAGAAAGTGG + Intronic
1011643519 6:89435865-89435887 CAAACATATCAACCAGGAAGAGG - Intronic
1012023432 6:93956525-93956547 ATAATATATAAATCAGAAATGGG - Intergenic
1012162396 6:95902574-95902596 GTAACATCTGAAGGAGAAAGAGG - Intergenic
1012328506 6:97955298-97955320 ATAAGATAGGAAGAAGAAAGTGG - Intergenic
1012704199 6:102500142-102500164 AAAACAGATGTTCCAGAAAGGGG + Intergenic
1013334622 6:109143017-109143039 CTAACTGATGCACCAGAAAGGGG + Intronic
1013339772 6:109202224-109202246 ACCACATATGAGCCAGAAAGCGG - Intergenic
1013659772 6:112283340-112283362 ATAATATGTGAGACAGAAAGCGG + Intergenic
1013664899 6:112337679-112337701 ATAAAATATGAAGCACAAGGAGG - Intergenic
1014097180 6:117473168-117473190 ATACCATTTTTACCAGAAAGGGG + Intronic
1014642914 6:123935493-123935515 ATAACATTTGAAGCTGGAAGAGG - Intronic
1014844648 6:126260193-126260215 ATAGCAAATAAACAAGAAAGAGG - Intergenic
1015776364 6:136818825-136818847 AACATCTATGAACCAGAAAGTGG - Intergenic
1016384839 6:143520442-143520464 GCAATCTATGAACCAGAAAGTGG + Intergenic
1016388654 6:143553406-143553428 ATATCATACAAACCAGGAAGAGG + Intronic
1016553090 6:145304424-145304446 ACTATCTATGAACCAGAAAGTGG - Intergenic
1017607673 6:156150843-156150865 ATCATCTATGAAGCAGAAAGGGG - Intergenic
1018005478 6:159618074-159618096 AGAACAACTGTACCAGAAAGGGG - Intergenic
1018334797 6:162775167-162775189 ATAACATATGAACCAGAAAGTGG + Intronic
1019628560 7:2034111-2034133 ATAACAAATGAATCAGATATGGG + Intronic
1021625025 7:22584547-22584569 ATAACTTATGATGCAGAAAGAGG - Intronic
1024145267 7:46509046-46509068 AGAACATATTATACAGAAAGTGG - Intergenic
1024357994 7:48437166-48437188 ATAACATATGAAGCAAATACTGG - Intronic
1025172832 7:56776543-56776565 ATAACATAAGAAACAGATAAGGG + Intergenic
1025699279 7:63801618-63801640 ATAACATAAGAAACAGATAAGGG - Intergenic
1026727950 7:72885449-72885471 ATAACACATAAAGCAAAAAGTGG - Intronic
1027115889 7:75480336-75480358 ATAACACATAAAGCAAAAAGTGG + Intronic
1027121132 7:75521702-75521724 ATAACACATAAAGCAAAAAGTGG + Intergenic
1027307661 7:76918311-76918333 ACTATATATGATCCAGAAAGTGG - Intergenic
1027982308 7:85241300-85241322 ATACCATTTGATCCAGATAGTGG + Intergenic
1028445798 7:90922399-90922421 ATAATATATGAACCAAAGAAAGG + Intronic
1028657264 7:93222891-93222913 TTAATATATGAACCAAAAACTGG - Intronic
1029579777 7:101428050-101428072 ATAACACAAGAAAGAGAAAGGGG + Intronic
1029721655 7:102370321-102370343 ATAACACATAAAGCAAAAAGTGG - Intronic
1029816423 7:103100790-103100812 ATAACAAATGAAAAATAAAGTGG + Exonic
1032007057 7:128311029-128311051 AGATCATATCTACCAGAAAGGGG + Intronic
1032446196 7:131985751-131985773 ATTAGACATGAACCAGGAAGAGG - Intergenic
1032452681 7:132046764-132046786 ATAAAATATGAGGCAGAGAGTGG - Intergenic
1032681641 7:134190815-134190837 AGAACATATGAATCCTAAAGGGG - Intronic
1033391575 7:140933466-140933488 ATAGCTGATGAAGCAGAAAGTGG - Intergenic
1033975445 7:147094946-147094968 ATCATCTAAGAACCAGAAAGTGG - Intronic
1034743210 7:153497445-153497467 ACCATCTATGAACCAGAAAGTGG - Intergenic
1034776912 7:153836235-153836257 AAAAGATCTGAGCCAGAAAGAGG - Intergenic
1038599289 8:28923103-28923125 AAAACTTCTGAACCAGACAGTGG - Intronic
1038940886 8:32303568-32303590 AGAACATTTAAAACAGAAAGTGG + Intronic
1039004872 8:33024088-33024110 ATAAAATGTGAAGCAAAAAGTGG - Intergenic
1041737728 8:61129624-61129646 ACCATCTATGAACCAGAAAGTGG - Intronic
1041776630 8:61529787-61529809 ACCATCTATGAACCAGAAAGTGG - Intronic
1041940837 8:63385845-63385867 AGAACATATGTCCCAGAAAAGGG - Intergenic
1042437126 8:68779560-68779582 GTGCCATCTGAACCAGAAAGGGG + Intronic
1043045566 8:75319214-75319236 AAAACATGAGAACCACAAAGAGG + Intergenic
1044162684 8:88939670-88939692 ACAACATATGAACCAGCAGCTGG + Intergenic
1044179747 8:89176545-89176567 GAAACATGTGAAACAGAAAGTGG - Intergenic
1044361244 8:91286847-91286869 ATAATAAATGAATCAGAAAAAGG + Intronic
1044725676 8:95192481-95192503 ACCATCTATGAACCAGAAAGTGG + Intergenic
1044763468 8:95547471-95547493 AGAACACATGGACCAGGAAGGGG + Intergenic
1045913368 8:107436460-107436482 ATAACGTGAGACCCAGAAAGAGG - Intronic
1046749356 8:117910655-117910677 ATAACATATGAAGCAGAGACAGG - Intronic
1047300398 8:123609127-123609149 AGAACATCTGATCCAGAATGGGG - Intergenic
1047833406 8:128660887-128660909 ATAACATATGATCCTGAATTAGG + Intergenic
1048909238 8:139118674-139118696 ATTACATAGGAGCCAGCAAGAGG + Intergenic
1050604691 9:7288461-7288483 ATAATATAGGAATCAGAATGAGG + Intergenic
1051537369 9:18175584-18175606 ATATGATATGAAACAAAAAGTGG - Intergenic
1051589850 9:18766660-18766682 ACCATCTATGAACCAGAAAGAGG - Intronic
1052254076 9:26433077-26433099 ATACCATAAGATCCAGACAGGGG + Intergenic
1052685996 9:31756757-31756779 ATTACATCTGAAGCAGCAAGAGG + Intergenic
1052921430 9:33973571-33973593 ATGAAATGAGAACCAGAAAGAGG + Intronic
1053112522 9:35474822-35474844 ATAACATATGCACCAGAAAAAGG - Intergenic
1055272859 9:74581257-74581279 ATGACATATAAAACAGATAGTGG + Intronic
1055572092 9:77627241-77627263 ATAGCCTATGAACCAAAAAAAGG + Intronic
1056167492 9:83953226-83953248 TTAAAAAATGTACCAGAAAGTGG - Intronic
1057111052 9:92471640-92471662 ATAATATATGAATCAGTATGTGG - Intronic
1057297309 9:93856566-93856588 ATAAAATTTGAACAATAAAGAGG - Intergenic
1058084326 9:100732291-100732313 ATCAGATATGGACCAGCAAGCGG + Intergenic
1058261059 9:102832408-102832430 ATCATCTATGAACCAGAAAGAGG + Intergenic
1058773415 9:108261240-108261262 CTAACACGTGAGCCAGAAAGGGG - Intergenic
1059353657 9:113683621-113683643 AGAACATTTGAACCAGAGATGGG - Intergenic
1060607763 9:124932796-124932818 GTCATGTATGAACCAGAAAGTGG - Intronic
1185729624 X:2450979-2451001 ATCATCTATGAACCAGGAAGTGG + Intronic
1186182624 X:6987742-6987764 ATACCATATGGCCCAAAAAGTGG + Intergenic
1186288665 X:8072584-8072606 AAAATAAATGAACAAGAAAGAGG - Intergenic
1186814284 X:13220747-13220769 ACAATATATGTACGAGAAAGAGG - Intergenic
1187784186 X:22866123-22866145 ATCTCATATCAACCAGAAAGTGG + Intergenic
1188165365 X:26856375-26856397 TTACCATATGAACGATAAAGTGG + Intergenic
1189843277 X:45105366-45105388 AAAAAATAAGAACCAGACAGGGG - Intronic
1192171447 X:68857868-68857890 ACCACCTATGAACCAGGAAGTGG - Intergenic
1192193119 X:69007617-69007639 ATAACACATGAAAAAGAAACAGG - Intergenic
1192589671 X:72349487-72349509 AAAACATATGGACCAGAAATTGG - Intronic
1193507132 X:82358649-82358671 ATAATCTGTGAACCAGGAAGAGG - Intergenic
1194922529 X:99783956-99783978 ATTCCATAAGAACTAGAAAGGGG - Intergenic
1195143155 X:101984573-101984595 ATAAGATAGGAACAAGATAGAGG + Intergenic
1195708221 X:107753427-107753449 ATCACATCTGAAACAGGAAGGGG - Intronic
1196168277 X:112558899-112558921 ATAACCTATCAACGAAAAAGAGG + Intergenic
1196382348 X:115104491-115104513 ATCATCTATTAACCAGAAAGTGG + Intergenic
1197311466 X:124910782-124910804 AGAACATTTGAACAAGAAAGGGG - Intronic
1197313990 X:124941319-124941341 AGAACAAATAATCCAGAAAGAGG - Intronic
1198435321 X:136611414-136611436 ATAACTCATGAAATAGAAAGAGG + Intergenic
1198802964 X:140466433-140466455 AAAACATATTAAGAAGAAAGAGG + Intergenic
1198915843 X:141670749-141670771 ACCATGTATGAACCAGAAAGTGG - Intronic
1199449395 X:147962499-147962521 ATAACATATGAATGAGGGAGAGG + Intergenic
1199655676 X:149993030-149993052 ATAACATCAGAGCCAGAAGGAGG + Intergenic
1200944110 Y:8815235-8815257 AACATATATGAACCAGAAAGTGG - Intergenic
1201533629 Y:15020870-15020892 ATGACATATCAGCCAGTAAGAGG + Intergenic
1201647228 Y:16248322-16248344 AGCACATATAAGCCAGAAAGAGG - Intergenic
1201655583 Y:16336980-16337002 AGCACATATAAGCCAGAAAGAGG + Intergenic