ID: 1018336102

View in Genome Browser
Species Human (GRCh38)
Location 6:162791745-162791767
Sequence TGCATTCTAGAAGGAGGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018336096_1018336102 10 Left 1018336096 6:162791712-162791734 CCATCAATTTGAATTTCACCATT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1018336102 6:162791745-162791767 TGCATTCTAGAAGGAGGATGGGG 0: 1
1: 0
2: 2
3: 22
4: 292
1018336097_1018336102 -8 Left 1018336097 6:162791730-162791752 CCATTCAGTACTTACTGCATTCT 0: 1
1: 1
2: 1
3: 19
4: 255
Right 1018336102 6:162791745-162791767 TGCATTCTAGAAGGAGGATGGGG 0: 1
1: 0
2: 2
3: 22
4: 292
1018336095_1018336102 11 Left 1018336095 6:162791711-162791733 CCCATCAATTTGAATTTCACCAT 0: 1
1: 0
2: 1
3: 18
4: 294
Right 1018336102 6:162791745-162791767 TGCATTCTAGAAGGAGGATGGGG 0: 1
1: 0
2: 2
3: 22
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018336102 Original CRISPR TGCATTCTAGAAGGAGGATG GGG Intronic
901653003 1:10753759-10753781 TGCATTCAAGAAGGGCGATCCGG + Intronic
902567387 1:17321180-17321202 TGGATTCTGCAAGAAGGATGTGG + Intronic
905108216 1:35576594-35576616 TGCATTTTAGAAAGAGGTTTGGG + Intronic
907387807 1:54137276-54137298 TACATTCTAGATGGGGGAGGGGG + Intronic
907827684 1:58034801-58034823 TGGATTTTAGAAGGGGGAAGAGG - Intronic
908121712 1:60992013-60992035 TACATTCTAATAGGAGGAAGAGG - Intronic
909247154 1:73300735-73300757 GGCATTTTAGAAAGAGTATGAGG + Intergenic
909926644 1:81445486-81445508 TCCTTTGTAGAAGTAGGATGAGG + Intronic
910123227 1:83813295-83813317 TACATTCTAGAAGAAGAATTAGG + Intergenic
910465275 1:87492598-87492620 TGGAAGCCAGAAGGAGGATGGGG + Intergenic
911522346 1:98943880-98943902 TCCATTCCAAAAAGAGGATGAGG + Intronic
912119986 1:106459140-106459162 TGCTTTTCAGAAAGAGGATGGGG + Intergenic
913370087 1:118089035-118089057 TATATTCTAGTAGGAGGACGGGG + Intronic
914360101 1:146927670-146927692 TGGAAGCCAGAAGGAGGATGGGG + Intergenic
914493646 1:148172226-148172248 TGGAAGCCAGAAGGAGGATGGGG - Intergenic
915165977 1:153947991-153948013 TTCATGCTAGAAAGAGGATCTGG + Exonic
916463625 1:165050402-165050424 AGCATTCCAGGAGGAGTATGTGG + Intergenic
920250983 1:204622319-204622341 AGCATCCTGGAAGCAGGATGAGG - Intronic
922516679 1:226213060-226213082 TGCTTCCTAGAAAGAGAATGAGG - Intergenic
923651952 1:235882461-235882483 TGCATTTCAGAAAGAGAATGTGG + Intronic
924730816 1:246710143-246710165 GGCATTTTAAAGGGAGGATGAGG + Intergenic
1063040479 10:2332603-2332625 GGGATTAAAGAAGGAGGATGGGG - Intergenic
1064652841 10:17526732-17526754 TGGATGGTAGAAGGAGGAAGAGG - Intergenic
1064965516 10:21011879-21011901 TGCCTTGTAGAAGGATGCTGAGG - Intronic
1065770452 10:29073333-29073355 TGCATCTTGGAAGTAGGATGAGG + Intergenic
1067495032 10:46754037-46754059 TACACTCAAGGAGGAGGATGGGG + Intergenic
1067988921 10:51187025-51187047 TGCTTTCCAGAAAGAGGAAGTGG + Intronic
1068605381 10:58999561-58999583 TGCAGTCTGATAGGAGGATGGGG + Intergenic
1069331098 10:67294110-67294132 TTCATCCTACAAAGAGGATGAGG + Intronic
1070283321 10:75066151-75066173 AACATTCTAGAAGGAGTATGAGG + Intergenic
1070615844 10:77968695-77968717 TGCATTTTGGAGGGGGGATGGGG - Intergenic
1073590288 10:104750897-104750919 TATATTCTAGAATGAGAATGGGG + Intronic
1075343045 10:121662447-121662469 TGCATTCTAGCTGGAGGTGGAGG + Intergenic
1076135871 10:128045512-128045534 TACATTCGAGAGGGAGGAGGGGG + Intronic
1081687346 11:45052214-45052236 AGCATTTTTGAAGGAGGAAGAGG - Intergenic
1082080862 11:48011602-48011624 TGAATTTTAAAAGGAGGAAGAGG - Intronic
1082109757 11:48261454-48261476 TGCATTCTGGAAGCTGGATTTGG + Intergenic
1082861206 11:57858291-57858313 TGCCGGCTAGAAGGAGGGTGAGG + Intergenic
1083170353 11:60920688-60920710 TGTAGACTAGAAGGTGGATGTGG + Intronic
1084954812 11:72685519-72685541 TGCAGTCAGGATGGAGGATGTGG + Exonic
1087540829 11:99517353-99517375 TGCATTGTAGAAAAAGGCTGTGG - Intronic
1088060861 11:105647798-105647820 TGCAGTGTAGGAGGAGGAAGAGG + Intronic
1090731868 11:129579496-129579518 TGCATTCCACAAGAAGGATGTGG - Intergenic
1091072925 11:132586004-132586026 TGCCTTCTAGAAGGGAGGTGTGG + Intronic
1092004622 12:5058846-5058868 TGCATCTTAGTAGGAGGATGAGG - Intergenic
1092763152 12:11827572-11827594 TGAATTCCAGGAGGAGGAGGTGG - Intronic
1096627401 12:52904083-52904105 AGCATTCTAGGAGAAGGAAGTGG - Intronic
1097367545 12:58734521-58734543 TGCTATCTAGAAGCAGGCTGAGG - Intronic
1098870104 12:75807917-75807939 TGCATTCTAGACTGAGGATATGG - Intergenic
1098949581 12:76625905-76625927 TGCATTCTAGTTGGGGGACGGGG + Intergenic
1099094752 12:78359845-78359867 TGCCTTCTAGAACAAGGCTGGGG + Intergenic
1101547753 12:105732578-105732600 TGGAGTCTTGAAGAAGGATGAGG - Intergenic
1102150321 12:110685255-110685277 TGCTTTAAAGATGGAGGATGGGG + Intronic
1102687488 12:114735995-114736017 TGAATTGTACAAGGAGGCTGAGG + Intergenic
1103300842 12:119925395-119925417 TGCATCCTTGAAGGGGGATCTGG + Intergenic
1103520354 12:121533787-121533809 TGCCCTCCAGAAGGAGGAGGTGG + Intronic
1104060508 12:125264145-125264167 TGCTTTCAAGACGGAGGAAGGGG - Intronic
1105245612 13:18647224-18647246 TGCCCTCTAGAAAGAAGATGTGG - Intergenic
1107664883 13:42678535-42678557 TGCATTCTAGAAAGAAGGAGTGG + Intergenic
1109326131 13:60869989-60870011 TGCATTCTGGCAGAGGGATGTGG + Intergenic
1110366846 13:74696367-74696389 TGCATTATAAAAGGCGGATGGGG - Intergenic
1110646558 13:77892259-77892281 GGAATTTTAGAAGAAGGATGAGG + Intergenic
1110660158 13:78051267-78051289 AGCATTTTAGAAGGCTGATGTGG + Intergenic
1111298042 13:86308865-86308887 AGAATTCAAGAAGGAGGAAGTGG - Intergenic
1111371878 13:87329822-87329844 TGCATTCTAGGAAGAGAATAAGG - Intergenic
1114618930 14:24083083-24083105 TGAATTCCTGAAGGAGGAAGAGG + Intronic
1115649112 14:35390528-35390550 TGCATTACAGAGGCAGGATGGGG + Intergenic
1116970168 14:51055627-51055649 TGCCTTCTAGAAGGTGGAAAAGG + Intronic
1117322337 14:54635976-54635998 TACATTCTAATGGGAGGATGTGG + Intronic
1118063890 14:62169388-62169410 TTCATTCTTGAAAGAGGATCTGG + Intergenic
1118823027 14:69357453-69357475 AGAATTCTAGAAGGAAGCTGTGG + Intergenic
1119512506 14:75222402-75222424 TGCATTCTAGGAAGAGGAAATGG + Intergenic
1119976766 14:79033266-79033288 TGCATTGTAGAAGGAAGAATAGG - Intronic
1120754520 14:88229881-88229903 AGCATTCTAGAAGGATGAGCAGG - Intronic
1121571230 14:94947972-94947994 GGCTTTGAAGAAGGAGGATGGGG + Intergenic
1121924373 14:97914560-97914582 AGCACTCTAGAAGCAGGTTGTGG - Intergenic
1124233414 15:27966541-27966563 TGTATACTAGAAGGTGGACGTGG + Intronic
1125238969 15:37550736-37550758 TGTGGTCTTGAAGGAGGATGGGG - Intergenic
1125872817 15:43117554-43117576 TTCATTCCTGAAGGAGGATCTGG + Intronic
1125910911 15:43438009-43438031 TGCATTCAAGAAGGTGGAAAGGG + Intronic
1126024880 15:44436007-44436029 TTCATTATAAAAGGAGGAGGAGG - Intronic
1127447908 15:59084333-59084355 TGCTTTGCAGAAGGATGATGTGG + Intronic
1129119797 15:73389332-73389354 TGCATTGCAGAAGTAGCATGAGG - Intergenic
1129910580 15:79222830-79222852 TGCATCCTAGCAGGAGGATGGGG + Intergenic
1130923529 15:88368447-88368469 TGCACTGGAGAAGGAAGATGTGG + Intergenic
1131241064 15:90743903-90743925 TGCATTTTAAAAGCAGGAAGAGG + Intronic
1131481415 15:92785104-92785126 TGCATTCTGCAAGGTGTATGTGG - Intronic
1131552816 15:93372659-93372681 TTCATTGTAAAAGGAGGAGGAGG + Intergenic
1133281805 16:4670990-4671012 TGCCTTTTGGAAGGAGGATCTGG + Intronic
1133841969 16:9418180-9418202 TTCCATCTAGAAGGTGGATGAGG + Intergenic
1134889997 16:17832349-17832371 TGCATTTGAGAAGGAGCATAAGG - Intergenic
1135963618 16:27018035-27018057 AGCATTCAAGAAGGAGGGCGTGG + Intergenic
1137399014 16:48138123-48138145 GGCATTCCAGAAGGAGGCTGAGG - Intronic
1137496687 16:48974812-48974834 TGCATTCTGGTAGGAGGAAATGG - Intergenic
1139228856 16:65261622-65261644 TTCATTTTTGAGGGAGGATGGGG + Intergenic
1140816464 16:78625390-78625412 GGCATTCTAGTAGTAGGTTGTGG - Intronic
1140837601 16:78809667-78809689 TGCCTTCTAGAAAGAGGACTGGG + Intronic
1142553619 17:756679-756701 TGCTTTATATAAAGAGGATGAGG + Intergenic
1143266546 17:5642294-5642316 TTCATTCTGTAAGGAGGAAGAGG - Intergenic
1143544463 17:7588325-7588347 TGGATTAAAAAAGGAGGATGAGG + Exonic
1143618390 17:8067167-8067189 TTCAGACTAGAAGGAGGATGAGG + Intergenic
1144326335 17:14185045-14185067 TGGTTTCTAGAAGCAAGATGAGG - Intronic
1144475211 17:15581918-15581940 TGGTTTCTAGAAGCAAGATGAGG - Intronic
1144787150 17:17838213-17838235 TGCATTTTAGAAGGGGTGTGTGG + Intergenic
1147388833 17:40097144-40097166 CCCATTATAGAAGGAGGAGGAGG + Exonic
1147393673 17:40124531-40124553 TGCATTCTGCAAGGTGGATTGGG + Intronic
1149353345 17:55814190-55814212 TCCATTCTAGAGGAAGGAGGAGG + Intronic
1151042522 17:70879770-70879792 TGCATACTAGCAAGAGGATCTGG + Intergenic
1152022857 17:77790164-77790186 TCCAATCTAGAAGGAGGAAGTGG + Intergenic
1152298049 17:79479763-79479785 TGCCTCCAAGAAGGAGGTTGCGG - Intronic
1152631571 17:81413022-81413044 TCGTTTCTAGAAAGAGGATGTGG - Intronic
1153206129 18:2703800-2703822 TGCTTTTTAGAAGGAAGATCAGG - Exonic
1153462341 18:5350256-5350278 TGCATTGTGGAAGGAGGGTGAGG + Intergenic
1153724400 18:7940522-7940544 AGCATTCTAGGAGGAGGAAGAGG + Intronic
1154032868 18:10768325-10768347 TGCATTCTAAAGGGACCATGAGG + Intronic
1154443334 18:14412706-14412728 TGCCCTCTAGAAAGAAGATGTGG + Intergenic
1156774172 18:40767010-40767032 TACATTCTGGAAGGAGGGTCTGG - Intergenic
1158240098 18:55368032-55368054 TTCATTCAAGAAGTAGTATGTGG - Intronic
1158363289 18:56701117-56701139 TACATTTTAGAAGGAGGATAAGG + Intronic
1158736694 18:60090675-60090697 TTCATTGGAGAAGGGGGATGTGG + Intergenic
1158797139 18:60860293-60860315 TGCATTCTAGGAAGAGGAGGAGG + Intergenic
1159148185 18:64482077-64482099 TGGATTCCAGAAGGAGGGGGAGG - Intergenic
1159884594 18:73891939-73891961 TTCTTTCTAGAAGGAGGGTTTGG + Intergenic
1160254413 18:77235640-77235662 TGGACTCTAGAATGTGGATGTGG + Intergenic
1160358304 18:78247180-78247202 TGCGTTCTGGAGGGAGGGTGCGG - Intergenic
1160929109 19:1561341-1561363 AGGATTCTAGAAGCAGGACGGGG + Intronic
1161375927 19:3938718-3938740 AGCCTTCCAGGAGGAGGATGTGG - Exonic
1161509741 19:4663734-4663756 GGCTTTGTAGAATGAGGATGGGG - Intronic
1161745768 19:6058818-6058840 TGCAGACTGGAAGGGGGATGGGG + Intronic
1163114054 19:15178737-15178759 TGGCGTCTAGGAGGAGGATGTGG - Intronic
1165074375 19:33272749-33272771 GGCAATCTAGGAGGGGGATGTGG - Intergenic
1165144124 19:33720774-33720796 TGCATAGTGGAAGGAGGATAGGG - Intronic
1165354020 19:35292575-35292597 TGCAATCTGGGAGGTGGATGGGG + Intronic
1166438250 19:42787918-42787940 TTCTTCCTAGAAGAAGGATGTGG + Intronic
1168059467 19:53883016-53883038 TGGGTTCTAGAAAGAGGAGGTGG + Intronic
925260016 2:2520815-2520837 TTCTTTCTAGAAGGAGGACCAGG + Intergenic
925820959 2:7799535-7799557 TGCGTTCAAGTTGGAGGATGGGG + Intergenic
927562955 2:24086253-24086275 GGAATTTTAGAAGGAGGAAGAGG + Intronic
927862553 2:26569214-26569236 AGCCTTCTGGATGGAGGATGTGG + Intronic
930162751 2:48175088-48175110 TGAATGCCAGAAGGAGGAAGAGG - Intergenic
930818684 2:55623923-55623945 GGTATTCTAGAAGGAGGCAGAGG + Intergenic
930850947 2:55959624-55959646 TTCATCCTAGAGGCAGGATGGGG + Intergenic
932283350 2:70513294-70513316 TGCATTCTAGAAAGGGGGTTGGG + Intronic
933575406 2:84061667-84061689 TGCATTATAGAAACTGGATGGGG - Intergenic
934845075 2:97657187-97657209 TGAGATCTAGAAGGAGGAAGTGG + Exonic
935224941 2:101045353-101045375 AGCATTCTAGTGGGTGGATGGGG - Intronic
935822339 2:106906760-106906782 TGCATTCTGAGAGGAGAATGAGG + Intergenic
937307687 2:120882206-120882228 GGCCTCCTGGAAGGAGGATGTGG - Intronic
937807127 2:126159620-126159642 TGGAGGGTAGAAGGAGGATGAGG + Intergenic
938815566 2:134900746-134900768 TGCATTCTACCATGAAGATGTGG + Intronic
939602632 2:144212016-144212038 TCCTTTGTAGAAGGAGGCTGTGG + Intronic
939734903 2:145831404-145831426 GGAATTCTAGAAGGAGAATCAGG + Intergenic
942363154 2:175194284-175194306 TGACTTCTTGAAGGAGAATGAGG - Intergenic
942818169 2:180077208-180077230 TTCATGCTAGAAGGAGGTTAGGG - Intergenic
944835589 2:203576152-203576174 TGAAAGCTCGAAGGAGGATGAGG + Intergenic
945051831 2:205831235-205831257 TGCATTCTAGAGGAAAGATGTGG - Intergenic
947713299 2:232327928-232327950 TGCATTTGAGACAGAGGATGGGG + Intronic
948292396 2:236835485-236835507 TGCAGTCCAGAAGGAAAATGTGG - Intergenic
948709397 2:239816326-239816348 TGCATTCTCGAGGGAGGAACTGG + Intergenic
948709402 2:239816363-239816385 TGCATTCTCGAGGGAGGAACTGG + Intergenic
948709407 2:239816400-239816422 TGCATTCTCGAGGGAGGAACTGG + Intergenic
948709412 2:239816437-239816459 TGCATTCTCGAGGGAGGAACTGG + Intergenic
948709417 2:239816474-239816496 TGCATTCTCGAGGGAGGAACTGG + Intergenic
948709422 2:239816511-239816533 TGCATTCTCGAGGGAGGAACTGG + Intergenic
948709428 2:239816548-239816570 TGCATTCTCGAGGGAGGACTGGG + Intergenic
1169110659 20:3031128-3031150 TGCTTTAGAGAAGCAGGATGAGG - Intronic
1170591144 20:17772958-17772980 TGCCTTCTAGCTGGAGGAGGAGG + Intergenic
1170792777 20:19521500-19521522 TGTGTTCTTGAAGGAGCATGAGG + Intronic
1170816313 20:19717401-19717423 TTCATTCTAGAGGGGAGATGTGG + Intronic
1171425286 20:25044938-25044960 TGCATTTGTGAAGGAGGAAGCGG + Intronic
1172599110 20:36171484-36171506 TGCTATTTAGAAGGAAGATGAGG - Intronic
1173525421 20:43729032-43729054 TTCCTTCTAGAAGAAGGAAGAGG + Intergenic
1174049033 20:47754631-47754653 TAAATTCTAGGAGGTGGATGCGG - Intronic
1175240026 20:57540352-57540374 TTTGATCTAGAAGGAGGATGAGG + Intergenic
1175357877 20:58383228-58383250 TGCAGTCAAGCATGAGGATGTGG - Intergenic
1176452758 21:6878502-6878524 TGCCCTCTAGAAAGAAGATGTGG - Intergenic
1176830931 21:13743551-13743573 TGCCCTCTAGAAAGAAGATGTGG - Intergenic
1177215970 21:18129413-18129435 TGCATTGTAGAAGCAGGTAGAGG + Intronic
1178467965 21:32866004-32866026 TGAATTCAAGTAGGAAGATGGGG - Intergenic
1178919828 21:36731396-36731418 TGGATTCTAGATTGTGGATGTGG + Intronic
1179147254 21:38778931-38778953 GGCATTGAAGATGGAGGATGGGG + Intergenic
1179502219 21:41816950-41816972 TTCATTTTAGAAGCAGGAAGAGG - Intronic
1180643559 22:17319023-17319045 TGGATTCTGGAGGGAGGAGGGGG + Intergenic
1181331666 22:22097760-22097782 TGCAGTGGAGGAGGAGGATGAGG - Intergenic
1181667186 22:24406436-24406458 AGCAGTCTGGAAGGAGGCTGAGG + Intronic
1181667466 22:24408035-24408057 AGCAGTCTGGAAGGAGGGTGAGG - Intronic
1182094385 22:27616195-27616217 TGTTTTCTGGAAGGAGGAGGGGG - Intergenic
1183827810 22:40402122-40402144 TTCCTTCTAGAATCAGGATGAGG - Exonic
1184373937 22:44099893-44099915 CGCCTTCTGGAAGGTGGATGGGG - Intronic
949447897 3:4154826-4154848 TGTATTCTGGAAGTGGGATGCGG - Intronic
950614493 3:14148138-14148160 TGCCTTCTGCACGGAGGATGTGG - Intronic
950778223 3:15368821-15368843 GGCATTCTAGAAGGAGAAACTGG + Intergenic
951651864 3:24959550-24959572 AGCATTCTAGTGGGAAGATGGGG + Intergenic
953179268 3:40581438-40581460 TGCTGTCTAGGAGGAGGAGGAGG - Intergenic
953281900 3:41566887-41566909 TGCAGTCTGGAACTAGGATGAGG + Intronic
961488330 3:127233140-127233162 GGCATTCGAGGATGAGGATGTGG + Intergenic
962813428 3:138977887-138977909 TGCATTCTGGGAGGAGGAAAGGG + Intergenic
964524496 3:157603735-157603757 TGCATTCCTGAAGGAGGCTCAGG + Intronic
965494349 3:169379346-169379368 TGAATTCTTGAAGGAGAAAGAGG + Intronic
967288943 3:187900710-187900732 TGCATTGAAGATGGAGGAAGGGG - Intergenic
967504040 3:190232928-190232950 TGCATTTTATAAGGTGGCTGGGG - Intergenic
969358100 4:6643086-6643108 TTCAATCTGGAAGGAGGGTGGGG - Intergenic
970540689 4:17075525-17075547 TGCATACTAGAAGTACAATGAGG - Intergenic
970715645 4:18919295-18919317 CACATTCTAGAAGAAGGAAGAGG + Intergenic
970801596 4:19978789-19978811 TGCATGCTTGAAGGAGGCTTGGG + Intergenic
971627595 4:28942526-28942548 TGCATTCTGGTAAGAGGATATGG + Intergenic
972979299 4:44676943-44676965 TGTATTTTAAAAGGAGAATGCGG - Intronic
973027398 4:45289992-45290014 TGAATTCTACAAGGAAGATCTGG - Intergenic
973832007 4:54771219-54771241 TGAATTCTAGAAGGATGTTCAGG + Intergenic
973893066 4:55387173-55387195 TGCACACTAGAAGGATGAGGTGG + Intergenic
974905501 4:68050232-68050254 TTCATTCGAGTAGGAGGTTGAGG - Intergenic
975307205 4:72864088-72864110 TGCATCCTAGAATGAGAAAGTGG - Intergenic
975487250 4:74948040-74948062 GGCATTCTAGAATGAGGAAATGG - Intronic
978100532 4:104834913-104834935 TGCAAAATAGAAGGAGAATGAGG + Intergenic
978207819 4:106100633-106100655 TGCATTGTAGAGGATGGATGAGG - Intronic
979560522 4:122096539-122096561 TGAATTCTGGAAGCAGGATTAGG + Intergenic
979654728 4:123179203-123179225 AGCAATCTAGAAGGAGGAGTAGG + Intronic
980799060 4:137724670-137724692 TGCATTTTGGAAGGAGGAGCAGG - Intergenic
981292440 4:143091376-143091398 TGCTTACAAGAAGGAAGATGAGG + Intergenic
982357331 4:154485293-154485315 TGCATGCAAGAAAGAGGAAGTGG + Intronic
982474980 4:155839399-155839421 GCCATTCCAGAAGTAGGATGGGG + Intronic
984017982 4:174448680-174448702 TGCAATCTAGATGGAAGTTGAGG + Intergenic
984757495 4:183337805-183337827 TACCTTCTGGAAGGAGGTTGAGG - Intergenic
987102307 5:14602681-14602703 AGCACTCTAGGAGGAGGAAGTGG - Intronic
988321523 5:29704173-29704195 TGAATTCTACAAGCAGGAGGTGG - Intergenic
989146372 5:38254643-38254665 TGTATTTTTGAAGAAGGATGAGG - Intergenic
989175597 5:38522024-38522046 AGCATTCTGGAGGGAGCATGGGG - Intronic
989540471 5:42612188-42612210 TGAATTATAGAAGGAGAAGGAGG + Intronic
990383943 5:55241015-55241037 TGCATTCTACAAAGAGGCAGTGG - Intergenic
990818042 5:59807374-59807396 TGCCCTCTAGAAGAAGCATGGGG - Intronic
992040553 5:72826475-72826497 TGTATTCTTGCAGGAGGAGGAGG - Intronic
993762503 5:91813395-91813417 TGGATGGTAGAAGGAGGATGAGG + Intergenic
995835443 5:116395804-116395826 TGCAACCTAGAAGGAGGCTCAGG - Intronic
996643745 5:125790848-125790870 TGCTTTCTAGAAGATGGTTGTGG - Intergenic
997023745 5:130033111-130033133 TGCTTTCTTGAAGGAGAATCTGG + Intronic
999567529 5:152881503-152881525 AGGATCCTGGAAGGAGGATGGGG + Intergenic
1000226161 5:159263643-159263665 TGCCTTCAACAAGGAGGTTGAGG - Intronic
1000898614 5:166886877-166886899 TGAATTGTAGAAGGAGAAGGTGG + Intergenic
1001332166 5:170770116-170770138 TGCATTTTAGAAAGAGGGTGGGG + Intronic
1001735884 5:174000761-174000783 TCCATTTAAGAAGGAGAATGAGG + Intronic
1001781302 5:174371326-174371348 TGCATTTCATAAGGAGGGTGGGG - Intergenic
1001997027 5:176170339-176170361 TGCTTTTTGGAAGGAGGATGGGG - Intergenic
1007380405 6:41486776-41486798 TGCATGCCAGGAGGTGGATGGGG + Intergenic
1008299170 6:49813444-49813466 GGCATTTTAAAGGGAGGATGAGG + Intergenic
1008927273 6:56900129-56900151 GGAGTTCTAGAATGAGGATGGGG - Intronic
1009447847 6:63764141-63764163 CGCATTCTAGAATGGGTATGAGG + Intronic
1010754951 6:79656402-79656424 TGGATTCTAGAAGGAAGAATGGG - Intronic
1010982286 6:82381905-82381927 TACTATCCAGAAGGAGGATGGGG - Intergenic
1011398508 6:86936044-86936066 TGAAGTCTAACAGGAGGATGAGG - Intergenic
1011748438 6:90431745-90431767 TGAATTCTTGAAGGAGGGGGTGG - Intergenic
1012447590 6:99322483-99322505 TGTGCTCTAGAATGAGGATGAGG + Intronic
1014495790 6:122120518-122120540 TGCATTCTAGATGGAGCATGTGG - Intergenic
1016454501 6:144216467-144216489 TGCGTTCTGGAGGGAGGGTGCGG + Intergenic
1017969311 6:159297815-159297837 TGCTTTGTAGATGGAGGAAGGGG - Intergenic
1018336102 6:162791745-162791767 TGCATTCTAGAAGGAGGATGGGG + Intronic
1018351488 6:162964496-162964518 AGCATTCCAGAAGTAGGATATGG + Intronic
1018880432 6:167873558-167873580 TGCATTCTAGAAGAATGGTTGGG + Intronic
1019323012 7:424177-424199 TGCATGCCAGGAGGAGGTTGAGG - Intergenic
1019569756 7:1705425-1705447 TTCATCCTGGAAGGAGGAGGAGG + Intronic
1022818701 7:33937930-33937952 CACATTCCAGAAGGAGCATGTGG - Intronic
1026289749 7:68995909-68995931 TGCTTTGAAGAAGGAGGAGGAGG - Intergenic
1027618035 7:80448452-80448474 TGCATTTTAGAAAGAGCATCTGG + Intronic
1028486435 7:91363238-91363260 TGCATTGTAGAAAGAAAATGTGG - Intergenic
1029439281 7:100578307-100578329 TGCTTTCTGGCAGGAGGATGGGG - Intronic
1030797005 7:113801433-113801455 TGCATTATAGAATGAGTTTGAGG - Intergenic
1031895068 7:127338945-127338967 TGCATTATGGACGGAGGCTGGGG - Intergenic
1031955943 7:127942517-127942539 TGGTTTCTAGCAGCAGGATGAGG + Intronic
1032930504 7:136662806-136662828 TGCATTTAAAAAGGAGGTTGTGG + Intergenic
1033270682 7:139930268-139930290 TGCATTCTAGTGGGAGAAGGTGG - Intronic
1033345600 7:140523412-140523434 TGCTTTCCAGATGGACGATGAGG - Exonic
1034206569 7:149321268-149321290 TGCCGGCTAGAAGGAGGGTGAGG - Intergenic
1034888194 7:154815182-154815204 TGCATTCTGGAAGCAGCAAGGGG + Intronic
1036454855 8:8897657-8897679 TGTGTTCTAGAAGGTGGAGGGGG - Intergenic
1036797799 8:11768762-11768784 TTAGTTCTCGAAGGAGGATGGGG - Intergenic
1037118847 8:15258580-15258602 TGCATTTTAGAAGAAGGTTGTGG - Intergenic
1038304926 8:26391327-26391349 TCCATTGTGGATGGAGGATGAGG - Exonic
1038558308 8:28544981-28545003 GGCATTATAAAAGGAGGAAGAGG - Intronic
1038679817 8:29656331-29656353 TGGTTTCAAGGAGGAGGATGAGG - Intergenic
1040509809 8:48084096-48084118 TGCAGTGTAGACGGAGGTTGTGG + Intergenic
1040908371 8:52492029-52492051 TGACTTGGAGAAGGAGGATGTGG - Intergenic
1041174611 8:55181577-55181599 TGCATTTTAGAAGGGTCATGTGG + Intronic
1042083389 8:65082126-65082148 TGCAATATAAAAGGAGGAGGAGG + Intergenic
1046678021 8:117134098-117134120 TGTGCTCTAAAAGGAGGATGGGG - Intronic
1047050294 8:121104105-121104127 TGCATCCTAAAAGGAAGATTGGG + Intergenic
1048437121 8:134428678-134428700 TGCATTATAAAAGTAGGATATGG + Intergenic
1049705667 8:144040885-144040907 TGCATTCGGGAAGGGGGATGGGG - Exonic
1051015279 9:12467251-12467273 TGCTGGCTAGAAGGAGGGTGAGG + Intergenic
1052999249 9:34568472-34568494 TTCATCCCAGACGGAGGATGGGG - Intronic
1053062402 9:35042643-35042665 TGGATTCTAGATGTAGAATGAGG + Intronic
1053144479 9:35703259-35703281 TGCACTCCAGAAGGAGGGTGTGG + Intronic
1055503915 9:76929156-76929178 AGCACTCTAGAAGGTGGAGGTGG + Intergenic
1057022390 9:91709588-91709610 GGCATTTTAAAGGGAGGATGAGG - Intronic
1057083119 9:92187635-92187657 TGTAGTCTTGAGGGAGGATGAGG - Intergenic
1057317392 9:93978578-93978600 TACATACTAGAAGGATGAGGAGG - Intergenic
1062325197 9:136009518-136009540 TGCTTTCCAGAAGGAGGTGGGGG - Exonic
1203516423 Un_GL000213v1:6013-6035 TGCCCTCTAGAAAGAAGATGTGG + Intergenic
1186239650 X:7552719-7552741 GGCATTCTACATGGATGATGGGG + Intergenic
1186590128 X:10921441-10921463 TCCAATCTTGAAGGAGGAGGAGG - Intergenic
1186728352 X:12381750-12381772 TGGATCCTAGAAGGAAGATCTGG + Intronic
1187705862 X:22008717-22008739 TGCTTTCTAGAAGTAGGACTTGG + Intergenic
1187972996 X:24677134-24677156 AGTGTTCTAGAAGGAGGATGGGG - Intergenic
1189844207 X:45117261-45117283 TGCATTTTTGAAAGAGGGTGTGG - Intergenic
1189848529 X:45157708-45157730 TGCATACCTGTAGGAGGATGGGG + Exonic
1190497742 X:51042587-51042609 TCCAATCTAGAAGGAGGAGATGG - Intergenic
1190681518 X:52830566-52830588 TGACTTCTAGTAGGAGGATGAGG + Intergenic
1190998601 X:55636608-55636630 TGACTTCTAGTAGAAGGATGAGG + Intergenic
1193076437 X:77360743-77360765 TGCCTTCTAGTTGGAGCATGAGG + Intergenic
1194144369 X:90244825-90244847 TGCATTGTAGAAGGGAAATGTGG - Intergenic
1194776799 X:97975357-97975379 TGCAGGTTAAAAGGAGGATGAGG - Intergenic
1196274745 X:113753892-113753914 TTCTTTCTAGATGGAGGAAGAGG - Intergenic
1197653491 X:129090435-129090457 CACATGCTAGAAAGAGGATGAGG + Intergenic
1197911910 X:131492015-131492037 TACATTCTAGTAGCAGGAAGAGG + Intergenic
1198608263 X:138368491-138368513 TTCATTATAGAGGGAGGAGGGGG + Intergenic
1200081379 X:153578465-153578487 TGGCTTCTAGAAGCAGGAGGGGG + Intronic
1200490129 Y:3814129-3814151 TGCATTGTAGAAGGGAAATGTGG - Intergenic
1202179590 Y:22128274-22128296 TGCATTCTTGAGGAAGGATCAGG + Intergenic
1202211771 Y:22458120-22458142 TGCATTCTTGAGGAAGGATCAGG - Intergenic