ID: 1018336353

View in Genome Browser
Species Human (GRCh38)
Location 6:162794108-162794130
Sequence AGTGTTGGTGAGGATATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 5, 2: 11, 3: 64, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018336353 Original CRISPR AGTGTTGGTGAGGATATGGA GGG (reversed) Intronic
900785310 1:4645936-4645958 GGTGGTGGTGAGGAGAGGGAGGG - Intergenic
901116518 1:6849671-6849693 AGTTTTGAGGAGGAAATGGAGGG + Intronic
902805424 1:18858442-18858464 AGTGTTGGTGATGATGGTGATGG - Exonic
906944530 1:50284413-50284435 AGTGTGGCTGAGGACAGGGAGGG + Intergenic
907352617 1:53845286-53845308 TGTGTTGGTGAGGGGATGAAGGG - Intergenic
907799045 1:57746347-57746369 AGTGTTGGTGAAGAAATAAATGG - Intronic
908897061 1:68912286-68912308 AGGGTAGCTGAGGAGATGGAAGG - Intergenic
909237687 1:73174758-73174780 AGTGTGGGTGGGGACCTGGAAGG + Intergenic
911261924 1:95696715-95696737 AGTGGTGCTGAGGATTTGAAAGG + Intergenic
912679282 1:111718783-111718805 AGACTTGGTGAGGACAGGGATGG + Intronic
918113086 1:181475412-181475434 AGTGTTGGAGAGATTATGAAAGG + Intronic
918424534 1:184394961-184394983 GGTGTTGGGGAGGCCATGGAAGG - Intronic
918893475 1:190308093-190308115 GGTGTAGGTGAGGGTGTGGAAGG - Intronic
918922991 1:190739293-190739315 TGTGTTGGTAAGAATATGGAGGG + Intergenic
918966936 1:191362939-191362961 AATGTTGGTACAGATATGGATGG + Intergenic
919268178 1:195302257-195302279 AGTGTTGGTGGGGGTAGGGGAGG - Intergenic
919462728 1:197897805-197897827 AGAGTTGGTGATGGTCTGGATGG + Intergenic
919771595 1:201163729-201163751 AATGCTGGTGAGGATGTGAAGGG + Intronic
922545649 1:226454601-226454623 AGGGTTGGAGAGGAAAGGGAGGG - Intergenic
923274099 1:232381880-232381902 ATTGGTGGTGAGGATGTGGGAGG - Intergenic
1062962219 10:1581122-1581144 TGTATTGGCGAGGATATAGAGGG - Intronic
1063613102 10:7579904-7579926 GGTGTTGTTGAGGATCTTGAGGG + Exonic
1063946743 10:11183581-11183603 AGTGTTGGAGGGAATGTGGAGGG - Intronic
1064158615 10:12924288-12924310 AGTGTGGTTGAAGACATGGAGGG + Intronic
1064913507 10:20429775-20429797 AGAGTTGGTGAGGATGTTGATGG + Intergenic
1065495749 10:26325773-26325795 AGTGTTGGTGATGATTTGGGAGG - Intergenic
1065616478 10:27531187-27531209 TGTGGTGGTAAGGATCTGGAAGG + Intronic
1067217638 10:44316353-44316375 AGTGATGGGGAGGAAGTGGATGG - Intergenic
1068954858 10:62813459-62813481 GGTGTGGGTGCGGATATGGGTGG + Exonic
1071881564 10:89904514-89904536 AGGATTCGTGAGGATCTGGATGG - Intergenic
1072135498 10:92542021-92542043 AGTGTTTGTTTGGATGTGGAGGG - Intronic
1072703073 10:97658672-97658694 AGTGCTGGTGAGAAATTGGAAGG - Intronic
1074830428 10:117244268-117244290 AGGGTTGGTGATGAGCTGGACGG - Exonic
1075366502 10:121895080-121895102 AGTGTTGGTGAGCACATGGAGGG + Intronic
1075631765 10:124004668-124004690 AGGGTTGGTGAGGACAGAGATGG + Intergenic
1075902791 10:126056556-126056578 AGTGGTGGTGAGGGTTTGCAAGG + Intronic
1075954515 10:126510621-126510643 GGTGCTGGTCAGGAAATGGATGG - Intronic
1077450619 11:2641292-2641314 AATGCTGGAGAGGATGTGGAGGG - Intronic
1077931543 11:6738110-6738132 AGTTATGATGAAGATATGGAAGG + Intergenic
1078449779 11:11432158-11432180 AGTGGTGGTGATGATGGGGATGG - Intronic
1078491232 11:11770810-11770832 AATGATGGTGAGGAGAAGGAAGG - Intergenic
1080100449 11:28453739-28453761 AATGATGGTGAGGATATTAATGG - Intergenic
1080392497 11:31861254-31861276 AAGGTTGGAGTGGATATGGATGG - Intronic
1080607977 11:33879848-33879870 AGTACTGGTGAGGATCTGGAGGG + Intronic
1081567926 11:44271044-44271066 AGTGGTGGTGGGGACAGGGACGG - Intronic
1081741097 11:45441170-45441192 AGTCTGGGTGAGGGGATGGATGG + Intergenic
1082106115 11:48223580-48223602 TGTGCTGGTGGGGATATGAAGGG + Intergenic
1083334593 11:61915276-61915298 AGTGTTGCTGGGAATATGGCAGG + Intronic
1085204085 11:74719925-74719947 AGGGTTGGTGAGGATAGGGCGGG - Intronic
1087120213 11:94566564-94566586 AGTCTTGGTGCAGAAATGGAAGG + Intronic
1088711532 11:112513060-112513082 GATGTTGGTGAGGTCATGGAGGG + Intergenic
1088726283 11:112638317-112638339 AAAGCTGGTGAGGATGTGGAGGG - Intergenic
1088738048 11:112744798-112744820 ATTGTCGGTGAGGATGTGAAGGG + Intergenic
1089899380 11:121964933-121964955 AGGGGTGGAGAGGAGATGGAAGG + Intergenic
1090186723 11:124743983-124744005 AGTGTGGGTCAGGATGGGGATGG - Intronic
1091193033 11:133710105-133710127 AGTGTTGGTGAAGATGTGGGAGG - Intergenic
1091535146 12:1400021-1400043 AGTGTTGGTGAGAATGTGTAGGG - Intronic
1091632548 12:2172923-2172945 AGAGTTGGTGAGGAGCTGGGAGG + Intronic
1093442868 12:19219811-19219833 GGTTTTGGTGTGGGTATGGATGG + Intronic
1095381579 12:41600891-41600913 AGTGTTGGCAAAGACATGGAGGG - Intergenic
1095830451 12:46580718-46580740 AGTGTTTGCTAGGGTATGGATGG - Intergenic
1096019792 12:48314163-48314185 ATTGCTGGTGAGGAGAGGGAGGG + Intergenic
1096159004 12:49360902-49360924 AAAGTGGGTAAGGATATGGAAGG - Intergenic
1099203632 12:79703523-79703545 AGTGATGGTGGGCAAATGGAGGG + Intergenic
1100448965 12:94687086-94687108 AGTGCTGCTGGGGATAAGGAAGG + Intergenic
1101922587 12:108944850-108944872 AGTGTCGGCAAGGGTATGGAAGG - Intronic
1102638901 12:114348927-114348949 AGTGGTGGTGAGGATGTTGATGG + Intergenic
1102927771 12:116839691-116839713 AGTGTGGGTGAGCAAATGAATGG + Intronic
1104276482 12:127333344-127333366 AGTGCTGGTGAGGGAAGGGAGGG - Intergenic
1104671571 12:130684235-130684257 AGTGTGGGTGGGGGTAGGGATGG - Intronic
1104683214 12:130766786-130766808 AATGGTGGTGATGATAGGGATGG - Intergenic
1104804849 12:131579198-131579220 AATGCTGCTGAGAATATGGAGGG + Intergenic
1105431262 13:20339697-20339719 AGTGTTGGTGTAGAAATGGCGGG + Intergenic
1106270947 13:28152900-28152922 AGTGTTTGTGTGGGTATGGGGGG + Intronic
1106323052 13:28659775-28659797 AGTGGTGGGGAGGAGAAGGAGGG - Intronic
1106873563 13:34047726-34047748 AGTGTTGGTGAGAATGTGTAGGG + Intergenic
1107179270 13:37439453-37439475 CATGTTGGCGAGGATGTGGATGG - Intergenic
1107378405 13:39829547-39829569 AGGGTAGGTGTGGTTATGGAAGG + Intergenic
1107398892 13:40049030-40049052 AGTGTGAGTGAGGATGTGGCTGG - Intergenic
1107777652 13:43863612-43863634 AATGTTGTTGCAGATATGGAAGG - Intronic
1108772938 13:53727475-53727497 AGTGTTGGTGAGGGTCAGGGAGG - Intergenic
1108812833 13:54250218-54250240 GTTCTTGGTGAGCATATGGAGGG + Intergenic
1110535812 13:76649595-76649617 AGTGTTGGTGAGGACATGGAGGG - Intergenic
1110613582 13:77516484-77516506 AGTTTTGCTGAGGATCTGGGAGG - Intergenic
1111618693 13:90695653-90695675 ATGGATGGTGAGGAAATGGATGG - Intergenic
1114613256 14:24055525-24055547 AGTCTCTGTGGGGATATGGAAGG - Exonic
1117060713 14:51959780-51959802 TGTGTTGGTGATGGTAGGGAGGG - Intronic
1117695578 14:58358995-58359017 AGTGTTGGCAAGAATATGAAGGG - Intronic
1118321371 14:64755136-64755158 AGTGCTGGGGAGGAGAGGGAAGG + Intronic
1118451738 14:65909049-65909071 AGTGCTGGTAAGGGTGTGGAAGG - Intergenic
1119344436 14:73910879-73910901 AGTGGTAGTGAAGATAAGGAGGG + Intronic
1119678628 14:76575210-76575232 AGAGTTGTTGAGGATCAGGAAGG - Intergenic
1122282496 14:100631972-100631994 GGTGCTGGAGAGGATGTGGAGGG + Intergenic
1122852185 14:104541764-104541786 GGTGCTGGTGAGAATGTGGATGG + Intronic
1124350086 15:28948893-28948915 GGGGTTGGTGAGGATAGGCAGGG + Intronic
1125872033 15:43110887-43110909 AGTGTTGGTAAGAAGCTGGAAGG + Intronic
1126307920 15:47282220-47282242 ATTGTTGGTGGGGATAGGGTAGG - Intronic
1126587826 15:50307199-50307221 AGGCTTGGTGAGGAGATGGTGGG - Intronic
1127697339 15:61463274-61463296 GGTGCTGGAGAGGAGATGGATGG - Intergenic
1127702551 15:61515057-61515079 AGAGCTGGTGAGTCTATGGAGGG - Intergenic
1127918783 15:63476840-63476862 AGTGCTGGTGAGGAGAGGGAGGG - Intergenic
1129331222 15:74828399-74828421 AGGCTTGGTGGGGATATGGGGGG - Intronic
1130666505 15:85873956-85873978 GGTGTTGGGGAGGACCTGGAAGG + Intergenic
1132732663 16:1370454-1370476 GGTGGTGGTGGGGATATGGGGGG + Intronic
1133413475 16:5587733-5587755 AGTATTGATGAGAATATGGAGGG + Intergenic
1133645543 16:7761041-7761063 AGTGTTGCTGAGGATGTGTGGGG - Intergenic
1133910670 16:10063288-10063310 TGTGATGCTGAGGATATGAATGG - Intronic
1133957302 16:10455810-10455832 ATTGTTGGTGAGGACTTGAAAGG + Intronic
1136183016 16:28567706-28567728 AATGTTGGTGGAAATATGGATGG + Intronic
1138544625 16:57708741-57708763 AGTATTGGCAAGGATGTGGATGG - Intronic
1138732857 16:59215169-59215191 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1139369377 16:66457188-66457210 AGTATTGGTGAGGGGATGGGTGG + Intronic
1140660898 16:77190791-77190813 AGTATTGGTTAGGATTTGGCGGG + Intergenic
1140941240 16:79723309-79723331 GGTGATGGTGAGGATAGGGGTGG + Intergenic
1141415517 16:83869404-83869426 ACTGTTGGTGAGAATGTAGATGG + Intergenic
1141606485 16:85156872-85156894 TGGGTTGGTGGGTATATGGATGG - Intergenic
1141912907 16:87072129-87072151 AGTTTTGGTGAAGAAATGAATGG - Intergenic
1142064465 16:88053207-88053229 TGTGTTGGTGATGATAATGATGG - Intronic
1142576539 17:912466-912488 AGTGTTGGCAAGGATGTAGACGG - Intronic
1144537096 17:16101268-16101290 AGCGCTGATGAGGATGTGGATGG - Exonic
1144769707 17:17752704-17752726 TGTGGTGGTGAGGAGAGGGAGGG - Intronic
1145302477 17:21650377-21650399 GGTGATGGTGATGATAAGGATGG + Intergenic
1145304244 17:21664002-21664024 TGTGATGGTGATGATAAGGATGG + Intergenic
1145347845 17:22052946-22052968 GGTGATGGTGATGATAAGGATGG - Intergenic
1145415755 17:22712499-22712521 GGTGATGGTGATGATAAGGATGG + Intergenic
1145960703 17:28885088-28885110 AGTGTAGGTGTGGGTATGGAAGG + Intronic
1146630006 17:34463031-34463053 AGTGTTGGTGTTGATATGGAGGG + Intergenic
1148083897 17:44982687-44982709 AGTGGTGGTGATGATAATGATGG + Intergenic
1148436115 17:47686970-47686992 AGTGCTGGGAAGGAAATGGATGG - Intergenic
1151011419 17:70502093-70502115 AGGGTTGGAGTGGATATGAAAGG + Intergenic
1151217090 17:72584396-72584418 AGTGTTGGTGTGGAGACGGAGGG - Intergenic
1151412553 17:73940959-73940981 AGTGCTGGGGAGGAGATAGAAGG + Intergenic
1151989911 17:77567767-77567789 AGTGTTGGTGAGTGTGTGGGGGG + Intergenic
1152365177 17:79851453-79851475 AGTGTTGGTGGGGACAGGGCTGG - Intergenic
1152384563 17:79963718-79963740 AGTGTCGGTGAGGATGTGGAGGG - Intronic
1152658671 17:81532010-81532032 AGTGGTGGTGATGATAGTGATGG + Intronic
1154109554 18:11554205-11554227 CGTCTTGGTGAGCCTATGGAGGG - Intergenic
1154227235 18:12516461-12516483 AGGGTTGGAGAGGAAAGGGAGGG + Intronic
1155866667 18:30973911-30973933 AGTGATGGTGATGGTATTGAAGG + Intergenic
1156591365 18:38492726-38492748 ATTGTTGGTGAGGATGTGGGAGG + Intergenic
1158434099 18:57421744-57421766 AGTGTTGCTGAGCATGTGGGGGG + Intergenic
1159275311 18:66212099-66212121 AATGTTGCTGAGGAGATAGATGG - Intergenic
1159772709 18:72566169-72566191 GGTGTTGGCCAGGATATGGAGGG + Intronic
1160184633 18:76665955-76665977 AGGGATGGTGGGGATAGGGAGGG + Intergenic
1160546005 18:79656173-79656195 AGACTTGTTGAGGATGTGGATGG + Intergenic
1160920047 19:1515337-1515359 GGTGGTGGTGAAGATGTGGAGGG + Intergenic
1160971243 19:1768712-1768734 AGTGTTGATGAGGATAATGAAGG + Intronic
1161711483 19:5851133-5851155 ACCGTTGGGGAGGACATGGAAGG - Intronic
1163216886 19:15885691-15885713 AGAGTTGGTGATGATATGTGAGG - Intronic
1164705454 19:30316264-30316286 AGTATTGGTGAGGTTTTGGCAGG - Intronic
1166030791 19:40125625-40125647 TGTGGGGGTGAGGAAATGGAGGG + Intergenic
1166598164 19:44069839-44069861 AATGTTGGTGAGGATGTGGAAGG - Intergenic
1167557783 19:50206388-50206410 AGGGCTGGTGAGGAAGTGGATGG + Intronic
1167764058 19:51468637-51468659 AGGGTTAGTGAGGAGATGGGGGG + Intergenic
926830413 2:16956185-16956207 AGTGTTGCAGTGGTTATGGATGG + Intergenic
928128345 2:28631238-28631260 AGTGGAGGTGGGGAGATGGAAGG - Intronic
928423966 2:31162857-31162879 AGTCTTTGTAAGGAGATGGAGGG + Intergenic
928610332 2:32986244-32986266 GATGTTGGTGAGGAGATGGATGG + Intronic
930170404 2:48245947-48245969 AATGTTGGTAAAAATATGGATGG + Intergenic
930346825 2:50193189-50193211 ATTGATGATGAGGATATGGAAGG - Intronic
930858466 2:56044305-56044327 AGCCTTGGTGTGGATATGGAGGG + Intergenic
930962695 2:57280001-57280023 GATGTTGTTGAGGATGTGGAGGG + Intergenic
932361222 2:71107669-71107691 TGTGTGGGAGAGGATAAGGATGG + Intergenic
932470538 2:71952291-71952313 AGAGTTGGTGAGAATATGAAGGG + Intergenic
933502272 2:83129133-83129155 AGTGTTTGTGGGCATATGGGTGG + Intergenic
935006912 2:99088007-99088029 AATGTTGCTAAGGATATGGATGG + Intronic
935212111 2:100946960-100946982 AGGGTTGGAGATGATATGGGTGG + Intronic
938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG + Intronic
938847902 2:135230497-135230519 AGTGCTGGTGAGTATATAGAAGG - Exonic
940038271 2:149331432-149331454 AGAGATAGTGAGGATATGGTGGG - Intronic
945112382 2:206372891-206372913 AGTGTTGGTGAGGATGTGGAGGG - Intergenic
946122182 2:217525821-217525843 AGTGTTAGTGATGTGATGGAGGG - Intronic
946895918 2:224323505-224323527 TGTTTTGGTGAGAAAATGGAGGG + Intergenic
948031654 2:234822804-234822826 AGTGTTGGTGATGGTAGTGATGG + Intergenic
948031673 2:234822926-234822948 AGTGTTGGTGATGGTAGTGATGG + Intergenic
948274732 2:236699674-236699696 AGAGATGGTGAGAAGATGGAAGG + Intergenic
948348148 2:237316626-237316648 TGTGGTGGGGAGGATATGGGAGG - Intergenic
948639263 2:239364066-239364088 TGTGTTGGTAAGGATGTGGTTGG + Intronic
1169785569 20:9355934-9355956 GGTGCTGGAGAGGATGTGGAGGG - Intronic
1169848154 20:10018618-10018640 GGTGTTGGTGAGGATGTGGATGG - Intronic
1170297102 20:14839760-14839782 AGTGTTGGTGAAGTTGGGGAGGG - Intronic
1170407875 20:16058653-16058675 AGTGTTGGGGAAGACATCGAGGG - Intergenic
1170950312 20:20930754-20930776 GGGGATGGTGAGGATAGGGAGGG - Intergenic
1171011717 20:21512730-21512752 AGTGTGGGTGAGAATTTGGGGGG + Intronic
1171519058 20:25761780-25761802 GGTGATGGTGATGATAAGGATGG + Intergenic
1171521803 20:25781838-25781860 AGTGTTGGTGATTGTAAGGATGG + Intronic
1171555022 20:26074045-26074067 AGTGTTGGTGATTGTAAGGATGG - Intergenic
1171555040 20:26074231-26074253 TGTGATGGTGATGATAAGGATGG - Intergenic
1171557866 20:26094731-26094753 GGTGATGGTGATGATAAGGATGG - Intergenic
1174871098 20:54183128-54183150 AGTGTTGGGGAGGATGTAGAGGG - Intergenic
1174888179 20:54358982-54359004 TGTGTGGGTGAGTAGATGGAGGG + Intergenic
1175032373 20:55968725-55968747 CGTGTTGGTAAGGATGTGGAGGG - Intergenic
1175380970 20:58563989-58564011 AGTGTTGACGAGGATGTGGAAGG + Intergenic
1176648967 21:9528784-9528806 AGTTTTGGTGTGTAGATGGAGGG - Intergenic
1176653236 21:9568391-9568413 AGTGATGGTGAGTATGGGGATGG + Intergenic
1176655603 21:9586774-9586796 AGTGTTGGTGATTGTAAGGATGG + Intergenic
1178507285 21:33172135-33172157 AGAGTTGGGGAGGAAATTGAAGG + Intergenic
1179567510 21:42258409-42258431 AGGGATGGGGGGGATATGGAAGG - Intronic
1180860884 22:19081588-19081610 AGAGTTGGAGAGGATGTGGATGG + Intronic
1181034660 22:20164084-20164106 AGTGATGGTGGGGATAGTGATGG - Intergenic
1181136310 22:20768983-20769005 AGTGATGGTGGAGATATGAAGGG + Intronic
1181898320 22:26130722-26130744 AGTGTTGGCGAGGATGTGGAGGG - Intergenic
1182241992 22:28923581-28923603 GGTGATGGTGAGTATATGGAGGG - Intronic
1182403741 22:30105821-30105843 GGTGATGGGGAGGATATTGATGG - Intronic
1182770670 22:32793982-32794004 AGTGTTGGGGAAGAGAAGGATGG + Intronic
1183860990 22:40669834-40669856 AGTGTCACTGAGGAAATGGATGG - Intergenic
1183947634 22:41335736-41335758 GGTGTTGGTGCAGGTATGGATGG + Intronic
1184042613 22:41952950-41952972 AGGGTTGGTGAAGGTAGGGAAGG - Intergenic
1185066386 22:48633785-48633807 AGTGAAGATGAGGATATGGGAGG + Intronic
1185070309 22:48652389-48652411 AGTGGTGGTTGGGATAAGGAAGG + Intronic
1185135997 22:49073003-49073025 AGTGTCCCTGAGCATATGGAAGG + Intergenic
1185200531 22:49501100-49501122 AGTGATGGTGATGATAGTGATGG - Intronic
950238562 3:11346473-11346495 AATGCTGGTGAGGATGTGGTAGG - Intronic
951063873 3:18241618-18241640 AATGTTGGGGAGGATGTGTATGG + Intronic
951607610 3:24453146-24453168 AGAGTTGGTGATGGTTTGGATGG - Intronic
952150687 3:30586743-30586765 AGAGTTAGTGAGGATGGGGAAGG + Intergenic
954302885 3:49709970-49709992 AGTGTCGGTAAGGATATGTATGG - Intronic
954406661 3:50349023-50349045 AGTGGCACTGAGGATATGGATGG - Intronic
954903254 3:54038432-54038454 TGTGTGGGTGAGCACATGGATGG + Intergenic
955336853 3:58093966-58093988 AGTGTGGGTGTGGTTATGCAAGG + Intronic
955538837 3:59952773-59952795 AGTCCTGGTTAGGATTTGGAGGG + Intronic
956467499 3:69533929-69533951 AGTGCTGTGGAGGATATGTAAGG - Intronic
956754799 3:72373867-72373889 AGTCTTGGAAAGGATCTGGAAGG - Exonic
957120088 3:76078990-76079012 AGTGATGTTGAGCACATGGACGG + Intronic
957548957 3:81679365-81679387 AGAGTTGATGAGGTTATGGGTGG - Intronic
957887638 3:86309745-86309767 AGTGTTAGTAAGGATGTGGAGGG - Intergenic
958045851 3:88282701-88282723 GGGGTTGGTGAGGATAGGAATGG + Intergenic
960386462 3:117026902-117026924 AGTGATGGTGAGGAAGAGGATGG + Intronic
960499668 3:118421372-118421394 AATGTTGGGGAGGATTTGAATGG + Intergenic
960631631 3:119737955-119737977 AGAGTTGGTTAGGATTTAGAGGG + Intronic
961523072 3:127479163-127479185 TGTGTTGGTGAGGATGTGGGGGG - Intergenic
961756137 3:129128363-129128385 GGTGTAGGTGAGGATGGGGAAGG - Intronic
962109083 3:132423340-132423362 AGGGTTGGTGAGGTTATGAATGG + Intronic
963142322 3:141957019-141957041 AGTGTAGAAAAGGATATGGAGGG + Intronic
963283256 3:143407727-143407749 AGTGATGGTCAGGATAGGGAAGG + Intronic
964781588 3:160344943-160344965 AATGCTGGTGAGGATGTGGAGGG + Intronic
966186800 3:177234753-177234775 AGTGATGGTGAGAATATAGATGG - Intergenic
967662133 3:192125693-192125715 AGTGTTGGAGAGGGTAAGGAAGG + Intergenic
968810065 4:2795777-2795799 AGGTGTGGTGAGGGTATGGAGGG + Intronic
969153442 4:5189799-5189821 AGTGCTGACGAGGATGTGGAGGG - Intronic
969529853 4:7724608-7724630 AGTGCTGGTGAGGATGGTGATGG + Intronic
969535150 4:7752079-7752101 TGTGGTGGTCAGGATATTGATGG - Intergenic
969833832 4:9822134-9822156 AGTGATGTTGGGGAGATGGAGGG - Intronic
970069198 4:12137238-12137260 AGTGTATGTGTGTATATGGAAGG + Intergenic
971047956 4:22827142-22827164 AGCGCTGGTGAGGATGTGAAGGG - Intergenic
972064719 4:34926683-34926705 AATGTTGGTGGAAATATGGATGG + Intergenic
972170687 4:36342139-36342161 AGTGTTGCTGATGACGTGGATGG + Intronic
972946008 4:44256503-44256525 CCAGTTGATGAGGATATGGAAGG + Intronic
973669712 4:53203828-53203850 AGTGTTGGTGGGGACATTTAGGG - Intronic
973977614 4:56278995-56279017 AGTGTTGATGAAGATATATAGGG + Intronic
974379923 4:61126036-61126058 AGTGTTTATCAGGAAATGGAGGG - Intergenic
974410132 4:61530206-61530228 AGTGTTAGTGTAGATATAGAAGG + Intronic
975385759 4:73758147-73758169 AGTGTTGGTGACAATGTGGAGGG - Intergenic
975422719 4:74187618-74187640 TGTGTTGGTGATGATGTGGAGGG + Intronic
975981632 4:80167470-80167492 AGTGTTGGCAAAGATATGGTAGG - Intergenic
976014663 4:80537226-80537248 ACTGTTGGTGAGAATATAAATGG + Intronic
976054006 4:81041771-81041793 AATCTTGGTGAGGGGATGGAAGG - Intronic
976345684 4:83997361-83997383 ATTGTTGATGAAGAGATGGATGG - Intergenic
977067320 4:92334202-92334224 AATGTTGGTGGAAATATGGATGG - Intronic
977375476 4:96197503-96197525 GATGTGGGTGAGGATATGGTGGG + Intergenic
981476276 4:145190408-145190430 AGTGTTGGAGAGGATGTGAAGGG - Intergenic
981883492 4:149644931-149644953 AGTGTAGGTGAGGATACAGAAGG - Intergenic
982101303 4:151970892-151970914 AATGCTGGTGAGGATGTGGCGGG - Intergenic
983168593 4:164510090-164510112 GGTGTTGGTAAGGAGATGGAAGG + Intergenic
983702770 4:170618329-170618351 AGTGGATGTGAGGATTTGGAAGG - Intergenic
984255276 4:177382608-177382630 ATTGAAAGTGAGGATATGGAAGG - Intergenic
984482185 4:180319548-180319570 AGTGATGGTGAAGATGAGGAAGG + Intergenic
985046532 4:185946626-185946648 AGGGTGGATGAGGAGATGGAAGG - Intronic
985691133 5:1313231-1313253 AGGGTTGGTGAGGATACAAAGGG + Intergenic
986592054 5:9381061-9381083 AGAGTAGGTTAAGATATGGAAGG + Intronic
987656197 5:20809813-20809835 AGTGTTGGTGAGGATGTGAGAGG - Intergenic
988767356 5:34394127-34394149 AGTGTTGGTGAGGATGTGAGAGG + Intergenic
989110843 5:37905437-37905459 AGTGTTGCAGAGGAGGTGGAAGG - Intergenic
989239542 5:39188435-39188457 AGGGTTGGTGGGGAGATGAAGGG - Intronic
989377166 5:40776488-40776510 AGGGGTGGTCAGCATATGGATGG + Intronic
989456376 5:41648885-41648907 AGTGGTGGTGAGGATAAGAATGG + Intergenic
992081526 5:73238078-73238100 AGTGTTGGCAGGGATATGAAGGG + Intergenic
992245103 5:74812808-74812830 AATGTTGGTGAGGATGTGGAGGG + Intronic
992750270 5:79854799-79854821 AATGGTGGTGAGGATAGGGTGGG + Intergenic
994293577 5:98061529-98061551 AGTGTTGGTAAAGATGTGGAAGG + Intergenic
994502253 5:100594298-100594320 GGTGTTGCTTAGGGTATGGAAGG - Intergenic
995016083 5:107310594-107310616 AGTGTTGGTGAGGATGTAAATGG + Intergenic
997755543 5:136395240-136395262 AACGTTGGTGAGGATGGGGAGGG + Intronic
998479239 5:142448090-142448112 AGTGTTGGTGAGGATATGGGAGG - Intergenic
999397065 5:151236292-151236314 AGTGTTGGTGAGAATGTAAATGG + Intronic
999706667 5:154279187-154279209 AGTGTTAGTGAGGATGTGGGTGG - Intronic
1001672917 5:173489283-173489305 AGTGCTGGTGAGGATGTGAACGG - Intergenic
1001904167 5:175457265-175457287 GGTGTTGGTGAGGATGTAGAGGG + Intergenic
1001978425 5:176020422-176020444 AGTGCTGGTGAGTATATGAGCGG + Intronic
1002004421 5:176220874-176220896 AGTATTGGTGAGGTTGTGGTAGG + Intergenic
1002221950 5:177689751-177689773 AGTATTGGTGAGGTTGTGGTAGG - Intergenic
1002238992 5:177823340-177823362 AGTGCTGGTGAGTATATGAGCGG - Intergenic
1002685586 5:181006937-181006959 AGTGTTGGTGAGGATGTGGAGGG + Intergenic
1002973048 6:2044401-2044423 ATTCTTGGTGGGGACATGGATGG + Intronic
1003617094 6:7664930-7664952 AGCGTCGGTGAGGATGTGGAGGG - Intergenic
1004510117 6:16278190-16278212 AGAGCAGGTGAGGGTATGGAGGG + Intronic
1004641194 6:17517015-17517037 AGGGTATGTGTGGATATGGATGG + Intronic
1004684297 6:17927782-17927804 TGGGATGGTGAGGATATGGGAGG + Intronic
1004902325 6:20205923-20205945 AGGGTTGGGGAGGAGTTGGAGGG - Intronic
1005400481 6:25427696-25427718 AGTGTTGGGGAGGATGTGGAGGG - Intronic
1005901988 6:30224757-30224779 AGTATTGGTGAAGGCATGGATGG - Intergenic
1006097412 6:31664770-31664792 ATTGTTGGTGAGGATGGGGGTGG - Intronic
1006420312 6:33929651-33929673 AGTGTTGGTGAGGATGTGGAAGG + Intergenic
1007037371 6:38688768-38688790 AGTGTTTGAGAGAATAAGGAAGG - Intronic
1007808447 6:44469234-44469256 GATGATGGTGATGATATGGATGG + Intergenic
1010169844 6:72961666-72961688 AGGGTTGGTGGGGATTTGGACGG + Intronic
1010701660 6:79056378-79056400 AGTGCAGGTGAGGACATGGCAGG + Intronic
1011969276 6:93201430-93201452 AGTGTTGATGAGAATGTGAAGGG + Intergenic
1012150111 6:95739301-95739323 AGTGTTGGCTAGAATTTGGAGGG + Intergenic
1012260339 6:97081142-97081164 AGGGTTGGTGAGGAGGTAGAAGG + Intronic
1012351276 6:98253895-98253917 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1012443534 6:99285052-99285074 AATGCTGATGAGGATGTGGAGGG + Intronic
1013723657 6:113064499-113064521 AGTATTGGTGATAATATGAAAGG - Intergenic
1015802663 6:137076525-137076547 AGTGTAGCAGAGAATATGGAAGG + Intergenic
1016115080 6:140271012-140271034 GGTGATGGTGAGGATAGTGATGG + Intergenic
1016303463 6:142657388-142657410 AATGTGGGTGGGGAGATGGAGGG - Intergenic
1016704086 6:147086788-147086810 AGTGTTAGTGAGGATATAGAGGG + Intergenic
1018224486 6:161615266-161615288 AGTGTGGATGAGGAGATGAAGGG - Intronic
1018336353 6:162794108-162794130 AGTGTTGGTGAGGATATGGAGGG - Intronic
1018362746 6:163087889-163087911 AGTGTTGGTGAGGATGGAGAGGG + Intronic
1018503885 6:164443202-164443224 GATGTTGGTAAAGATATGGATGG + Intergenic
1018840919 6:167515926-167515948 AGTGATGGTGATGATAGTGATGG - Intergenic
1019369625 7:654660-654682 GGTGATGGTGAAGATATTGATGG - Intronic
1020076873 7:5263961-5263983 AGGTTTGGTGAGGAGATGCAGGG + Intergenic
1021022326 7:15617666-15617688 TGTGTTGGGGAGGCTGTGGAGGG + Intronic
1021340985 7:19462339-19462361 AGTGTTGGCAAGGATGTGGAGGG - Intergenic
1021682715 7:23150712-23150734 ATTGATGGTGGGGATGTGGATGG - Intronic
1023009456 7:35912766-35912788 AGTGTGGCTGAGAATATAGATGG - Intergenic
1023593781 7:41807270-41807292 AGTGTGGATGAGGATGTGGACGG - Intergenic
1024065102 7:45726099-45726121 AGTGTGGCTGAGAATATAGATGG + Intergenic
1024226780 7:47331445-47331467 AGTGTCGCTGAGGTTGTGGAGGG - Intronic
1024642131 7:51338663-51338685 AGTGTTGGAGAGGTTGTGGAGGG + Intergenic
1025123126 7:56322919-56322941 AGTGTGGCTGAGAATATAGATGG - Intergenic
1025279533 7:57616710-57616732 GGTGATGGTGATGATAAGGATGG + Intergenic
1025282289 7:57636913-57636935 AGTGTTGGTGATTGTAAGGATGG + Intergenic
1025302441 7:57828606-57828628 AGTGTTGGTGATTGTAAGGATGG - Intergenic
1025305198 7:57848790-57848812 GGTGATGGTGATGATAAGGATGG - Intergenic
1026386110 7:69849515-69849537 AGTGGAGGGGAGGATAGGGAAGG - Intronic
1028482717 7:91325299-91325321 AGAGTTGGCCAGGAGATGGATGG - Intergenic
1028769153 7:94596166-94596188 AGTCTTGATGGGGTTATGGAAGG + Intronic
1030341495 7:108385782-108385804 TGTATTGGAGAGAATATGGAAGG + Intronic
1030416019 7:109243733-109243755 AGTGGTGGGGAGGACAAGGAAGG + Intergenic
1034389332 7:150772049-150772071 AGTGTTGGTGAAGATGTGGAGGG + Intergenic
1035988658 8:4463287-4463309 AGTGTTGGTGAGGAGGTGTATGG + Intronic
1036215075 8:6872597-6872619 TGTGTTGCTGTGGAGATGGAAGG + Intronic
1036959550 8:13228940-13228962 AGTGTTGGTAAGGATGTGGAGGG + Intronic
1037721969 8:21452099-21452121 AGTGTTGGTGAGAAAAAGGAAGG + Intergenic
1038367427 8:26950263-26950285 AGTATGGGTGAGGACATGAATGG - Intergenic
1038406975 8:27329433-27329455 ACTGATGGTGAGGCTAGGGAGGG + Intronic
1038679477 8:29653632-29653654 AGTGTGGGAGTGGATGTGGAAGG - Intergenic
1038824018 8:30981112-30981134 AGTATTGGTGGGGATGTTGAAGG + Intergenic
1039278741 8:35958940-35958962 AGTGTCGGTGAGATTCTGGATGG - Intergenic
1039469959 8:37807221-37807243 AATGTTGGTGAGGACATGTAAGG - Intronic
1039797181 8:40925458-40925480 TGTGTTGGGGGGCATATGGATGG - Intergenic
1040792937 8:51254591-51254613 AGTGTTGGTGATGGGATGGTGGG + Intergenic
1041496051 8:58486390-58486412 TGTGTTGGTGAGAAGATGGTTGG - Intergenic
1041593732 8:59621605-59621627 AATGTTGGTGAGGTTGTGGAGGG - Intergenic
1041779295 8:61559926-61559948 AGTGTTGGTGAGGGTTGGGGGGG + Intronic
1042396421 8:68296325-68296347 AGTGTTGGTCAGCATTTGGGAGG - Intergenic
1042654211 8:71077770-71077792 TGTGTTTGTGAGGAGAAGGAGGG + Intergenic
1042750792 8:72155482-72155504 AGTAATGGTGAGAATATGAAGGG - Intergenic
1042932665 8:74029246-74029268 AGTGTCTGTGAGAATGTGGAGGG + Intergenic
1044054960 8:87557201-87557223 AGTGTTGATGAAGCTATGCATGG - Intronic
1044299041 8:90562607-90562629 AGTGTATGTGTGGATATGTATGG + Intergenic
1044651119 8:94497026-94497048 AGTGTATGTGACAATATGGATGG - Intronic
1044844334 8:96365636-96365658 AGTGATGGTGATGATAAAGAAGG + Intergenic
1045557996 8:103233191-103233213 AGGGGTGGTGAGGAAGTGGAGGG + Intergenic
1045843844 8:106610184-106610206 AGTGTTGGTGGGGACTTGGGAGG - Intronic
1047438277 8:124853906-124853928 AGTGTTTGTTATGATAAGGAAGG + Intergenic
1047821822 8:128529620-128529642 AGTCTTGGAGAGGTTATGAAGGG - Intergenic
1048303155 8:133266061-133266083 TGTGAGGGTGAGGACATGGAGGG - Intronic
1049073691 8:140376897-140376919 AGTGTTGGGAAGAAGATGGATGG + Intronic
1049281523 8:141751474-141751496 AGTGCTGGGGAGGATGTGGGAGG + Intergenic
1050170620 9:2812118-2812140 AGTTTTAGAGAGGGTATGGATGG + Intronic
1050260793 9:3838794-3838816 AGTGTTGGAGAAGAAATGAAGGG - Intronic
1051279449 9:15426987-15427009 ATTATTGGTGAGGAAAAGGAAGG - Intronic
1051988508 9:23121411-23121433 AGTTTTGGAGAGGATAAAGATGG + Intergenic
1052278898 9:26710163-26710185 AGTGTTGGTAAGGATGGTGAAGG - Intergenic
1052653628 9:31330586-31330608 CATGGTGGTGAGGATATGGAAGG - Intergenic
1054609040 9:67214807-67214829 AGTGTCTGTGAGGTTATGTATGG + Intergenic
1054819187 9:69505023-69505045 AGTGTTTGTGAGGATGTGTGCGG - Intronic
1055618813 9:78101684-78101706 AGTGTGTGTGAGGAAATGCAGGG + Intergenic
1055694167 9:78864985-78865007 AGTGTTGGTGCAGTTATGGGAGG - Intergenic
1056673758 9:88655372-88655394 AGTGTTGGTTAGGAATGGGAGGG + Intergenic
1056900617 9:90596063-90596085 AATTTTGGTGGGGAAATGGAGGG + Intergenic
1057444211 9:95102746-95102768 AGTGGTGGTCAGGAGGTGGAAGG - Intronic
1057480874 9:95444761-95444783 GGTGCTGGTGTGGATTTGGATGG + Exonic
1058076970 9:100661140-100661162 AGTTTTGGTGATGGGATGGAGGG + Intergenic
1058589996 9:106555125-106555147 AATGTTGATGCAGATATGGAGGG + Intergenic
1058979040 9:110152271-110152293 AGTGCAGGTGAGGAACTGGATGG + Intronic
1060102486 9:120852695-120852717 AGCGTGGGAGAGGAGATGGAGGG - Intergenic
1060308916 9:122441673-122441695 AGTGTTGTTGGGGGAATGGAGGG + Intergenic
1060410668 9:123398153-123398175 AGAGTTGCTGAGAGTATGGAGGG - Intronic
1060444323 9:123673921-123673943 AGTGTTGGGGAGGGAAGGGAGGG - Intronic
1062260391 9:135659762-135659784 AGTGCTGCTGAGGGAATGGAAGG + Intergenic
1203626701 Un_KI270750v1:32333-32355 AGTTTTGGTGTGTAGATGGAGGG - Intergenic
1203630956 Un_KI270750v1:71841-71863 AGTGATGGTGAGTATGGGGATGG + Intergenic
1203633316 Un_KI270750v1:90189-90211 AGTGTTGGTGATTGTAAGGATGG + Intergenic
1187936382 X:24340204-24340226 AGTGTTGATGAGGTTGTGGAGGG + Intergenic
1188263809 X:28045562-28045584 AATGCTGGCGAGGATGTGGAGGG - Intergenic
1188485777 X:30680431-30680453 GGGGTTGGTGAGGATATAGAGGG + Intronic
1188973108 X:36641009-36641031 AGTGTTTGTCAGGCTCTGGAGGG - Intergenic
1189502052 X:41570548-41570570 TGTGGTGGGGAGGGTATGGAGGG - Intronic
1190597836 X:52065010-52065032 AGTGTAGGTGCTGATGTGGAAGG - Intronic
1190610988 X:52189063-52189085 AGTGTAGGTGCTGATGTGGAAGG + Intronic
1192026914 X:67463041-67463063 AGTGTTGGTGAGAATTTGAAGGG + Intergenic
1193058218 X:77177126-77177148 AGTGTTGATGTGTTTATGGATGG - Intergenic
1193159378 X:78210730-78210752 AATGCTGGTGAGGATGCGGAGGG - Intergenic
1193264693 X:79454519-79454541 GATGCTGGTGAGGATGTGGAGGG + Intergenic
1195343432 X:103926375-103926397 TGAGATTGTGAGGATATGGATGG + Intronic
1196774709 X:119327734-119327756 ACTGTAGGTGAGGTTGTGGATGG - Intergenic
1197996207 X:132377451-132377473 ACTGTTGATCAGGATTTGGATGG + Intronic
1198507830 X:137318813-137318835 AGGGTAGGTGAGGAAGTGGAAGG - Intergenic
1199096143 X:143742677-143742699 AGTGTTTGTGAGGGTATAAAGGG - Intergenic
1201070500 Y:10143629-10143651 GGTATTGGTGAGTATATGGGAGG - Intergenic
1201636828 Y:16132585-16132607 AGTGTTGGTGAGGAAGGGGTAGG - Intergenic
1201732829 Y:17223764-17223786 AGTGTATGTCAGGATAGGGAAGG - Intergenic