ID: 1018336096

View in Genome Browser
Species Human (GRCh38)
Location 6:162791712-162791734
Sequence AATGGTGAAATTCAAATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 375}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018336096_1018336100 8 Left 1018336096 6:162791712-162791734 CCATCAATTTGAATTTCACCATT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1018336100 6:162791743-162791765 ACTGCATTCTAGAAGGAGGATGG No data
1018336096_1018336102 10 Left 1018336096 6:162791712-162791734 CCATCAATTTGAATTTCACCATT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1018336102 6:162791745-162791767 TGCATTCTAGAAGGAGGATGGGG 0: 1
1: 0
2: 2
3: 22
4: 292
1018336096_1018336103 21 Left 1018336096 6:162791712-162791734 CCATCAATTTGAATTTCACCATT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1018336103 6:162791756-162791778 AGGAGGATGGGGAATGCAGAAGG No data
1018336096_1018336099 4 Left 1018336096 6:162791712-162791734 CCATCAATTTGAATTTCACCATT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1018336099 6:162791739-162791761 ACTTACTGCATTCTAGAAGGAGG No data
1018336096_1018336098 1 Left 1018336096 6:162791712-162791734 CCATCAATTTGAATTTCACCATT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1018336098 6:162791736-162791758 AGTACTTACTGCATTCTAGAAGG No data
1018336096_1018336101 9 Left 1018336096 6:162791712-162791734 CCATCAATTTGAATTTCACCATT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1018336101 6:162791744-162791766 CTGCATTCTAGAAGGAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018336096 Original CRISPR AATGGTGAAATTCAAATTGA TGG (reversed) Intronic
903329653 1:22590740-22590762 AAAGGTGGAATTCAAAGTCATGG - Intronic
904065527 1:27747266-27747288 AATGATGTAATTCAGATTCAGGG + Intronic
904081279 1:27873843-27873865 AATGGTGGAAGTCAGAGTGATGG + Intronic
905612246 1:39364095-39364117 AATGGTGAAATTTCAATGGAGGG - Intronic
905751221 1:40466162-40466184 ATTGGAGAAATTCAAATTCTTGG - Intergenic
906449435 1:45932306-45932328 TATGGTGAAATGCCAACTGATGG - Intronic
907998247 1:59654716-59654738 TGTGGTGAAATGCAAATTGCTGG + Intronic
908309457 1:62863137-62863159 ACTTGTGAATCTCAAATTGATGG + Intronic
908750616 1:67419063-67419085 ATTGGAGAAAGTCACATTGATGG - Intronic
909780296 1:79537451-79537473 AATGCTAAACTTCAAATGGAAGG - Intergenic
910364899 1:86454237-86454259 AAAGGTGGAATTCAAATTAATGG - Intronic
910603735 1:89059689-89059711 AATTGTAAAATTAAAATTCAAGG + Intronic
910637095 1:89420803-89420825 AATTGTAAAATTAAAATTCAAGG - Intergenic
910721235 1:90288415-90288437 AGTGATGCAATTCAAATAGATGG - Intergenic
911961913 1:104315438-104315460 TTTTCTGAAATTCAAATTGAGGG - Intergenic
912363839 1:109116637-109116659 AATGGTGAAAAACCAATTCAAGG + Intronic
912744624 1:112235291-112235313 AATGATGAAATTGAAATTTAAGG - Intergenic
912828489 1:112928559-112928581 AATGGTAAAATTTAAGTTTAGGG + Intronic
915437154 1:155916058-155916080 AATGGTTAAAATGAATTTGAAGG - Intronic
916384492 1:164252122-164252144 AATGATGAAAATTAAAATGATGG + Intergenic
916401098 1:164449220-164449242 AATGTTGAACTTAAGATTGATGG - Intergenic
918000849 1:180493860-180493882 ATTAGACAAATTCAAATTGAGGG - Intronic
918904975 1:190479296-190479318 AAGGGTGAAATTGAAGTAGAGGG + Intergenic
920822557 1:209395012-209395034 AGTGGTCATATTCAAATTAAAGG + Intergenic
921342779 1:214151102-214151124 AATGAAGAAATTCAAGATGATGG + Intergenic
921527787 1:216239618-216239640 TATGGTGAAAAGCAAATGGAAGG + Intronic
1063499924 10:6544178-6544200 AATGGGGAAAATCAACCTGAAGG + Intronic
1064101122 10:12465119-12465141 AATGGTAGATTTCTAATTGAAGG + Intronic
1064161927 10:12954016-12954038 ATGTATGAAATTCAAATTGATGG - Intronic
1064459066 10:15515834-15515856 GATGGTTAAATTCAAGATGATGG + Exonic
1064477665 10:15708153-15708175 AATGGTAAAATTAAATTTCAGGG - Intronic
1065448864 10:25833608-25833630 ATTTGTGAAATATAAATTGAAGG + Intergenic
1066451049 10:35530489-35530511 AATGCTGAAATTAAAAATGCAGG + Intronic
1066526545 10:36285273-36285295 AATTGTGCAATTAAAATTTATGG + Intergenic
1066936464 10:41844593-41844615 AATTATGAAATTGAAATGGATGG - Intergenic
1068008139 10:51414257-51414279 AATGGTGAAAATAAGAATGATGG + Intronic
1068672195 10:59734477-59734499 AATGGTGCAATTACAATTGGGGG - Intronic
1070360543 10:75684379-75684401 AAAGGTGACATTCATTTTGATGG - Intronic
1070363998 10:75718103-75718125 AATGGTGCAAATAAGATTGAAGG - Intronic
1070564594 10:77594142-77594164 AATGGTCAAAGTCAAGGTGAGGG + Intronic
1072347069 10:94518534-94518556 AATAATCAAATTCAAGTTGAGGG - Intronic
1072867975 10:99084632-99084654 AGAGGTAAAGTTCAAATTGATGG - Intronic
1073198915 10:101718892-101718914 AATGGTGAAAGACAAATTGTTGG - Intergenic
1073649456 10:105343085-105343107 AATTGTGTATTTCAAGTTGACGG + Intergenic
1073714591 10:106089311-106089333 GATGGTGAAATTTAAATTTGTGG - Intergenic
1073921437 10:108464618-108464640 AATATTTAAATTCAAATTGGAGG + Intergenic
1074451875 10:113565865-113565887 AATTGTGAGATTCAAATTGCAGG - Intronic
1074841424 10:117356328-117356350 AAAGGTAAAACTCAATTTGAAGG + Intronic
1074954642 10:118376580-118376602 GATGATGAAACTCAAATTTAAGG - Intergenic
1077602557 11:3583531-3583553 AATGCTGAGATTCAAATTCAGGG + Intergenic
1077923932 11:6661990-6662012 AACAGAGAAATCCAAATTGAGGG - Intergenic
1079532406 11:21470393-21470415 AATGGTGAAATACAAATTTAAGG - Intronic
1079548281 11:21662315-21662337 AATGTTGATATGCAAATTAATGG - Intergenic
1079807412 11:24950976-24950998 AATGTTGAAAGACAAATTGGGGG - Intronic
1080286464 11:30619945-30619967 GATGGTGAAAGTGAAAGTGATGG + Intergenic
1080555410 11:33411614-33411636 ATTTGTGAAATTCAAATGGCAGG + Intergenic
1081409485 11:42739762-42739784 AAAGGTGAAATTCAGAATAATGG - Intergenic
1082140787 11:48606147-48606169 AATGCTGAAATTTAACTTTATGG - Intergenic
1082143422 11:48636254-48636276 AATGCTGAAATTTAACTTCATGG - Intergenic
1082567960 11:54702916-54702938 AATGCTGAAATTTAACTTTATGG - Intergenic
1082569562 11:54721020-54721042 AATGCTGAGATTCAACTTCATGG - Intergenic
1082570608 11:54733528-54733550 AATGCTGAAATTTAACTTCATGG - Intergenic
1082612260 11:55314616-55314638 AATGCTGAAATTTAATTTCATGG - Intergenic
1082621361 11:55426361-55426383 AATGCTGAAATTTAACTTCATGG - Intergenic
1082623627 11:55456334-55456356 AATGCTGAAATTTAACTTCATGG - Intergenic
1083061738 11:59880091-59880113 AATGGTAAAATTGTAAATGAAGG - Intergenic
1085663096 11:78387933-78387955 AATGGAGAAAATAAAAGTGAAGG + Intronic
1086212797 11:84341288-84341310 GGTTGTGAAATTCAAATTGGTGG + Intronic
1087494198 11:98868425-98868447 AATAGTGAAAATCAAATTACAGG + Intergenic
1087893109 11:103557437-103557459 AATATTGAAAATAAAATTGATGG + Intergenic
1088070884 11:105783321-105783343 AAAGTTGAAATACAAAATGAAGG + Intronic
1088603337 11:111503808-111503830 AATTAGGAAATTCAACTTGATGG + Intronic
1091577076 12:1747855-1747877 AATGTTGAAAGTCAAAGTCAAGG - Intronic
1092295460 12:7194096-7194118 AATGCTGTAATTAAAAATGAAGG - Intronic
1092428703 12:8392880-8392902 AATGCTGAGATTCAAATTCAGGG + Intergenic
1093088223 12:14890653-14890675 AATAGTGCAATACAAATTAAAGG + Intronic
1093256055 12:16869493-16869515 AATGTAGAAATTCATCTTGATGG - Intergenic
1095360559 12:41333394-41333416 CTTGGTGAAATTCAAAATGATGG + Intronic
1095379107 12:41567906-41567928 AATGATGTAGTTCAAATTGTTGG - Intronic
1095486856 12:42694373-42694395 AATGCTGAAGTTAAAATTGTGGG - Intergenic
1095760249 12:45824771-45824793 AATGCTGCAATGCACATTGACGG - Intronic
1096330257 12:50705633-50705655 AATGGAGAAATGGACATTGAAGG + Intronic
1096926704 12:55156063-55156085 ATTGGTGTAATTGAAAGTGATGG - Intergenic
1097665844 12:62476419-62476441 AAAAGTGAAATTCAAGTTAATGG - Intronic
1098035394 12:66296483-66296505 CATGATGAATTTCAAATAGATGG + Intergenic
1098066643 12:66625586-66625608 AATGAAGAAATTCAAAATGATGG + Intronic
1098175753 12:67789117-67789139 AAAAGTGATATTTAAATTGAGGG + Intergenic
1098989487 12:77049027-77049049 CATGGTGAAAATCCAGTTGAGGG - Intronic
1099074702 12:78092144-78092166 AAAGTTGACATTCAAATTCAGGG + Intronic
1099320143 12:81136636-81136658 AATGGTAAAATTCATTTGGAAGG + Intronic
1099422561 12:82480935-82480957 AATGGACAAATTGAAACTGAGGG - Intergenic
1103251214 12:119501560-119501582 AATGGTGAAATTCTTCATGAGGG - Intronic
1107256218 13:38430542-38430564 ACTGGTGAAATTGAAGGTGAAGG - Intergenic
1107503306 13:41003404-41003426 AATGATCAAAGTCAAATTTAAGG - Intronic
1108824580 13:54397038-54397060 AATGAGGAAATTCAATTTCATGG - Intergenic
1111553650 13:89850693-89850715 AAAAGTTAAATTCAAATTGTTGG + Intergenic
1112142736 13:96663472-96663494 AATGGCTAAAATCAAATAGATGG + Intronic
1112212115 13:97388118-97388140 AATGGAGAAGTTCAAAATTAAGG + Intronic
1112818337 13:103300362-103300384 ACTGGGCAAATTCAAAATGAGGG + Intergenic
1113564646 13:111312527-111312549 ATTGGTGAAATGCAAGTTAAAGG + Intergenic
1114014086 14:18408689-18408711 AAAAATGACATTCAAATTGAGGG + Intergenic
1114072298 14:19122359-19122381 AAGGGAGCAATTCAAATAGATGG + Intergenic
1114089959 14:19277614-19277636 AAGGGAGCAATTCAAATAGATGG - Intergenic
1117747747 14:58888334-58888356 AATGGTGAAAGTGAAATTGAGGG + Intergenic
1118075878 14:62298419-62298441 AATGGGGAAATTTAAATATATGG - Intergenic
1119462424 14:74818893-74818915 AACAGACAAATTCAAATTGAGGG - Intronic
1121084194 14:91132859-91132881 AATGGTCAAATTCATAAAGATGG - Intronic
1121133495 14:91472339-91472361 ACTGGTGAAATATAAATAGAAGG - Intronic
1123456908 15:20434661-20434683 CATGGTGCCATTCAAAATGATGG - Intergenic
1123661153 15:22565695-22565717 CATGGTGCCATTCAAAATGATGG + Intergenic
1123693198 15:22856736-22856758 AAATGGGAAATGCAAATTGAAGG + Intronic
1123871664 15:24581321-24581343 ATTGGTGAAATTCAATATGAAGG + Intergenic
1123983850 15:25626807-25626829 AATGGTGAAGTTTACCTTGAGGG + Intergenic
1124207458 15:27733750-27733772 AATGGAGACATTCAATTTTATGG - Intergenic
1124263058 15:28209804-28209826 CATGGTGCCATTCAAAATGATGG - Intronic
1124314953 15:28659931-28659953 CATGGTGCCATTCAAAATGATGG + Intergenic
1124359804 15:29027924-29027946 AAAAGTGAAAATCAAAATGAAGG - Intronic
1124644664 15:31429378-31429400 AATGGTGAGATTCATAGAGATGG + Intronic
1127620746 15:60731820-60731842 ACTTGTGAAATTCAAACTCATGG - Intronic
1129433655 15:75520217-75520239 AAGGGTCAAATTCAAATTATGGG + Intronic
1130621556 15:85468218-85468240 AAAGATGTAATGCAAATTGAGGG - Intronic
1130684859 15:86028207-86028229 AATGGACAAATCCCAATTGAAGG + Intergenic
1131039420 15:89249270-89249292 AATGGGAAAATTCATATTCAAGG + Intronic
1132357418 15:101182585-101182607 AATGGGGAAATGGAAATTGGGGG + Intronic
1133124800 16:3639754-3639776 TATTGTGAATTTCAAATTGTTGG + Intronic
1133174938 16:4007234-4007256 AATCGTGAAAACCAAATCGAAGG + Intronic
1133369513 16:5237484-5237506 CATGCTGAGATTCAAATTCAGGG - Intergenic
1134194269 16:12146799-12146821 AATGTTGAAATTTAAAATAATGG + Intronic
1134390376 16:13814476-13814498 AATGATGAAACTCAACTTAATGG - Intergenic
1135289271 16:21221153-21221175 AATGATCAAATTCAAGATGAAGG - Intergenic
1140497748 16:75404650-75404672 AATGCAGCAATCCAAATTGAGGG + Intronic
1143559796 17:7686800-7686822 GATGGAGAAAATCCAATTGAAGG - Exonic
1144223125 17:13118090-13118112 AATGGAGAAATGGGAATTGAAGG - Intergenic
1148875388 17:50684024-50684046 AAGGGTGAAATCCGCATTGATGG + Exonic
1149508516 17:57216614-57216636 AATGGTGAAATTCACAGTCCAGG + Intergenic
1150242024 17:63642072-63642094 ATGGGTGAAATTCAGATTTAGGG + Intronic
1151795483 17:76342347-76342369 CACGGTGAAACCCAAATTGAGGG + Intronic
1151941840 17:77297374-77297396 AATGGTGTCATCCATATTGAGGG + Intronic
1153895520 18:9555665-9555687 ATTGTGTAAATTCAAATTGAGGG + Intronic
1154089004 18:11339318-11339340 AATTGTGAAATTCATCTTGTTGG - Intergenic
1155301975 18:24438553-24438575 AATGGACAAACCCAAATTGAGGG - Intronic
1155374706 18:25143524-25143546 GATGGTGAACTTTAAACTGAAGG - Intronic
1155773635 18:29731193-29731215 CAGGGTGAAATTAAATTTGATGG - Intergenic
1156009345 18:32478106-32478128 AATGGTGGATTTTAAATTGCAGG - Intergenic
1156598539 18:38576384-38576406 AAATGTGATATTCAAAATGAGGG + Intergenic
1157157793 18:45284745-45284767 GATGGTGAAATACAAAACGAGGG + Intronic
1157335662 18:46735543-46735565 ATTGGTGAAATGAGAATTGATGG + Intronic
1158050976 18:53219510-53219532 AATTTTTAAATGCAAATTGATGG + Intronic
1158262403 18:55622551-55622573 AATAGTGATATTCTAATTGTAGG + Intronic
1158564318 18:58541741-58541763 ATTGGTTAAAATCAAATTTATGG - Intronic
1164841829 19:31398532-31398554 AATGGTGAAATACTCACTGAGGG + Intergenic
1168440108 19:56357588-56357610 AAAAATCAAATTCAAATTGAAGG + Intronic
1202666980 1_KI270709v1_random:3541-3563 TATCGTGAAATTGAAATGGATGG - Intergenic
926231754 2:11009788-11009810 TATGGTGAAGTTCAACTTGTTGG + Intergenic
929216465 2:39418921-39418943 ACTAGTGAAATCCAAATAGACGG + Intronic
930246934 2:48993362-48993384 AACTGTCAAATTAAAATTGATGG - Intronic
930811930 2:55551448-55551470 TATTTTGAAATTTAAATTGATGG + Intronic
931894877 2:66717596-66717618 AAGTGAGAAATTCAAAGTGATGG - Intergenic
931906777 2:66851028-66851050 AATGGTGACAATAAAATTAAAGG - Intergenic
932227388 2:70053319-70053341 AAAGGTGAAATCCACATTGTTGG + Intergenic
932374719 2:71226145-71226167 AATGGTCAAATGCCATTTGAAGG + Intronic
935834192 2:107032429-107032451 AATGGAGAAATGCAAATAAAAGG + Intergenic
935888627 2:107651085-107651107 AGTTGTGAAGTTCAAAATGAGGG + Intergenic
936681330 2:114775720-114775742 AGTGGTGACATTCTAATTGTTGG - Intronic
937200423 2:120200576-120200598 AATAGTGAAATTCATAGCGATGG + Intergenic
938486542 2:131715843-131715865 AAGGGAGCAATTCAAATAGATGG + Intergenic
938622045 2:133066187-133066209 TATGGTGAAAGACAAATTAAAGG + Intronic
938676434 2:133640092-133640114 AATGATCAAATCCAAATTTAAGG + Intergenic
939006459 2:136793252-136793274 AATGGCTAAAATCAAAATGATGG - Intronic
939260233 2:139798293-139798315 AAAGGTGATATTCAAATAGCGGG + Intergenic
940189883 2:151029407-151029429 AATGTTGAAATCCAAATTCAAGG + Intronic
940487840 2:154318996-154319018 ACTGGTAAAGTTCAAAATGAAGG + Intronic
940492673 2:154384454-154384476 AATGGTGATCTTTCAATTGATGG - Intronic
940526433 2:154820865-154820887 AAGGGAGAAATTAAAATTCAGGG - Intronic
940884806 2:158979958-158979980 AATTGTGAAATTCTTATTCAGGG + Intronic
941083893 2:161094065-161094087 AATGCTGAAAGTAAAATTAATGG - Intergenic
941498114 2:166232414-166232436 AAAGGTGAAATTAAATGTGATGG + Intronic
941540949 2:166783628-166783650 AATGCTGAAAGTCAAAGTCAAGG + Intergenic
941857238 2:170243488-170243510 ACTGGTGAACTTGAAAGTGATGG - Intronic
941990427 2:171550678-171550700 AATGGTGAAAGTCAGATTTAGGG + Intronic
943241759 2:185393462-185393484 CAAGGTGAAATTTAAAATGACGG + Intergenic
943730077 2:191293193-191293215 CAGGGAGAAATTCCAATTGAAGG + Intronic
944369709 2:198967618-198967640 AATTGCAAAAATCAAATTGAAGG + Intergenic
944743929 2:202636603-202636625 AAAAGAGAAATTCAAATTGTGGG + Intronic
944783424 2:203043212-203043234 AATGAAAAAATTCAAATTTATGG + Intronic
945001709 2:205358148-205358170 AATAGTGAATTTCAAGTTGCTGG - Intronic
1169475524 20:5928030-5928052 AATGGTGGCATTAAAATGGAGGG + Intergenic
1169834881 20:9866881-9866903 AATGGTGAAATTGAAAATATTGG - Intergenic
1170491273 20:16877579-16877601 AATGAGGAAATTCAAAATCATGG + Intergenic
1171024087 20:21613027-21613049 AATGATGAAAGTGAAATTGCTGG - Intergenic
1172571843 20:35976663-35976685 AATGATGAGATTGAAATTCAGGG - Intronic
1173388393 20:42609375-42609397 AATGGTTTAATTCAAAGTGTTGG - Intronic
1176011010 20:62895580-62895602 AATGGTGAGATGCAAAGTCAGGG + Intronic
1176112845 20:63418367-63418389 AATGGTGAAATTCAGATGTGCGG + Intronic
1176967131 21:15223945-15223967 AAGGGTGAAAATAGAATTGATGG - Intergenic
1178168649 21:30011929-30011951 AATGATGATGTTCAAATTGGAGG - Intergenic
1178200645 21:30400003-30400025 AATGATGAGTTTCAAAATGATGG - Intronic
1180438585 22:15339495-15339517 AAAAATGACATTCAAATTGAGGG + Intergenic
1180490744 22:15844733-15844755 AAGGGAGCAATTCAAATAGATGG + Intergenic
1182081573 22:27532954-27532976 AATGATGAATTTCAAGTTGATGG + Intergenic
1182546758 22:31081195-31081217 ATTGGGAAAATTCAATTTGACGG - Intronic
1182818776 22:33194444-33194466 AACCTTGAAAATCAAATTGATGG - Intronic
1183746745 22:39696299-39696321 AATGGTAGAATTCTAAGTGATGG + Intergenic
949278873 3:2322923-2322945 ATTGGTGGATTTCACATTGATGG + Intronic
949641885 3:6045355-6045377 AATGGAGAATTTGAAATAGATGG - Intergenic
949708609 3:6847636-6847658 ATCAGTGAAATACAAATTGAGGG - Intronic
949731658 3:7120863-7120885 AATTATGAAATTCAAGTTAAAGG + Intronic
951078904 3:18427676-18427698 AAAGGTGCTATTCAAATTTAAGG - Intronic
951592186 3:24278601-24278623 AATGTTGCAATTTAAATAGAGGG - Intronic
953732603 3:45463207-45463229 AATAGAGAAATTCAAATGGGAGG - Intronic
955062186 3:55502863-55502885 AATGGTCCTATTCAAACTGAAGG + Intergenic
955250275 3:57274917-57274939 AATATTGAAATTTCAATTGAGGG + Intronic
955809613 3:62773429-62773451 AATTCTGAAATGCAAGTTGAAGG + Intronic
956050147 3:65239165-65239187 AATGGGGAAATGCAAATTAAAGG - Intergenic
956145399 3:66186578-66186600 GATGGTCAAGTTCAAATTTATGG - Intronic
956725997 3:72156869-72156891 AATGATGGAATTCAAATTTTAGG + Intergenic
957073408 3:75582591-75582613 CATGCTGAGATTCAAATTCAGGG + Intergenic
957659138 3:83123969-83123991 ACTGCTTAAATGCAAATTGATGG - Intergenic
958130199 3:89409383-89409405 AATTGTCCAAGTCAAATTGAGGG - Intronic
958155801 3:89754071-89754093 AATGCTGTAATTGAAATGGAAGG + Intergenic
958795125 3:98698978-98699000 CATGGTCAAATTCAGATTCAAGG - Intergenic
958997503 3:100921912-100921934 AATGGTAAAATGAAAAATGATGG + Intronic
959653379 3:108773312-108773334 AATGGGCAAATTCAAGTTCAAGG + Intergenic
960271420 3:115678767-115678789 ATAGGTGAAGTTCAACTTGAAGG + Intronic
960395035 3:117126783-117126805 AATGGTGAAATACACACTGAAGG + Intronic
961873721 3:130005401-130005423 AATGCTGAGATTCAAATTCAGGG + Intergenic
962425397 3:135265024-135265046 AGTGGTGGAACTCAAATTGTAGG + Intergenic
962701627 3:138006171-138006193 AAAGGTGAAATTAAAAATTAGGG + Intronic
962731887 3:138291177-138291199 AAAGGTGAAATGGAAAGTGAAGG - Intronic
963132079 3:141867485-141867507 AAATGTGAAATTTAAAATGAAGG - Intergenic
963452416 3:145500364-145500386 AATGGAGAAATTATAATTCAGGG - Intergenic
963492338 3:146017153-146017175 AATGGGAAAATTCAAAGTCATGG - Intergenic
963560745 3:146862076-146862098 GATGGTGAAAGTCAAAGGGAAGG - Intergenic
963654425 3:148026573-148026595 AAAGATTAAATTCAAATTTATGG + Intergenic
964087044 3:152831396-152831418 ATTGGAAAAATTCCAATTGAGGG - Intergenic
965629374 3:170715791-170715813 AAGGTTGAAAGTCAAATTGGAGG + Intronic
965756954 3:172037488-172037510 AAAGGTCAAATTCAGGTTGAAGG - Intergenic
965893298 3:173541500-173541522 ATTCATGAAATTCAAAATGAAGG + Intronic
966637757 3:182155320-182155342 ATTGGTGTACTTCAAATTGATGG - Intergenic
968252169 3:197229178-197229200 AATTGAGAAATTCTAATTTAGGG + Intronic
969736956 4:8998426-8998448 CATGTTGAGATTCAAATTCAGGG - Intergenic
969796137 4:9529999-9530021 AATGCTGAGATTCAAATTCAGGG - Intergenic
970453030 4:16190637-16190659 AACTTTGAAATTCAAATTGCAGG - Intronic
970551254 4:17183881-17183903 AATGGTTACTTTCATATTGATGG - Intergenic
970636610 4:18017579-18017601 AACAGATAAATTCAAATTGAGGG + Intronic
972954379 4:44371019-44371041 AGTGGTGAAATTCAGACTGATGG + Intronic
973715066 4:53668431-53668453 ATTGGTGTAACTGAAATTGATGG - Intronic
974435644 4:61854151-61854173 AGTGGTGAAATTGTAATGGAGGG + Intronic
974515345 4:62900951-62900973 TATGGAGAAATACAAATGGAGGG - Intergenic
974852476 4:67420632-67420654 AACTGTGCAATTAAAATTGAGGG + Intergenic
975114394 4:70663132-70663154 AATGTTGACATTCAAAGTTAAGG - Intronic
976167303 4:82269607-82269629 AATTGTGAAACTCAACATGATGG - Intergenic
978489058 4:109291391-109291413 TATATTGAAATTTAAATTGATGG - Intronic
979336429 4:119468459-119468481 AATGTTGCAATTAAAAATGAAGG + Intergenic
980186509 4:129468538-129468560 AATGATGATAATGAAATTGATGG - Intergenic
980305032 4:131049432-131049454 TTTGGTTAAATTCAAATTTATGG - Intergenic
980748109 4:137048075-137048097 AATAGAGAAATTAAAAGTGAAGG - Intergenic
981134916 4:141199702-141199724 AATGGGGATTTTCAGATTGACGG + Intronic
981467418 4:145089429-145089451 AATGTTGAAAAACAAATTTAGGG - Intronic
982153531 4:152492031-152492053 AATGGTGATATTCAACTGGGAGG - Intronic
982424011 4:155235445-155235467 AATGATGAAAATAAAAATGAGGG - Intergenic
982990333 4:162265610-162265632 AATGGTTGAATACAAATTGTTGG + Intergenic
983205636 4:164908103-164908125 AAGGGTGAAAGCCAAATTGCAGG + Intergenic
983239335 4:165213801-165213823 AATGTTGCAATTAAAAATGAAGG + Intronic
984367542 4:178818422-178818444 AGGGCTGAAATTCAAACTGAAGG - Intergenic
984386697 4:179069209-179069231 AATGCTGAAGTTAAGATTGAAGG + Intergenic
984711245 4:182887221-182887243 AGTGGTGAAATTCATACAGAAGG + Intergenic
985469594 5:31278-31300 AACTTTGAAATTCAATTTGAGGG + Intergenic
987012443 5:13781400-13781422 AGTGTTCAAATTTAAATTGAAGG + Intronic
988070486 5:26282322-26282344 TATGCTGAAATTCAAATTGAGGG + Intergenic
988144255 5:27283867-27283889 AAAGATGAAAGTAAAATTGATGG + Intergenic
988960650 5:36368007-36368029 AATGTTGAAACTCAAATGTAGGG - Intergenic
989295373 5:39819299-39819321 CACTGTGAAATTCAAGTTGAAGG - Intergenic
990100486 5:52179137-52179159 AAAGTTTAAATTCATATTGAAGG - Intergenic
990146849 5:52770690-52770712 AATGTTGTAATTAAAAATGATGG + Intergenic
990943519 5:61227581-61227603 CATGGTGAAGTTCATATTTAGGG - Intergenic
991038034 5:62147603-62147625 AAGACTGAAATTCAAATTGGAGG + Intergenic
991525596 5:67554180-67554202 AGTGGTAAAATTCTAATTCAAGG - Intergenic
993010564 5:82477803-82477825 AATTTTTAAATTTAAATTGAAGG + Intergenic
993702474 5:91134813-91134835 AGTGGTGAAATTTAAAGTCAAGG + Intronic
994058745 5:95449522-95449544 AAGGGGGAACTTCAAATTAATGG + Intronic
994898550 5:105739242-105739264 AATGGACAAACCCAAATTGAGGG + Intergenic
994910733 5:105902676-105902698 ATTGCTCAAAATCAAATTGAAGG + Intergenic
995903679 5:117098221-117098243 AATTGTGAAAATCCCATTGATGG - Intergenic
996139144 5:119884132-119884154 AATGGTGAAATATAAAGTTAAGG + Intergenic
996433392 5:123405634-123405656 AATGGTGAAGTTCAGATCCAAGG + Intronic
996931081 5:128888439-128888461 AGTAGTGAATTTCAACTTGAGGG + Intronic
997911066 5:137874111-137874133 AATGGTAAAATACTCATTGAGGG + Intronic
998722790 5:144973922-144973944 AATGGTGAAGTTTTAATTTAGGG - Intergenic
998780390 5:145650186-145650208 AATGGTGAAAATAGAATTCAGGG - Intronic
999444265 5:151626678-151626700 AATGGTGGAAGCCAAATTGTTGG + Intergenic
1000896853 5:166865687-166865709 AAATGTGCAGTTCAAATTGAAGG + Intergenic
1001160989 5:169312811-169312833 CATTGTGAAATTTAAATTGTTGG - Intergenic
1003576381 6:7299931-7299953 AATAGAGGAATGCAAATTGAAGG - Intronic
1004425138 6:15502055-15502077 AATGGTGAGATTCATTTTGATGG - Intronic
1004835280 6:19523966-19523988 AATGGTTAAATTCAAACTACAGG + Intergenic
1008014177 6:46499864-46499886 AGTTGTGAAATTGAAAATGAGGG + Intergenic
1008124756 6:47655676-47655698 AATGCTGAGATTAAAATTAAGGG + Intergenic
1008598103 6:53063599-53063621 AATTTTGAAATTTAAATTGGGGG - Intronic
1009668693 6:66716857-66716879 ATTAGTGAAATACAAATTAAAGG + Intergenic
1010549742 6:77206754-77206776 AAAGGAGAAAGTCAAATTGAAGG - Intergenic
1010741924 6:79517217-79517239 AACGGTACAAGTCAAATTGAAGG + Intronic
1012355299 6:98307190-98307212 AAAGGTGAAATAAAGATTGAGGG - Intergenic
1012743467 6:103052231-103052253 AATGCTGAATTTCAAGTTGCTGG - Intergenic
1012810884 6:103956612-103956634 AATGGTGAAATGCAAATATAGGG - Intergenic
1013568829 6:111399447-111399469 ACTGGTGACATTCAAATAAAAGG - Intronic
1013953690 6:115816402-115816424 AATGGTGTAATTCAGTCTGAAGG + Intergenic
1014045476 6:116880198-116880220 AATGGTGAAATTGAAGATGATGG - Intronic
1014908378 6:127058699-127058721 CATGATGAACTTAAAATTGAAGG - Intergenic
1015408924 6:132869930-132869952 AATGGGGAAAGAGAAATTGAAGG - Intergenic
1015431589 6:133136693-133136715 AACTGTAAAATTCAAACTGATGG - Intergenic
1016173038 6:141042774-141042796 AATGGACAAAGACAAATTGAAGG - Intergenic
1016726571 6:147376889-147376911 AAAGGTGAAATTTAAAAAGATGG + Intronic
1017170622 6:151451247-151451269 AATGGAGAAATGCAAAGTGGAGG - Intronic
1018336096 6:162791712-162791734 AATGGTGAAATTCAAATTGATGG - Intronic
1019263966 7:101925-101947 AATGGTGCAATTGAAATTCCAGG - Intergenic
1020217648 7:6206963-6206985 AATGGTTTACTTAAAATTGATGG - Intronic
1020438593 7:8192981-8193003 AATGGTTAAATTCAAATTTGAGG - Intronic
1020459344 7:8411236-8411258 ATTAGGCAAATTCAAATTGAAGG + Intergenic
1020582881 7:10027869-10027891 TATATTGAAATTCAGATTGAAGG - Intergenic
1020704272 7:11524098-11524120 AATAAAGAAATACAAATTGATGG - Intronic
1021045629 7:15919464-15919486 AAAGGTGAAATACAAATCTATGG - Intergenic
1021539126 7:21737430-21737452 AATGCTGAGATGCAAACTGAGGG + Intronic
1022602844 7:31778044-31778066 ATTGTTAAAATTCAAATTGCTGG - Intronic
1023760942 7:43464727-43464749 AAGGGGGAAATTAAAATTGGTGG - Intronic
1024435328 7:49346461-49346483 AATGGTGAAATACTGATTAAAGG + Intergenic
1024879464 7:54069204-54069226 ATCAGGGAAATTCAAATTGAGGG + Intergenic
1025151674 7:56559505-56559527 ACTGTTGAAAGACAAATTGAGGG - Intergenic
1025736302 7:64150117-64150139 ACTGTTGAAAGACAAATTGAGGG + Intronic
1025924763 7:65948624-65948646 AATAGGGAAATTCAAATATAGGG + Intronic
1025932121 7:66003981-66004003 AATAGGGAAATTCAAATATAGGG + Intergenic
1026494279 7:70888971-70888993 AGTGGTGACATTCAAATTAGAGG + Intergenic
1027148745 7:75717173-75717195 CATGATGAAATTGATATTGATGG + Intronic
1027449826 7:78318493-78318515 ATTGGTGTAACTCAAAGTGATGG + Intronic
1027535541 7:79395631-79395653 AATGGTTCAATGTAAATTGATGG - Intronic
1027847898 7:83407330-83407352 AATGGTGAAAGTTAAACTTAAGG - Intronic
1027909827 7:84236136-84236158 AGTGGTGCACTTAAAATTGAAGG - Intronic
1028720579 7:94026407-94026429 AATGGTCACTTTAAAATTGAAGG + Intergenic
1030237761 7:107285297-107285319 AATAGTGACATTTAAATAGATGG - Intronic
1030859705 7:114609856-114609878 GAATGTGAAATTCAAATAGAAGG - Intronic
1031212186 7:118844709-118844731 CATGGTAAAATTCACAATGAAGG - Intergenic
1031292954 7:119961906-119961928 AATTATGCAATTCAAATTAATGG - Intergenic
1031526724 7:122831016-122831038 AATGGAGAAATTAAAATTTAGGG + Intronic
1032245749 7:130210320-130210342 AATGAAGAAGTTCAAAGTGAAGG - Intronic
1032424142 7:131806889-131806911 AATGGAGAAATCCAAAGAGAGGG + Intergenic
1032572851 7:133019375-133019397 AATGGTGAAATTTACAGGGATGG - Intronic
1033435838 7:141332986-141333008 AATGGTGGATTCCAAATGGATGG - Intronic
1033517454 7:142122132-142122154 AATGGTGAAATTTAAGTGGGAGG - Intronic
1033587723 7:142786842-142786864 CAAGGTGAAAATCACATTGAAGG - Intergenic
1033820909 7:145133157-145133179 AATATTCATATTCAAATTGATGG + Intergenic
1033842714 7:145394949-145394971 AATTGTGAACTTAAAACTGATGG - Intergenic
1035818243 8:2563254-2563276 AATTGTGAAAATCCCATTGAAGG - Intergenic
1036258741 8:7224326-7224348 AATGCTGAGATTCAAATTCAGGG + Intergenic
1036307877 8:7615184-7615206 AATGCTGAGATTCAAATTCAGGG - Intergenic
1036310799 8:7682922-7682944 AATGCTGAGATTCAAATTCAGGG + Intergenic
1036358732 8:8063185-8063207 AATGCTGAGATTCAAATTCAGGG - Intergenic
1036830691 8:12017442-12017464 AATGCTGAGATTCAAATTCAGGG + Intergenic
1036892227 8:12603767-12603789 AATGCTGAGATTCAAATTCAGGG + Intergenic
1036899772 8:12661743-12661765 AATGTTGAGATTCAAATTCAGGG + Intergenic
1036977811 8:13434375-13434397 AATGGAGAAACTCAAATTACTGG - Intronic
1037997735 8:23365732-23365754 AAAGGTGAAATGGAGATTGAAGG - Intronic
1038220983 8:25607575-25607597 AAGGCTGATTTTCAAATTGATGG - Intergenic
1039378630 8:37063190-37063212 AATGGGGAAATTCAAGGAGAGGG + Intergenic
1039669117 8:39576669-39576691 GATGGTGAGATTCTGATTGAAGG - Intergenic
1039864018 8:41485263-41485285 GATGGTGAAATTTAAATGGAAGG + Intergenic
1041554411 8:59136544-59136566 AAAGGTGAAATGCAAATAAATGG + Intergenic
1042422889 8:68613173-68613195 ATTGTTGAAATTAAACTTGATGG + Intronic
1042748409 8:72132781-72132803 AGTGGTGAAATTCAAGCTAAAGG + Intergenic
1042830643 8:73024447-73024469 AATGGTGAATTCTAAATTCAGGG + Intronic
1042834287 8:73064085-73064107 ATTTGTGAAATTGAAAATGAAGG - Intergenic
1045056536 8:98373010-98373032 CATGGTGAAATTCCATTTCAGGG - Intergenic
1045696085 8:104810375-104810397 TATGCTGCAATTCAAAGTGAAGG + Intronic
1046041080 8:108905796-108905818 AATGATTAAAATCAAATAGATGG + Intergenic
1046699286 8:117382012-117382034 AAAGGTGAGATTCACATTCAGGG - Intergenic
1047146862 8:122210442-122210464 AATGGTGGAATTAGAATTGCAGG + Intergenic
1048100155 8:131342328-131342350 AATGATGAGATTCAGTTTGAGGG - Intergenic
1048212909 8:132470878-132470900 AATAGACAAATTCAAATTGTGGG - Intronic
1048652826 8:136498364-136498386 AATGTTGAAATTTAGATTGTGGG + Intergenic
1050005439 9:1124848-1124870 CATGGGGCAATTCAAATTTAAGG + Intergenic
1050961327 9:11736832-11736854 AATGGAGATTTTCAAATTGTTGG - Intergenic
1051530452 9:18096354-18096376 AATGTTGAAATAAAAATTGCTGG - Intergenic
1051713740 9:19959869-19959891 AATGGAGAAAGTAAAATTCAGGG + Intergenic
1055678042 9:78685851-78685873 GATGGTTAAATTAAAATAGAAGG - Intergenic
1055751927 9:79515963-79515985 AAAAGTTAAATTCAAATGGAAGG - Intergenic
1056724191 9:89098126-89098148 AATAGGCAAATTAAAATTGAGGG + Intronic
1057900794 9:98946413-98946435 AATTGTGACATTCAGATTGTGGG - Intronic
1057974062 9:99585005-99585027 AATGATGAAATAAAAATTTAAGG + Intergenic
1058352587 9:104043502-104043524 AATGAAGAAATTCAAATCTAAGG - Intergenic
1058932375 9:109733698-109733720 AATGCTGTGATTAAAATTGAGGG - Intronic
1059827608 9:118049518-118049540 AAAGGTGAAGTTCAACTTAAAGG - Intergenic
1061286967 9:129629292-129629314 CATGGTGACATTCAGATTGGTGG + Intronic
1061696634 9:132380731-132380753 AATGGTAAAAATTATATTGAAGG - Intronic
1187417234 X:19103884-19103906 AATGGGGAATTTCAAATACAAGG + Intronic
1188654697 X:32678110-32678132 AATGGGGAAATGCTAATTAATGG + Intronic
1188935190 X:36167164-36167186 TATGGTGAAATACAATTGGATGG - Intergenic
1189576817 X:42362657-42362679 CATGATGAAATTCAAATTATGGG - Intergenic
1190471090 X:50780345-50780367 AATTGGAAAATTCAAATTTAAGG + Intronic
1192441220 X:71175748-71175770 AATTTTGAAATTCAAGTTGGGGG - Intergenic
1193076220 X:77358998-77359020 AATGGTGAGAAGCAAAATGAGGG - Intergenic
1193530031 X:82645130-82645152 AATGCTCAAACTCAAATTGAAGG - Intergenic
1194448457 X:94014351-94014373 TTTGGTAAAAGTCAAATTGAAGG - Intergenic
1196569570 X:117249652-117249674 AATGATGAAATTTTCATTGAGGG + Intergenic
1196692849 X:118579285-118579307 AATTGTGAAATTCAAATGTTTGG + Intronic
1196816976 X:119672829-119672851 AATGCTGAAAGTCTAACTGATGG - Intronic
1197031349 X:121819802-121819824 CATGAGGAAATTCAAGTTGATGG - Intergenic
1197282360 X:124552179-124552201 AATAGTGAAAATAAAATGGAAGG + Intronic
1197655424 X:129111618-129111640 TATGGTGAAATTGAACCTGAGGG + Intergenic
1197854686 X:130902625-130902647 AAACCTGAAATACAAATTGAGGG + Intronic
1198423471 X:136492092-136492114 AATGGTGAAAATGAAATGCATGG - Exonic
1198930342 X:141851160-141851182 AATGGTTAAATTGGAAGTGATGG - Intronic
1200697700 Y:6375633-6375655 AATGGTGAGATTCATTGTGAGGG + Intergenic
1201036412 Y:9789066-9789088 AATGGTGAGATTCATTGTGAGGG - Intergenic
1201582993 Y:15530884-15530906 AATGGTGTACCTCAAAGTGATGG - Intergenic