ID: 1018336097

View in Genome Browser
Species Human (GRCh38)
Location 6:162791730-162791752
Sequence AGAATGCAGTAAGTACTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 255}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018336097_1018336104 24 Left 1018336097 6:162791730-162791752 CCATTCAGTACTTACTGCATTCT 0: 1
1: 1
2: 1
3: 19
4: 255
Right 1018336104 6:162791777-162791799 GGTAATGTGTAGTTTTAAACAGG No data
1018336097_1018336103 3 Left 1018336097 6:162791730-162791752 CCATTCAGTACTTACTGCATTCT 0: 1
1: 1
2: 1
3: 19
4: 255
Right 1018336103 6:162791756-162791778 AGGAGGATGGGGAATGCAGAAGG No data
1018336097_1018336105 25 Left 1018336097 6:162791730-162791752 CCATTCAGTACTTACTGCATTCT 0: 1
1: 1
2: 1
3: 19
4: 255
Right 1018336105 6:162791778-162791800 GTAATGTGTAGTTTTAAACAGGG 0: 1
1: 0
2: 2
3: 19
4: 253
1018336097_1018336101 -9 Left 1018336097 6:162791730-162791752 CCATTCAGTACTTACTGCATTCT 0: 1
1: 1
2: 1
3: 19
4: 255
Right 1018336101 6:162791744-162791766 CTGCATTCTAGAAGGAGGATGGG No data
1018336097_1018336102 -8 Left 1018336097 6:162791730-162791752 CCATTCAGTACTTACTGCATTCT 0: 1
1: 1
2: 1
3: 19
4: 255
Right 1018336102 6:162791745-162791767 TGCATTCTAGAAGGAGGATGGGG 0: 1
1: 0
2: 2
3: 22
4: 292
1018336097_1018336100 -10 Left 1018336097 6:162791730-162791752 CCATTCAGTACTTACTGCATTCT 0: 1
1: 1
2: 1
3: 19
4: 255
Right 1018336100 6:162791743-162791765 ACTGCATTCTAGAAGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018336097 Original CRISPR AGAATGCAGTAAGTACTGAA TGG (reversed) Intronic
901149103 1:7088539-7088561 AGAAGGCAGTAAGTAGTGCCAGG + Intronic
904814360 1:33183787-33183809 AGGATGCAGCAAATACAGAAGGG + Intergenic
908374815 1:63524523-63524545 GGAATGCAATGAGTCCTGAAGGG + Intronic
910190558 1:84590610-84590632 AGAAAGCAGTAAATATGGAAAGG + Intergenic
911417101 1:97588620-97588642 AGCTTGCAGAAAGTACTGGAGGG + Intronic
912031469 1:105249961-105249983 AAAATGGATTAAATACTGAAAGG - Intergenic
912259249 1:108092936-108092958 AAAAGGCAGTAAGTAGTGAGAGG - Intergenic
913239037 1:116812101-116812123 AAAATTCAGCAAGTACTCAAAGG + Intergenic
914447493 1:147762171-147762193 AGAAAGCAGAAAGTAGAGAAAGG + Intronic
915688659 1:157663619-157663641 AGGAAGCACTAAGTACAGAAAGG + Intergenic
915835867 1:159174023-159174045 GGAAAGCAGTAACTTCTGAATGG + Intronic
915958243 1:160241518-160241540 AGAATGCAGTATGTAGTTATAGG - Intronic
916458102 1:164991899-164991921 AGCATCCAGCAAGGACTGAATGG + Intergenic
917127544 1:171701138-171701160 AGAATGTAGTAAGGGCTGAAAGG - Exonic
918097724 1:181348636-181348658 AGTGTGCAGTAAATACTAAAAGG - Intergenic
922991228 1:229913595-229913617 AAAATGGAGTAAGTACTCATGGG + Intergenic
1064237829 10:13592819-13592841 AAGATGCAGTAAATACTGGAAGG - Intronic
1065366024 10:24937851-24937873 AGAATTCAGTAAATACTGCCAGG - Intronic
1066116137 10:32241994-32242016 CAAAGGCAGTAAGTACTGAGGGG - Intergenic
1066356584 10:34690496-34690518 ATAATGTAGTAAGGCCTGAAGGG - Intronic
1067416265 10:46105882-46105904 AGAATTCTTCAAGTACTGAAAGG - Intergenic
1067436410 10:46282375-46282397 AGAATTCTTCAAGTACTGAAAGG - Intergenic
1068674584 10:59757616-59757638 AGAATGCAGGAAATCCTGGATGG - Intergenic
1069307454 10:66988675-66988697 AGACTGCAGAATGTTCTGAAAGG - Intronic
1070404788 10:76085319-76085341 GGAAAGCAGTAAATGCTGAAGGG + Intronic
1071050078 10:81436792-81436814 AGAATGCAGCAAGTCCAAAATGG + Intergenic
1071350788 10:84741871-84741893 AGAATGCAGAAAATAGAGAATGG - Intergenic
1071401570 10:85278532-85278554 AGGAAGCAGTAAATACAGAAGGG - Intergenic
1071512374 10:86270227-86270249 AGGCTGCAGTGGGTACTGAATGG - Intronic
1072782598 10:98260717-98260739 AGAGTTCAGTGAGTACTGACTGG - Intronic
1073098486 10:100995083-100995105 AGAATGCAATATGTTCTGAGGGG + Intergenic
1073552488 10:104415920-104415942 AGCATACAGTAAGCACTCAAAGG - Intronic
1073674971 10:105635786-105635808 TCAATGCAGTAAGTACACAAAGG + Intergenic
1074622525 10:115140061-115140083 AGCATGCAGTACCTACTGAAAGG - Intronic
1074899202 10:117802108-117802130 AGGCTGCAGTGAGCACTGAATGG + Intergenic
1076777558 10:132706561-132706583 AGAATGCAGTGTGTACGGGAAGG + Intronic
1078059726 11:8035463-8035485 AGTAGGCAGTAAGAGCTGAAGGG - Intronic
1078363070 11:10685046-10685068 AGAAGGCAGAAAGTTCTGAGGGG - Intronic
1078476413 11:11633995-11634017 GGAATGCAGTGAGTGTTGAAGGG - Intergenic
1080619445 11:33974855-33974877 AGAAGGCAGAAAGAACTTAAAGG - Intergenic
1086891619 11:92265345-92265367 GGAACGCAGTCAATACTGAAGGG - Intergenic
1088012740 11:105022535-105022557 AGTGTGCAGTATGGACTGAAGGG + Intronic
1088378268 11:109165608-109165630 AGAAGGCAGTACATACAGAAAGG + Intergenic
1090817375 11:130310646-130310668 AGAATGTAGTAGATACTAAAAGG + Intronic
1091805885 12:3355466-3355488 TGAATTCAGTAAGTACTGGCTGG + Intergenic
1092547171 12:9462189-9462211 GGTAGGCAGTCAGTACTGAATGG + Intergenic
1093375264 12:18418475-18418497 AGATTGCAGTGTGTACTAAAGGG + Intronic
1094181263 12:27594573-27594595 ACAATGAAGTAAGTTTTGAAAGG - Intronic
1094287170 12:28808783-28808805 AGAAAGCAGTAAGTAGATAAGGG - Intergenic
1094505768 12:31059875-31059897 AGTAGGCAGTCAGTACTGAATGG - Intergenic
1095616200 12:44192305-44192327 AGCATCCAGTAGGTCCTGAAAGG - Intronic
1097125361 12:56770276-56770298 AGAAGGCAGTAAGTAGCGAGAGG - Intronic
1100311784 12:93402405-93402427 ACAATGCACTATGCACTGAAAGG - Exonic
1102102693 12:110292976-110292998 AGTCTGTAGTAAGCACTGAAGGG - Intronic
1102376090 12:112422122-112422144 AGAATGCAGTTAGTTTTGATAGG + Intronic
1102434686 12:112911696-112911718 AGAAAGCAGAAAGAACAGAAAGG - Intronic
1103294759 12:119876950-119876972 ATAATGCAGTTAGTGCTGACAGG + Intronic
1105728150 13:23186107-23186129 AGAATGAAGCAAATGCTGAATGG - Intronic
1112405983 13:99120486-99120508 AGTCTGCATTAAGTACTGAGAGG - Intergenic
1113310744 13:109129746-109129768 AAATTGCAGCAAGTACAGAATGG + Intronic
1115136846 14:30120379-30120401 AGCATGCAGTATTTACTCAAAGG - Intronic
1115207701 14:30928755-30928777 AGAAAGCAGAAACTACAGAAAGG + Intronic
1115295163 14:31817656-31817678 AGGATGCAGTAAATATGGAAAGG + Intronic
1116044166 14:39722417-39722439 AGAAAGCAATAAGCACTGCATGG - Intergenic
1116986711 14:51227668-51227690 AGAATGGATAAAGTAATGAAAGG + Intergenic
1117255303 14:53971222-53971244 AGTATTCAATAAGTATTGAATGG - Intergenic
1117424906 14:55583951-55583973 TGGAAGCAGTAAGTACTGATTGG - Intronic
1119904772 14:78291633-78291655 AGAACTCAGTAGATACTGAAGGG - Intronic
1121010230 14:90516017-90516039 CAAATGCAGTAAGTGCTGAACGG + Intergenic
1124091173 15:26602756-26602778 CAAAAGCAGTAAGTACTAAAAGG + Intronic
1125376209 15:39032439-39032461 AGAAATCAGGAAGAACTGAAAGG + Intergenic
1127341264 15:58046799-58046821 AAAATGCAGTAGGTGCTCAAAGG + Intronic
1127341826 15:58053990-58054012 AGAATTTAGTAATTACTTAATGG - Intronic
1128442191 15:67721246-67721268 AGAATGCAGAACCTTCTGAATGG + Intronic
1128463825 15:67891765-67891787 AGAATGGAGGAAGTAGGGAAGGG + Intergenic
1132015288 15:98309808-98309830 GGAATGCAGTAAAAACTGAAAGG - Intergenic
1132236447 15:100225495-100225517 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236457 15:100225597-100225619 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236460 15:100225631-100225653 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236464 15:100225666-100225688 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236483 15:100225838-100225860 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236487 15:100225872-100225894 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236490 15:100225906-100225928 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236503 15:100226043-100226065 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236507 15:100226078-100226100 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236510 15:100226112-100226134 TGACTGCTGTAAGGACTGAATGG - Intronic
1132236515 15:100226147-100226169 TGACTGCTGTAAGGACTGAATGG - Intronic
1133254189 16:4506528-4506550 AGAAGCCAGCAAATACTGAAGGG + Intronic
1134252171 16:12582071-12582093 AGCATACAGTAAGTGCTCAATGG + Intergenic
1134409568 16:13992839-13992861 AGAATGAAATCAGTACTGAGAGG - Intergenic
1136954044 16:34759097-34759119 TGAATGCAGTAATTATTGAATGG - Intergenic
1136954552 16:34766000-34766022 AGAATGCAGTTAATATCGAATGG - Intergenic
1136966274 16:34914651-34914673 TGAATGCAGTAATCATTGAATGG - Intergenic
1137114494 16:36608105-36608127 AGAATGCTGTATGAACAGAAAGG - Intergenic
1137136065 16:36965585-36965607 AGAATGCTGTATGTAAAGAAAGG - Intergenic
1137158425 16:37335131-37335153 AGAATGCTGTATGAACAGAAAGG - Intergenic
1137173265 16:37580746-37580768 AGAATGCTGTATGAACAGAAAGG - Intergenic
1137174454 16:37600450-37600472 AGAATGCTGTATGAACAGAAAGG - Intergenic
1137185283 16:37779455-37779477 AGAATGCTGTATGTAAAGAAAGG - Intergenic
1137195925 16:37955883-37955905 AGAATGCTGTATGTAAAGAAAGG + Intergenic
1137197433 16:37980523-37980545 AGAATGCTGTATGAACAGAAAGG - Intergenic
1138138235 16:54543389-54543411 AGAATGCTGTGATTACTTAATGG - Intergenic
1138988731 16:62363695-62363717 AGAAAGCCTTCAGTACTGAAAGG + Intergenic
1139673850 16:68509713-68509735 AGAATGCAGCCAGAAATGAAGGG - Intergenic
1141888311 16:86908572-86908594 AGGATGCAGTAAGTGCAGAGAGG - Intergenic
1142149535 16:88506479-88506501 ATAATCCAGAAAGGACTGAATGG + Intronic
1142298052 16:89240152-89240174 AAAATGCAGTTTGTAATGAAAGG + Intergenic
1203141444 16_KI270728v1_random:1769857-1769879 AAAGTGCTGAAAGTACTGAAGGG - Intergenic
1146390225 17:32415359-32415381 AGAATGCAGTAGGAAAGGAAAGG + Intergenic
1146892148 17:36513179-36513201 AGAATGCAGTAAGTGATCCATGG - Intronic
1149539454 17:57457843-57457865 AGAATGCAGTGAGTTATGATTGG + Intronic
1153119284 18:1701642-1701664 AGAAAGCACTAAGTATGGAAAGG + Intergenic
1153296080 18:3548098-3548120 GGAATGCAGTGAGTACTAATGGG + Intronic
1157440813 18:47710344-47710366 ATGATGCAGTCAGTACTCAAGGG + Intergenic
1159335888 18:67065541-67065563 ATAATGCAAAAAGTTCTGAAAGG + Intergenic
1159565533 18:70043827-70043849 AGTCTGCAGTAAGTACTGTATGG - Intronic
1161405510 19:4089259-4089281 AGTCTCCAGGAAGTACTGAAGGG + Intergenic
1167144005 19:47671530-47671552 AGGGTGCAGGAAGTAATGAAGGG + Intronic
925566386 2:5258622-5258644 AGGAAGCAGTAAATACAGAAAGG + Intergenic
926058123 2:9788289-9788311 AGAACTCAGTAATTACTGCAAGG - Intergenic
926292257 2:11540461-11540483 CGATTGCAGTAAGAACTGAATGG - Intronic
926396839 2:12451993-12452015 AGAATGCAGTTACTACAGAACGG - Intergenic
928650888 2:33402561-33402583 AAATTGCAGTAACTTCTGAAAGG - Intergenic
931991159 2:67791787-67791809 AAAATGCAGTAGATACTGTAGGG + Intergenic
932344006 2:70984092-70984114 AGAAAGCAGAAAGGACTGGATGG - Intronic
933985586 2:87589485-87589507 AGAATGCAGTATGAATAGAAGGG + Intergenic
935559320 2:104544235-104544257 AGAATGAAGTGAGTACTTCAAGG - Intergenic
936308257 2:111361315-111361337 AGAATGCAGTATGAATAGAAGGG - Intergenic
936756253 2:115716208-115716230 AAAATGCAGTTAGAACTGAAGGG + Intronic
937860875 2:126707950-126707972 AGAACTCTGTTAGTACTGAATGG + Intergenic
940413251 2:153390705-153390727 TGACTGCAGTAACTACTGAATGG - Intergenic
944275328 2:197831012-197831034 AGGAAGCAGTAAATACGGAAAGG + Intronic
945270058 2:207929068-207929090 GGTGTTCAGTAAGTACTGAATGG - Intronic
946674546 2:222144848-222144870 TGAATGCAGTAAGTAGAGGAGGG - Intergenic
948106367 2:235417414-235417436 AGAATGCAGATAGAACAGAATGG + Intergenic
1172635527 20:36407363-36407385 ACAATGCAGGAAGAAGTGAATGG - Intronic
1177544736 21:22542142-22542164 AGAAAGAAGTAAGTACTTTATGG + Intergenic
1180529882 22:16340829-16340851 AGAATGCAGTCATTATCGAATGG - Intergenic
1181378404 22:22479308-22479330 AGAATGCTGAAAGTGCTGATTGG + Intergenic
1182834982 22:33334609-33334631 AGAATGTAGAAAGCACAGAAAGG + Intronic
1182855852 22:33516923-33516945 AGACAGTAGTAAGTACTCAAGGG + Intronic
1203319766 22_KI270737v1_random:44982-45004 AGAATGCAGTCATTATCGAATGG + Intergenic
1202726716 2_KI270716v1_random:7309-7331 TGAATGCAGTAATCATTGAATGG - Intergenic
949112032 3:272806-272828 GGAGTTCAGTAAGTACTGGATGG - Intronic
949195076 3:1295543-1295565 TGAATGCAGTAAGGACAGTATGG + Intronic
949685904 3:6570465-6570487 AAAATGCAGGAAGGAATGAAAGG - Intergenic
949715756 3:6929400-6929422 AGAATCCAGAAACTAGTGAAAGG + Intronic
950238052 3:11341007-11341029 ACAATGCATAAAGGACTGAACGG - Intronic
951893078 3:27584919-27584941 GGCATGCAGTAAGTTCTTAATGG + Intergenic
953587888 3:44221719-44221741 AAAAGGCAGTAAGCACAGAAGGG - Intergenic
953733150 3:45467034-45467056 GAAATGCAGTAAGTACAGAATGG + Intronic
954120886 3:48499236-48499258 AGACTGCAGTAAGTCGTGATTGG - Intronic
954205301 3:49054482-49054504 AGAATGGAGTTAGTATTGAGGGG - Intronic
955734905 3:62028067-62028089 AGCATCCATTAATTACTGAAAGG + Intronic
958073413 3:88643902-88643924 AGAATGCATTAGGAACAGAATGG - Intergenic
959293888 3:104510966-104510988 AAAACCCAGTAAGTAATGAAAGG - Intergenic
959902927 3:111680118-111680140 AGAAATCACTAAGTACTCAAGGG - Intronic
960179349 3:114556596-114556618 AAAATACACTAAGTAATGAATGG + Intronic
960616312 3:119599219-119599241 GGAATGCTGTAAGGACTGAATGG + Intronic
960818171 3:121695696-121695718 AGATTGCAGAAAGTACTGAGTGG - Exonic
961030816 3:123601985-123602007 AGAATGTAGTGACTACAGAAAGG + Intergenic
961075679 3:123979721-123979743 AGAATGCAGTGTGTACTGTGCGG + Intronic
961308005 3:125972787-125972809 AGAATGCAGTGTGTACTGTGAGG - Intronic
963668493 3:148221629-148221651 AGAATGCACTAGGAAATGAAAGG - Intergenic
963759943 3:149277869-149277891 AGAATACAATAAGTAAGGAAAGG + Intergenic
966270699 3:178101568-178101590 AGAGTGCAGTGGGTAATGAATGG + Intergenic
967327712 3:188258684-188258706 AAAAAAAAGTAAGTACTGAAGGG + Intronic
1202737245 3_GL000221v1_random:16836-16858 GGAATGGAGTAATTACAGAAGGG + Intergenic
971624030 4:28895579-28895601 AGAAAGCAGTAAATATGGAAAGG + Intergenic
971922878 4:32966032-32966054 AGCATGAGGTAAGGACTGAAGGG + Intergenic
972320095 4:37965455-37965477 GGCATGCAGTAAGTACTCAGCGG + Intronic
973902800 4:55495040-55495062 AGGTTGCTGTAAATACTGAAAGG - Intronic
975480405 4:74873136-74873158 GGAATTCAGTAAGTCCTCAAAGG - Intergenic
976397114 4:84568034-84568056 AGAATTCAGTAAGTATAAAAAGG + Intergenic
976764868 4:88589594-88589616 AGAATGCAGAAAGAAATGGATGG + Intronic
977027504 4:91837919-91837941 AGATAGCAGTAAGTACTCTAGGG + Intergenic
978674924 4:111301268-111301290 TGAATGAACTAGGTACTGAAGGG - Intergenic
980772484 4:137394988-137395010 AGTATGCAGAAAGTATTAAAAGG + Intergenic
981072020 4:140552243-140552265 AGAATGCTTTAAGTAAAGAAGGG + Exonic
982811192 4:159827693-159827715 TTAATGCAGTAAATACTCAAGGG + Intergenic
982906189 4:161076617-161076639 TCAATGCAGCAAGTACTGAGTGG + Intergenic
984127528 4:175830741-175830763 TGAAATCAGTAAGTACAGAATGG - Intronic
984265424 4:177492908-177492930 AGAATGAAAGATGTACTGAACGG + Intergenic
984733611 4:183090416-183090438 GGAATGCAGTTAGTATTGATAGG + Intergenic
987214533 5:15719972-15719994 AGGATGCAGTAGCTACTGATAGG - Intronic
987720199 5:21623602-21623624 AGAATGCAGCAAGAATTGATTGG - Intergenic
988435188 5:31165870-31165892 AGAATGCAGGAATGAATGAATGG - Intergenic
989319441 5:40118262-40118284 AGAACGCAGCAAGTATTGATGGG + Intergenic
991646845 5:68808764-68808786 GGAAAACAGTATGTACTGAAAGG - Intergenic
992270443 5:75057288-75057310 ACAATGCAATAAATACTGGAAGG - Intergenic
992361812 5:76046352-76046374 AGAAAGCAGTGAATTCTGAAGGG + Intergenic
995456164 5:112354373-112354395 ATAATGCAATAAGTAATAAAGGG + Intronic
996290033 5:121841947-121841969 AGAATGCAGAAAGAAGTCAATGG - Intergenic
996420509 5:123257275-123257297 AGGAAGCAGTAAATACGGAAAGG - Intergenic
997752806 5:136364922-136364944 AGAAAGCTGTCAGTAGTGAAGGG + Intronic
1000913040 5:167045368-167045390 AGAATGTACTAGGTACTAAATGG - Intergenic
1001368373 5:171168888-171168910 AGAAGGCAGGAAGGGCTGAACGG - Intronic
1001732913 5:173973392-173973414 AGAATGCAGGAAGGGCTGATTGG - Intergenic
1003097105 6:3150984-3151006 AGAGTGCAGACAGTGCTGAACGG + Intronic
1003182382 6:3803101-3803123 AGATTGTAGCAAATACTGAAAGG - Intergenic
1008594096 6:53023900-53023922 AGAACCCAGTAAATACAGAAGGG + Intronic
1009550254 6:65082443-65082465 ACAATGAGGTAAGTACTAAAAGG + Intronic
1010079069 6:71836440-71836462 AGAAAGCAGTAAATTCTGACTGG + Intergenic
1010907591 6:81510881-81510903 ATAATGGATTAAGTACTTAAAGG - Intronic
1012538713 6:100333104-100333126 AGAATGCAGAAAATAATTAATGG - Intergenic
1012844595 6:104373933-104373955 TGAATGCAGGAAGCATTGAATGG - Intergenic
1014064871 6:117112537-117112559 AGGAAGCACTAAGTACGGAAAGG + Intergenic
1014408127 6:121077465-121077487 AGAATACAGTAAGCAAGGAAGGG - Intergenic
1014413200 6:121152148-121152170 AGAAAGCACTAAATATTGAAAGG - Intronic
1015153164 6:130061497-130061519 ATAATGTAATAAGTAGTGAAAGG + Intronic
1018336097 6:162791730-162791752 AGAATGCAGTAAGTACTGAATGG - Intronic
1022170600 7:27825433-27825455 AGTATGCAGTAAGCACTCTAAGG - Intronic
1024245715 7:47468483-47468505 AAATAGCAGTAACTACTGAAGGG - Intronic
1025317038 7:58044539-58044561 TGAATGCAGTAATCATTGAATGG + Intergenic
1025317232 7:58046913-58046935 CGAATGCAGTAATCATTGAATGG + Intergenic
1025476021 7:60922315-60922337 AGAATGGAGTCATTATTGAATGG - Intergenic
1025476215 7:60924862-60924884 AGAATGCAGTCATTATTGAATGG - Intergenic
1027748480 7:82109786-82109808 TGCATGCAGTAAGTAATGCAAGG - Intronic
1027763994 7:82316334-82316356 TAAAGGCAGTAAGTAATGAAAGG - Intronic
1027772336 7:82422701-82422723 ATAATGTAGTAAGGACTGCATGG + Intronic
1027985400 7:85281925-85281947 AAAATGAAGTAAATACTTAATGG + Intergenic
1028436954 7:90815082-90815104 ACAATGTAGTAAGTGCTAAAAGG - Intronic
1029602329 7:101574966-101574988 AGAAAGAAGTAAAAACTGAAAGG - Intergenic
1030192019 7:106819680-106819702 AGTAAGCAGGAAGTACTAAAGGG + Intergenic
1031678121 7:124635870-124635892 AGAATAGTTTAAGTACTGAAGGG - Intergenic
1033118908 7:138649654-138649676 AGAAAGCAGTAAGGGCTGTAAGG + Intronic
1037038732 8:14203756-14203778 AGAATGCACTTAGTATTGATGGG + Intronic
1038186636 8:25281121-25281143 AGAATGAAGAAAGAAGTGAATGG + Intronic
1039272358 8:35896947-35896969 AGAATGCAGTAAGTTCTGAATGG + Intergenic
1039816568 8:41099922-41099944 AGAATTAAGTAAGTTCTTAAAGG - Intergenic
1040794694 8:51276091-51276113 AGAATGCACTAGGTATTGTAGGG + Intergenic
1040868352 8:52073720-52073742 AAAATGCAGTATATACAGAATGG - Intergenic
1041154793 8:54974002-54974024 ATAATGCAGTAGTTGCTGAATGG - Intergenic
1041460204 8:58103131-58103153 TGAATGCAATATGTACAGAAGGG + Intronic
1042073689 8:64965022-64965044 AGAATGAAGGAAGTAATGAAAGG + Intergenic
1042572987 8:70186912-70186934 GAAATGCAGTAATTATTGAATGG - Intronic
1042880108 8:73478064-73478086 AAAATGCAGTAAGTACAGAAGGG + Intronic
1046571051 8:115966629-115966651 AGCAGGCAGGAAGTACTGGAAGG + Intergenic
1047437895 8:124849980-124850002 GGCATGCAAGAAGTACTGAATGG - Intergenic
1049401683 8:142430520-142430542 ACAAAACACTAAGTACTGAAGGG + Intergenic
1049869973 8:144966859-144966881 AGAAAGAAGTAAAAACTGAAAGG + Intergenic
1050288814 9:4131834-4131856 AGCACGCAGTAGGTACTTAATGG + Intronic
1050518521 9:6471741-6471763 AGTTTGCAGTAAGATCTGAAGGG + Intronic
1050932554 9:11348876-11348898 AGAATACAGTAAGAACTGGTAGG - Intergenic
1050934133 9:11372349-11372371 ACAATGCATAAATTACTGAAAGG - Intergenic
1051024051 9:12584984-12585006 AAAATGCAGAAATGACTGAATGG + Intergenic
1052392538 9:27897538-27897560 AAAATGCAATAAGTATGGAATGG - Intergenic
1052421005 9:28242968-28242990 AGAAAGCACTAAGTATGGAAAGG + Intronic
1054977768 9:71168390-71168412 AGACAGTAGTAAGTACTGAACGG + Intronic
1055012649 9:71583992-71584014 AGAATGCAATCAGTGCTGGAGGG - Intergenic
1056969609 9:91191412-91191434 AAAATACAGTAAATGCTGAATGG + Intergenic
1057218216 9:93241307-93241329 AGAAGGCAGTTAGTATTGCATGG + Intronic
1059820034 9:117962285-117962307 TGAATGCAGTTAGTAATGAGGGG + Intergenic
1060643456 9:125258440-125258462 AGAATGCAGTAACTATTCACAGG - Intergenic
1060873707 9:127064466-127064488 AAAAATCACTAAGTACTGAAAGG + Intronic
1062729078 9:138098479-138098501 AGCATGTAGTTAGTACTGAAGGG + Intronic
1185551747 X:987514-987536 AAAGTGCTGAAAGTACTGAAGGG + Intergenic
1185580218 X:1206275-1206297 AAGCTGCAGGAAGTACTGAAAGG + Intronic
1186093544 X:6075625-6075647 AGAATTCAGTCATTACTGCAAGG - Intronic
1187867518 X:23737521-23737543 AGAATACTGTAAATACTGAGAGG - Intronic
1189081908 X:37981925-37981947 AGAAAACAGTAAGTACTTAGAGG + Intronic
1189914847 X:45846968-45846990 AGATTGCACTAAATACTGAAGGG - Intergenic
1191638872 X:63409089-63409111 AGAAAAAAGTAAGAACTGAAAGG + Intergenic
1192294118 X:69828872-69828894 AGAAAACAGAAAGAACTGAAGGG - Intronic
1193586445 X:83327639-83327661 AGAATGTGGTAAGTAGAGAAAGG - Intergenic
1194177398 X:90667056-90667078 AGAAAGCACTAAGTATGGAAAGG + Intergenic
1194183296 X:90739245-90739267 AGAAAGCACTAAATATTGAAAGG + Intergenic
1194737505 X:97530130-97530152 TCAAGGCAGTCAGTACTGAAGGG + Intronic
1194865690 X:99063151-99063173 AGAAAGGAGTAAGTAGAGAAAGG + Intergenic
1195022498 X:100844107-100844129 AGAATGCAGCAATGACAGAATGG + Intronic
1195545744 X:106110322-106110344 AGAATGCAGCACGTTCTAAAAGG + Intergenic
1195546557 X:106118558-106118580 AAAATGCAGCAAGAAATGAATGG + Intergenic
1196082953 X:111652454-111652476 AGTATGCAGAAAGTACTGCTGGG - Intergenic
1198229126 X:134673032-134673054 AGAATCCAGTAAGTGCTAACAGG + Intronic
1200524073 Y:4249202-4249224 AGAAAGCACTAAGTATGGAAAGG + Intergenic
1200529912 Y:4321201-4321223 AGAAAGCACTAAATATTGAAAGG + Intergenic
1201593098 Y:15637109-15637131 AGAATGCAGGACCCACTGAATGG - Intergenic