ID: 1018336103

View in Genome Browser
Species Human (GRCh38)
Location 6:162791756-162791778
Sequence AGGAGGATGGGGAATGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018336095_1018336103 22 Left 1018336095 6:162791711-162791733 CCCATCAATTTGAATTTCACCAT 0: 1
1: 0
2: 1
3: 18
4: 294
Right 1018336103 6:162791756-162791778 AGGAGGATGGGGAATGCAGAAGG No data
1018336096_1018336103 21 Left 1018336096 6:162791712-162791734 CCATCAATTTGAATTTCACCATT 0: 1
1: 0
2: 3
3: 34
4: 375
Right 1018336103 6:162791756-162791778 AGGAGGATGGGGAATGCAGAAGG No data
1018336097_1018336103 3 Left 1018336097 6:162791730-162791752 CCATTCAGTACTTACTGCATTCT 0: 1
1: 1
2: 1
3: 19
4: 255
Right 1018336103 6:162791756-162791778 AGGAGGATGGGGAATGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018336103 Original CRISPR AGGAGGATGGGGAATGCAGA AGG Intronic
No off target data available for this crispr