ID: 1018336095

View in Genome Browser
Species Human (GRCh38)
Location 6:162791711-162791733
Sequence ATGGTGAAATTCAAATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 294}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018336095_1018336103 22 Left 1018336095 6:162791711-162791733 CCCATCAATTTGAATTTCACCAT 0: 1
1: 0
2: 1
3: 18
4: 294
Right 1018336103 6:162791756-162791778 AGGAGGATGGGGAATGCAGAAGG No data
1018336095_1018336099 5 Left 1018336095 6:162791711-162791733 CCCATCAATTTGAATTTCACCAT 0: 1
1: 0
2: 1
3: 18
4: 294
Right 1018336099 6:162791739-162791761 ACTTACTGCATTCTAGAAGGAGG No data
1018336095_1018336101 10 Left 1018336095 6:162791711-162791733 CCCATCAATTTGAATTTCACCAT 0: 1
1: 0
2: 1
3: 18
4: 294
Right 1018336101 6:162791744-162791766 CTGCATTCTAGAAGGAGGATGGG No data
1018336095_1018336100 9 Left 1018336095 6:162791711-162791733 CCCATCAATTTGAATTTCACCAT 0: 1
1: 0
2: 1
3: 18
4: 294
Right 1018336100 6:162791743-162791765 ACTGCATTCTAGAAGGAGGATGG No data
1018336095_1018336102 11 Left 1018336095 6:162791711-162791733 CCCATCAATTTGAATTTCACCAT 0: 1
1: 0
2: 1
3: 18
4: 294
Right 1018336102 6:162791745-162791767 TGCATTCTAGAAGGAGGATGGGG 0: 1
1: 0
2: 2
3: 22
4: 292
1018336095_1018336098 2 Left 1018336095 6:162791711-162791733 CCCATCAATTTGAATTTCACCAT 0: 1
1: 0
2: 1
3: 18
4: 294
Right 1018336098 6:162791736-162791758 AGTACTTACTGCATTCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018336095 Original CRISPR ATGGTGAAATTCAAATTGAT GGG (reversed) Intronic
901269849 1:7943234-7943256 ATGGTGACTTTCAAAGTGTTAGG - Intergenic
903329652 1:22590739-22590761 AAGGTGGAATTCAAAGTCATGGG - Intronic
905612245 1:39364094-39364116 ATGGTGAAATTTCAATGGAGGGG - Intronic
905751220 1:40466161-40466183 TTGGAGAAATTCAAATTCTTGGG - Intergenic
906449434 1:45932305-45932327 ATGGTGAAATGCCAACTGATGGG - Intronic
908309458 1:62863138-62863160 CTTGTGAATCTCAAATTGATGGG + Intronic
908347424 1:63249359-63249381 ATTGTGAAATTTACATTGTTTGG - Intergenic
908921373 1:69197807-69197829 AATGAGAAATTCAAATTGGTAGG - Intergenic
909496405 1:76283872-76283894 ATGTTGGGATTCAAATTGTTTGG + Intronic
909607808 1:77524020-77524042 ATAGTGAAATTCACAGAGATAGG - Intronic
909621731 1:77675495-77675517 ATGGTGAGATTTAAAGGGATTGG - Intronic
910091336 1:83468021-83468043 ATGGAGAAATTAAAATTAAATGG + Intergenic
910364898 1:86454236-86454258 AAGGTGGAATTCAAATTAATGGG - Intronic
911784738 1:101932214-101932236 ATGTTTAAATTGAAATTGGTGGG + Intronic
911961912 1:104315437-104315459 TTTCTGAAATTCAAATTGAGGGG - Intergenic
912260024 1:108101628-108101650 ATGGAGAAATTCAAAGTTGTGGG + Intergenic
913946641 1:125176852-125176874 ATCATGAAATTGAAATGGATGGG - Intergenic
915612971 1:157009937-157009959 AGGGTGAGATTGAATTTGATAGG - Intronic
916408295 1:164519374-164519396 ATGGTGAAATAAAAATGGACTGG - Intergenic
917410385 1:174754450-174754472 TTGGAGAAGTTCAAATTGCTGGG + Intronic
917804666 1:178602830-178602852 ATGGTGAAAAGAAAATTGAAAGG - Intergenic
917833473 1:178919259-178919281 ATACTGAAACTCAAATTGTTTGG - Exonic
920346275 1:205307616-205307638 ATGGAGAAGTTCATGTTGATGGG - Intronic
924943560 1:248829609-248829631 CTGGTGAGATTCAAACTAATTGG + Intergenic
1064459067 10:15515835-15515857 ATGGTTAAATTCAAGATGATGGG + Exonic
1065423150 10:25569663-25569685 AAGGGGATATTCTAATTGATGGG - Intronic
1065478856 10:26172026-26172048 ATGGAGAATTTGACATTGATTGG + Intronic
1066078258 10:31903010-31903032 ATGTTGCACTTCAAATTGATAGG - Intronic
1066526546 10:36285274-36285296 ATTGTGCAATTAAAATTTATGGG + Intergenic
1068008140 10:51414258-51414280 ATGGTGAAAATAAGAATGATGGG + Intronic
1068150454 10:53124117-53124139 ATGATGCAATTTAAATTGTTTGG - Intergenic
1068351700 10:55855294-55855316 AAGTGGAAATTCAAATTGACTGG + Intergenic
1072490500 10:95901028-95901050 ATGGTTAGATTCACATTGAAAGG + Intronic
1072893892 10:99349128-99349150 ATTGTGATATTTAAATTAATAGG + Intronic
1073714590 10:106089310-106089332 ATGGTGAAATTTAAATTTGTGGG - Intergenic
1074451874 10:113565864-113565886 ATTGTGAGATTCAAATTGCAGGG - Intronic
1077735774 11:4789239-4789261 AAGATGAATTTCAGATTGATTGG + Intronic
1077977891 11:7267962-7267984 ATGTAGAAATACAAATTGAGTGG + Intronic
1078670070 11:13356788-13356810 ATGCTGAAGTTCAAATTACTAGG - Intronic
1079548280 11:21662314-21662336 ATGTTGATATGCAAATTAATGGG - Intergenic
1079973290 11:27062233-27062255 TTGGTGAAGTTAAAATTGTTAGG + Intronic
1083464134 11:62834005-62834027 ATGTTGAAATGGAAAGTGATTGG - Intronic
1085006982 11:73100753-73100775 ATGTTGAAATTCGAATCTATTGG + Intronic
1086006268 11:82041700-82041722 GTGGAGAAATACAAATTAATAGG - Intergenic
1086275392 11:85122419-85122441 AGGATGAAATTCAAATTATTTGG + Intronic
1086886984 11:92217528-92217550 TTGTTGAAATGCAAATTGCTGGG + Intergenic
1086967148 11:93041089-93041111 AGGATGAACTTCAAATAGATAGG - Intergenic
1087489509 11:98806021-98806043 ATTATGAAATACATATTGATGGG - Intergenic
1092583220 12:9871013-9871035 ATGGTTAAATTGAAAAAGATTGG - Intergenic
1093081062 12:14811909-14811931 ATGGAGAAATTAAAAGTGAACGG + Intronic
1094346650 12:29477244-29477266 TTGGGGAAATTCAAAGTGAATGG + Intronic
1095156980 12:38869707-38869729 ATGGGGAAATACAAATTAAGAGG - Intronic
1096926703 12:55156062-55156084 TTGGTGTAATTGAAAGTGATGGG - Intergenic
1097343986 12:58470835-58470857 AAGGAGAAATTCAGATTTATAGG - Intergenic
1098035395 12:66296484-66296506 ATGATGAATTTCAAATAGATGGG + Intergenic
1099909130 12:88808270-88808292 ATGCTGAAATTCAATTATATTGG - Intergenic
1100962238 12:99975323-99975345 ATAGTGAAGTTGTAATTGATTGG - Intronic
1103083884 12:118046550-118046572 ATGGTCACATTCAGATTGTTTGG - Intronic
1103978196 12:124717511-124717533 ATGGCAAAATCAAAATTGATAGG + Intergenic
1104240725 12:126986387-126986409 TTGGTGAAATGCTAATTGGTGGG - Intergenic
1106404503 13:29462139-29462161 ATGTTGAAATGCAAATTCTTGGG - Intronic
1107191739 13:37596251-37596273 AGGGTGGACTTCAAATTAATAGG + Intronic
1107563500 13:41578622-41578644 ATCGTGAAATCCAACTTGACAGG + Intronic
1108824579 13:54397037-54397059 ATGAGGAAATTCAATTTCATGGG - Intergenic
1108863137 13:54887490-54887512 ATAGGGAAATTCAAAATGAAAGG + Intergenic
1109033752 13:57229580-57229602 ATGTGGAAATTCAAATTCGTAGG + Intergenic
1109927112 13:69158127-69158149 ATATTGAATGTCAAATTGATTGG - Intergenic
1110167251 13:72458251-72458273 AAGGAAAAATTCTAATTGATAGG + Intergenic
1112618521 13:101030723-101030745 TTGGAGAAATTCCAATTTATTGG + Intergenic
1112731067 13:102363198-102363220 ACTCTGAAATTCAAATTGAATGG + Intronic
1115104142 14:29739464-29739486 TTGCTGTAATTCAAATAGATGGG - Intronic
1115211274 14:30969545-30969567 AAGGTGAAATTCAGATTATTTGG + Intronic
1115754047 14:36516297-36516319 CTGATGAGATTCAAATTGTTTGG - Intergenic
1116136953 14:40937696-40937718 ATTGTGAAAGCCAAATAGATAGG + Intergenic
1116271133 14:42768714-42768736 AAGGTCAAATTCAAATTGACTGG + Intergenic
1116563067 14:46407668-46407690 ATTTTAAAAGTCAAATTGATAGG - Intergenic
1117934800 14:60890922-60890944 ATAGTGAATGTCAACTTGATTGG - Intronic
1120386321 14:83850759-83850781 ATGGTCAAATTCAAAAACATGGG + Intergenic
1120477132 14:85002453-85002475 ATGCTGACATACAAATTGATAGG - Intergenic
1120498116 14:85261223-85261245 ATAGTGAATGTCAACTTGATTGG - Intergenic
1123183092 14:106488161-106488183 ATTGGGAAATTTAAACTGATGGG - Intergenic
1125360075 15:38855969-38855991 ATGGTGACATACATATTTATAGG + Intergenic
1126977829 15:54205168-54205190 ATGGTGAAAGAAAAAATGATTGG + Intronic
1127380038 15:58423078-58423100 ATATTGAATGTCAAATTGATTGG + Intronic
1127724765 15:61738407-61738429 ATGGTAAAATTTGAATAGATGGG - Intergenic
1127737348 15:61855468-61855490 ATGCTGAAATACAAAATGGTAGG + Intronic
1128323819 15:66710272-66710294 ATAGTAAAATTGAAAGTGATTGG + Intronic
1128669611 15:69565123-69565145 AGGATGAAAGTCAAACTGATAGG + Intergenic
1129768979 15:78191595-78191617 ATGTTGAATTTCTAATTCATTGG - Intronic
1130714170 15:86315191-86315213 ATGGTGAAACTCAAATGGATAGG + Intronic
1131561198 15:93441834-93441856 ATTGTAAAATTTAAATTGTTGGG - Intergenic
1131688649 15:94801655-94801677 AAAGTGAAATTAAAATTGAATGG - Intergenic
1134194270 16:12146800-12146822 ATGTTGAAATTTAAAATAATGGG + Intronic
1135944600 16:26854821-26854843 ATGGTGATATACAAAGAGATGGG + Intergenic
1137329529 16:47477933-47477955 ATGGTTAAGTTCAAATTCCTCGG - Intronic
1138493484 16:57392385-57392407 ATGTTGAATGTCAACTTGATTGG + Intergenic
1139041481 16:63004146-63004168 ATGCTGAATGTCAACTTGATTGG - Intergenic
1144440955 17:15281135-15281157 AAGGTGAAATTCACATTGTCTGG - Intergenic
1146411562 17:32590128-32590150 ATGATAAAGTTCAAATTCATTGG + Intronic
1149194215 17:54100768-54100790 ATGATGAAATTTAAATTGTAAGG + Intergenic
1149804408 17:59601716-59601738 AAGGTGAAATTCACAATGTTTGG - Intronic
1152593502 17:81225560-81225582 AAGCTGAAACTCAAATTTATAGG - Intergenic
1152939928 17:83163245-83163267 ATGGTGACATTCAAATTCAGAGG - Intergenic
1154174285 18:12074741-12074763 TTTTTGAAATTCAAAATGATTGG - Intergenic
1154196172 18:12268703-12268725 ATATTCAAATTCAAATTGTTTGG + Intronic
1154335954 18:13464900-13464922 ATGGTGACATGCTAATTGGTTGG + Intronic
1155773634 18:29731192-29731214 AGGGTGAAATTAAATTTGATGGG - Intergenic
1155866650 18:30973745-30973767 ATTCTGAAATTAAAATTAATGGG + Intergenic
1157225807 18:45863284-45863306 ATGATAAAATTCAAATGTATTGG - Intronic
1157396024 18:47342126-47342148 CTCCTGAAATTCATATTGATTGG - Intergenic
1158306007 18:56106284-56106306 ATGTAGAATTTCAAACTGATTGG - Intergenic
1158736097 18:60081970-60081992 ATAGGGAAATTAAAATTGTTTGG - Intergenic
1159097524 18:63921317-63921339 ATGGTGAATTTGAAATGCATGGG - Intronic
1159396029 18:67857431-67857453 ATGGTGAAATTAAAAATAAAAGG + Intergenic
1159622934 18:70659755-70659777 ATGCTGAAACTGAAACTGATGGG + Intergenic
1160008975 18:75089339-75089361 TAGGTGAAATTCTAGTTGATGGG - Intergenic
1168230896 19:55030790-55030812 CTGGTGAAATTCAAATAGCCTGG + Intronic
925245983 2:2383457-2383479 ATGGTGAAATGGACAGTGATTGG - Intergenic
925900193 2:8503762-8503784 ATGGTGAGTGTCAACTTGATTGG + Intergenic
926452122 2:13017924-13017946 ATGGTGTAATTCAAGGTTATAGG - Intergenic
930758755 2:55007626-55007648 CTGGTGTAATTCATATTGTTGGG - Intronic
932335360 2:70928024-70928046 AAGGTTAAATCCAAAGTGATCGG - Intronic
932632731 2:73359682-73359704 ATAGAGAAACTAAAATTGATTGG - Intergenic
933088894 2:78094614-78094636 CTAGTGAAAAACAAATTGATAGG - Intergenic
933503939 2:83153831-83153853 TTGTTAAAATGCAAATTGATAGG + Intergenic
934902150 2:98168041-98168063 AAGGTCAAACTCAAAATGATTGG + Intronic
935351177 2:102152774-102152796 ATGATGTGATTCCAATTGATGGG + Intronic
935834196 2:107032466-107032488 ATGGGGAAATGCAAATCGAGTGG + Intergenic
936681329 2:114775719-114775741 GTGGTGACATTCTAATTGTTGGG - Intronic
937521498 2:122718240-122718262 ATATTGAATGTCAAATTGATTGG + Intergenic
938150384 2:128877130-128877152 ATGCTGAGATTCAAATGGAATGG - Intergenic
939536812 2:143441419-143441441 ATTCAGAAATTCAAGTTGATGGG + Intronic
940189884 2:151029408-151029430 ATGTTGAAATCCAAATTCAAGGG + Intronic
940562253 2:155313443-155313465 ATGTTGCAATTGAAATTGCTCGG - Intergenic
940667804 2:156630429-156630451 ATGGAGAAATTCAAGTGCATTGG + Intergenic
941083892 2:161094064-161094086 ATGCTGAAAGTAAAATTAATGGG - Intergenic
941191056 2:162382686-162382708 ATGGTGAAACTAAAATTTGTGGG + Intronic
941488546 2:166113459-166113481 ATGGTAATATTCATATTTATTGG - Intronic
942925352 2:181425730-181425752 ATGGTGAAATTTTAACTGACAGG + Intergenic
943357441 2:186874401-186874423 ATGATGAAATTCAAATAGGCCGG - Intergenic
943908867 2:193537197-193537219 ATGGAGGAATTTTAATTGATTGG - Intergenic
945781851 2:214184852-214184874 ATTTTGAAATTAAAATTTATTGG - Intronic
946810897 2:223524518-223524540 AAGCTGAAATATAAATTGATTGG - Intergenic
947041613 2:225928307-225928329 ATGTGGAAATTCACATTTATCGG - Intergenic
1168782253 20:503064-503086 ATGGTGATATTCATATGGAAAGG - Intronic
1169050218 20:2570014-2570036 ATAGTGAAATTCATACTGAATGG + Intronic
1170350474 20:15435508-15435530 ATGGTGATCTTCAAATGGAGTGG - Intronic
1170973542 20:21139510-21139532 ATGGAGAAAATGAAAGTGATGGG + Intronic
1171024086 20:21613026-21613048 ATGATGAAAGTGAAATTGCTGGG - Intergenic
1173093532 20:40001073-40001095 ATGGTAAAATTCAAATATAGTGG - Intergenic
1173338746 20:42135466-42135488 ATATTGAAATGCATATTGATGGG - Intronic
1173388392 20:42609374-42609396 ATGGTTTAATTCAAAGTGTTGGG - Intronic
1175764899 20:61585536-61585558 TTGGTCAAATTCAATTTAATAGG + Intronic
1176967130 21:15223944-15223966 AGGGTGAAAATAGAATTGATGGG - Intergenic
1177934206 21:27321747-27321769 TTGGAGAAATTGAAATTCATGGG + Intergenic
1178029587 21:28508969-28508991 ATGGAGAAAATCAAAATGAAAGG + Intergenic
1182818775 22:33194443-33194465 ACCTTGAAAATCAAATTGATGGG - Intronic
1183746746 22:39696300-39696322 ATGGTAGAATTCTAAGTGATGGG + Intergenic
1185168361 22:49276285-49276307 ATGCTGAATGTCAACTTGATTGG - Intergenic
953041588 3:39259692-39259714 ATGGCTAAATTGAAATTTATTGG + Intergenic
953914955 3:46912859-46912881 AAGGTGCAAAACAAATTGATTGG - Intergenic
958832532 3:99106822-99106844 CTGGTAAACTTCAAATGGATTGG + Intergenic
958899881 3:99873269-99873291 ATGGTCAAATACAAATTAAATGG + Intronic
959396919 3:105852222-105852244 ATGCTAAAATGCAAATTGTTAGG + Intronic
959663357 3:108894389-108894411 ATGGTGAAATATAATTTGCTAGG - Intergenic
963297605 3:143563138-143563160 ACGGTTAAATTCAAGTTAATTGG + Intronic
963492337 3:146017152-146017174 ATGGGAAAATTCAAAGTCATGGG - Intergenic
963560744 3:146862075-146862097 ATGGTGAAAGTCAAAGGGAAGGG - Intergenic
963654426 3:148026574-148026596 AAGATTAAATTCAAATTTATGGG + Intergenic
963690928 3:148501943-148501965 CTGATGTTATTCAAATTGATTGG - Intergenic
964830669 3:160880769-160880791 ATGCTGAAAGTCAATTTGATTGG - Intronic
965483550 3:169249848-169249870 AGTGTGAAATTTAAATTGGTTGG - Intronic
965787804 3:172354715-172354737 AAGGTGAAATAAAAGTTGATTGG - Intronic
965827656 3:172747031-172747053 ATGGTTGAATTCAAACTCATAGG - Intergenic
966637756 3:182155319-182155341 TTGGTGTACTTCAAATTGATGGG - Intergenic
966648593 3:182273965-182273987 ATGTTGAAACTCAGATTGCTGGG + Intergenic
966982504 3:185151836-185151858 ATTGTGAAATTCTAATTAAATGG + Intronic
967009047 3:185414318-185414340 ATGGTGGAATTCAATTTTTTTGG - Intronic
970228959 4:13889580-13889602 ATGGTGGAATAGAAATTGAAAGG + Intergenic
970987463 4:22175590-22175612 ATGGTGAAAATGAAAATGACAGG - Intergenic
971010991 4:22434840-22434862 TTTTTGAAATTCAAAATGATTGG - Intronic
971847973 4:31945278-31945300 ATGGTGAAATTGACATGGTTTGG + Intergenic
972326152 4:38017013-38017035 ATGCAGAAAGTCAAATTAATGGG + Intronic
972908890 4:43788629-43788651 ATGGTGTAATTAAAATTAAATGG + Intergenic
973715065 4:53668430-53668452 TTGGTGTAACTGAAATTGATGGG - Intronic
973873988 4:55195893-55195915 ATTGTTAAATTCACACTGATGGG - Intergenic
974515344 4:62900950-62900972 ATGGAGAAATACAAATGGAGGGG - Intergenic
974731026 4:65866544-65866566 ATGGTCAATTTGAAATTGCTCGG + Intergenic
976167302 4:82269606-82269628 ATTGTGAAACTCAACATGATGGG - Intergenic
977314547 4:95429315-95429337 ATGGTAAAATTCCAATTTGTTGG - Intronic
978006020 4:103617962-103617984 ATAGAGAAAATAAAATTGATGGG + Intronic
980964386 4:139506709-139506731 ATGATGATATTCAACTTGAGTGG - Exonic
981362971 4:143868700-143868722 ATGGTGAGTTTGAGATTGATAGG + Intergenic
981373700 4:143989520-143989542 ATGGTGAGTTTGAGATTGATAGG + Intergenic
981382801 4:144092763-144092785 ATGGTGAGTTTGAGATTGATAGG + Intergenic
981463103 4:145034151-145034173 ATACTGAAAGTCAACTTGATTGG + Intronic
982656116 4:158151813-158151835 ATGTTGAATGTCAACTTGATTGG + Intronic
983374694 4:166910923-166910945 ATTGTAATATTCAAACTGATAGG - Intronic
984025340 4:174536810-174536832 ATGGTCACCTTCAAATTAATTGG - Intergenic
986733949 5:10654370-10654392 ATAGTGAATTTCAAGTTGACAGG + Intergenic
987868806 5:23584067-23584089 AAGATGAAATACAAATTGATAGG + Intergenic
988059159 5:26144736-26144758 ATCATAAAATTCAAATTAATTGG - Intergenic
988268944 5:28989516-28989538 CAAGTGAAATTCAAATTGAATGG + Intergenic
989142541 5:38216029-38216051 ATGTGGACATTCAAATTAATCGG + Intergenic
989245935 5:39254703-39254725 ATGGTGGAATGCAAAATAATTGG + Intronic
989288972 5:39739315-39739337 TTGGAGAAATTCAAATGGAGAGG - Intergenic
989295372 5:39819298-39819320 ACTGTGAAATTCAAGTTGAAGGG - Intergenic
989758815 5:44987796-44987818 ATGGGGAAATTCAAATTCCCTGG + Intergenic
990366220 5:55073184-55073206 ATGGTAACATTAAAAATGATTGG - Intergenic
990943518 5:61227580-61227602 ATGGTGAAGTTCATATTTAGGGG - Intergenic
992905447 5:81340856-81340878 AAGGAGAAATTCAAATTCAATGG + Intronic
993010182 5:82472333-82472355 TTGGAGAAATTCAAAGTGGTAGG + Intergenic
993209740 5:84933265-84933287 ATGGAGAAATTCAAATGAATTGG + Intergenic
993325664 5:86532603-86532625 ATGATGTTATTCAAATTGAATGG - Intergenic
993330394 5:86593008-86593030 ATGGAGAAATTGAAACTGTTGGG + Intergenic
993361854 5:86987456-86987478 ATGCTGAAACCCAAAGTGATAGG + Intergenic
995279321 5:110315596-110315618 ATAGTGAGAGTCAACTTGATTGG - Intronic
995511019 5:112909481-112909503 AGGGTATAATTAAAATTGATGGG - Intronic
996658677 5:125972582-125972604 ATGTTTAAAATCAAATTGACTGG + Intergenic
998022629 5:138783697-138783719 ATGTTGTAACACAAATTGATAGG + Intronic
998837244 5:146214654-146214676 ATGGTGAAACTTAAATACATTGG - Intronic
999057398 5:148593765-148593787 AAGATGAAATTCAAGTTTATTGG + Intronic
999444266 5:151626679-151626701 ATGGTGGAAGCCAAATTGTTGGG + Intergenic
999704953 5:154263808-154263830 ATGTTGAAATTCAAATCCAAAGG - Intronic
1006891417 6:37432656-37432678 AAGGTGAAATTTGAATTCATGGG + Intergenic
1007128125 6:39444885-39444907 CTTGTGAACTGCAAATTGATGGG - Intronic
1007318089 6:41005824-41005846 ATGGTGATATTCAAAAGGGTGGG + Intergenic
1008421985 6:51311665-51311687 ATGGTACAATTCTAATTTATAGG - Intergenic
1011800109 6:91003363-91003385 AGGTTTAAATTCAAACTGATTGG + Intergenic
1012130840 6:95490795-95490817 ATAGTTAAATTGAAATTGTTTGG + Intergenic
1012162409 6:95902701-95902723 ATGGTAAAATTAAAATTTAAAGG - Intergenic
1012810883 6:103956611-103956633 ATGGTGAAATGCAAATATAGGGG - Intergenic
1013202200 6:107909890-107909912 ATGGTGAATATCAAATTGTATGG + Intronic
1014045475 6:116880197-116880219 ATGGTGAAATTGAAGATGATGGG - Intronic
1014656186 6:124107326-124107348 ATGGTGTGATTCTAGTTGATAGG + Intronic
1014908377 6:127058698-127058720 ATGATGAACTTAAAATTGAAGGG - Intergenic
1015419826 6:132994289-132994311 ATGGTGAATATAAAATTGAAAGG - Intergenic
1015499724 6:133919906-133919928 ATGGTCAAATCAATATTGATAGG - Intergenic
1016161652 6:140888734-140888756 ATAGAGAAATTCAAAATTATAGG - Intergenic
1017693409 6:156989957-156989979 AGGTTGAAAATCAAATTAATTGG - Intronic
1018133839 6:160758344-160758366 ATGGTGGAAGCCACATTGATGGG - Intergenic
1018336095 6:162791711-162791733 ATGGTGAAATTCAAATTGATGGG - Intronic
1020217647 7:6206962-6206984 ATGGTTTACTTAAAATTGATGGG - Intronic
1020704271 7:11524097-11524119 ATAAAGAAATACAAATTGATGGG - Intronic
1020770968 7:12394128-12394150 ATGGTGATATTCAAATCCAGAGG - Intronic
1021218896 7:17951452-17951474 ATGGTGAAAATAATATAGATTGG + Intergenic
1022215266 7:28253457-28253479 ATGGTTAATTTTGAATTGATGGG - Intergenic
1022604988 7:31804081-31804103 AAGGTGAAATTCACAATGTTTGG - Intronic
1025263200 7:57436168-57436190 ATGGAGAAATTCATATAGAATGG + Intergenic
1026215032 7:68340956-68340978 ATGGGAAAATTCAAATGGCTGGG - Intergenic
1026335505 7:69391103-69391125 ATTGTGAAAATCAAATGAATTGG + Intergenic
1027308181 7:76924468-76924490 ATGGAGAAATTAAAATTAAATGG + Intergenic
1027351922 7:77320951-77320973 ATGGTCACATTCATATTTATGGG - Intronic
1027449827 7:78318494-78318516 TTGGTGTAACTCAAAGTGATGGG + Intronic
1027888755 7:83943405-83943427 ATGTTGAGATTCAAACTGAGTGG + Intergenic
1028308976 7:89305273-89305295 ATGTTCAAAATCAAATTGACTGG - Intronic
1028349099 7:89822024-89822046 ATGGAGAAATAAAAATAGATGGG - Intergenic
1031068399 7:117134079-117134101 TTGGTAAAATGAAAATTGATAGG - Intronic
1031526725 7:122831017-122831039 ATGGAGAAATTAAAATTTAGGGG + Intronic
1032055762 7:128683031-128683053 ATGGGTATATTCAAATTGATTGG - Exonic
1032607688 7:133374279-133374301 GTGGTGAAAGTCAGATTGCTTGG + Intronic
1033435837 7:141332985-141333007 ATGGTGGATTCCAAATGGATGGG - Intronic
1033645120 7:143295582-143295604 GTGGTGAAATTAAAATTGCTAGG + Intronic
1034313013 7:150106514-150106536 ATGGTGAAATACACATGAATTGG + Intergenic
1034793850 7:153994150-153994172 ATGGTGAAATACACATGAATTGG - Intronic
1037100948 8:15045239-15045261 ATGATAAAATTCAGATAGATTGG + Intronic
1037602903 8:20413103-20413125 TTGGTTAAATACAAATTGCTGGG - Intergenic
1038220982 8:25607574-25607596 AGGCTGATTTTCAAATTGATGGG - Intergenic
1039320150 8:36420706-36420728 AGGGAGAAATGCAATTTGATAGG - Intergenic
1040961379 8:53036803-53036825 ATCTTGCAATTTAAATTGATTGG - Intergenic
1041038213 8:53817397-53817419 ATGGTAAATTTTGAATTGATTGG - Exonic
1045695327 8:104802523-104802545 ATGGAGAAACACAAATGGATTGG + Intronic
1045696086 8:104810376-104810398 ATGCTGCAATTCAAAGTGAAGGG + Intronic
1046700696 8:117397392-117397414 ATGGTCAAAGTCAAGTTGTTGGG + Intergenic
1047467928 8:125136955-125136977 AAGGAGAAATGCAAATTGAATGG + Intronic
1048528689 8:135227825-135227847 ATGGGGACATTCCAATTAATAGG - Intergenic
1050005440 9:1124849-1124871 ATGGGGCAATTCAAATTTAAGGG + Intergenic
1050255195 9:3786424-3786446 ATGATGAAATAAAAATTGTTTGG + Intergenic
1051587195 9:18739296-18739318 ATGTTGAAATTCAAAGTTCTGGG + Intronic
1052481575 9:29034588-29034610 ATGGTGAAAATCATAGTCATAGG - Intergenic
1052509662 9:29399498-29399520 ATTTTGACATTCAAATTAATTGG + Intergenic
1052788826 9:32855110-32855132 ATGGTGACATTGAAATTGTGAGG + Intergenic
1053189153 9:36046851-36046873 ATGGTGAAGGTCAAATCTATAGG - Intronic
1057193662 9:93101830-93101852 ATGGAGAAATTCAAACTCTTTGG - Intronic
1057486181 9:95486417-95486439 ATGGGGAAATCCCAATTGAGAGG + Intronic
1058438586 9:104987114-104987136 ATACTGAATTTAAAATTGATTGG - Intergenic
1059146851 9:111907541-111907563 ACGGTGAAATTCAAAATGTCTGG - Intronic
1059876953 9:118645553-118645575 AGTGTGAAATACAAAATGATAGG + Intergenic
1185814290 X:3140183-3140205 ATGGAGAAATTCTAATTTCTTGG + Intergenic
1186123807 X:6391385-6391407 ATGGTGAGATGGAAATTGAAAGG + Intergenic
1186159646 X:6763410-6763432 ATTATGAAATTCAAATTTAAAGG + Intergenic
1188654698 X:32678111-32678133 ATGGGGAAATGCTAATTAATGGG + Intronic
1189092553 X:38102167-38102189 ATGGTATAATTCAGATTGACCGG + Intronic
1190882263 X:54500185-54500207 ATGCTGAAATACACATTGAAAGG + Intergenic
1191940127 X:66469892-66469914 ATGGTTAAATTCATTTTTATAGG - Intergenic
1192289293 X:69775345-69775367 ATAGAGAAATTCAAAAGGATTGG - Intronic
1193299736 X:79875910-79875932 ATGGTAAAATGCAAAAAGATAGG + Intergenic
1193568608 X:83112453-83112475 AAGGAGAAATGGAAATTGATAGG - Intergenic
1194096105 X:89640979-89641001 ATGTTGAATGTCAACTTGATTGG + Intergenic
1194279152 X:91925682-91925704 ATGATAAAATTCAAATTTAATGG - Intronic
1195900233 X:109789889-109789911 ATGATGAAGTTCAAGATGATTGG + Intergenic
1195950839 X:110270989-110271011 AATATGAAATTCAAATTGAGAGG + Intronic
1196069585 X:111505967-111505989 ATGGTGCAATAAAAAGTGATTGG + Intergenic
1197457021 X:126689493-126689515 ATGTTGAATGTCAACTTGATTGG - Intergenic
1198323632 X:135544404-135544426 AATGTGAAATTCAAATGGTTTGG + Intronic
1199692294 X:150317854-150317876 ATGGAGAAATGCAGATGGATAGG + Intergenic
1200414744 Y:2897702-2897724 ATGGTGAAAATGAAATTAATAGG + Intronic
1200449111 Y:3302358-3302380 ATGTTGAATGTCAACTTGATTGG + Intergenic
1200450573 Y:3322815-3322837 ATAATTAAATTCATATTGATAGG - Intergenic
1200596625 Y:5149184-5149206 ATGATAAAATTCAAATTTAATGG - Intronic
1200789129 Y:7284193-7284215 ATAGTGAATTTCACCTTGATGGG + Intergenic
1201582992 Y:15530883-15530905 ATGGTGTACCTCAAAGTGATGGG - Intergenic
1201691651 Y:16773541-16773563 ATGCTGAAATGCAAAATGAGTGG + Intergenic
1202136770 Y:21674216-21674238 ATGGTGTGATACAAATTTATTGG - Intergenic